Cel-mir-254 is a spike-in control used for normalization and as an indicator of extraction efficiency in miRNA expression studies [PMC9263206] [PMC7868066] [PMC7708817] [PMC5908279] [PMC9571479] [PMC8005714] [PMC8317413]. It is a non-mammalian synthetic miRNA probe that is added to samples to assess RNA extraction efficiency and control for technical variation during the RNA extraction process [PMC7708817] [PMC8005714]. Cel-mir-254 is used in conjunction with other spike-in controls such as ath-miR-159a, cel-miR-248, osa-miR-414, and osa-miR-442 for normalization purposes in miRNA expression analysis using the nCounter® Human v.3 miRNA expression platform [PMC5908279] [PMC8317413]. It is added to each sample before lysis and denaturation to allow for normalization of technical variation that may occur during RNA extraction, reverse transcription, and other steps of the assay process. Cel-mir-254 has been used in various studies to assess miRNA expression patterns in different biological samples such as plasma and worms, providing valuable insights into gene regulation mechanisms and disease processes. For example, cel-mir-254 has been shown to exhibit differential expression patterns between wild-type worms and eat-2(ad1116) worms, indicating its potential role in modulating gene expression during aging processes in C. elegans [PMC4247386].
--acua -a AA -AU C - au ugcau uugccgccUACAG GC AGAUUU CACAaac c u ||||| ||||||||||||| || |||||| ||||||| | c acgua agcggcggauguC CG UCUAAA GUguuug g g uuuuug ca AG CUU C u ga
Accession | MIMAT0000310 |
Description | Caenorhabditis elegans cel-miR-254-3p mature miRNA |
Sequence | 59 - UGCAAAUCUUUCGCGAC - 75 |
Evidence |
experimental
Northern [1-2], PCR [1], Illumina [3] |
Database links | |
Predicted targets |
Accession | MIMAT0031891 |
Description | Caenorhabditis elegans cel-miR-254-5p mature miRNA |
Sequence | 19 - UACAGAAGCAUAGAUUUCCACA - 40 |
Evidence |
experimental
454 [2] |
Database links |
|