miRBase entry: cel-mir-239b

Stem-loop cel-mir-239b


Accession
MI0000315
Description
Caenorhabditis elegans cel-mir-239b precursor miRNA mir-239
Gene
family?
RF00713; mir-239

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Cel-mir-239b is a microRNA from Caenorhabditis elegans used as a negative control in various studies due to its minimal sequence identity with miRNAs in human, mouse, and rat [PMC2699527]. It is employed to differentiate the specific effects of other miRNAs being investigated, as it does not target human genes [PMC7708977]. In experiments involving the FXN gene, cel-mir-239b did not cause a decrease in FXN mRNA and protein levels, unlike specific human miRNAs such as hsa-miR-224-5p [PMC7253519]. This control microRNA is used across various cell types and conditions to ensure that observed effects can be attributed to the experimental miRNA rather than nonspecific effects of transfection or experimental manipulation [PMC7708977][PMC9617134][PMC4260481][PMC4546478[PMC9617134][PMC4260481][PMC4546478]. Cel-mir-239b is also used in gene regulation studies as a negative control to validate the specificity of miRNA-mimic or inhibitor effects on target gene expression [PMC6027187]. Additionally, it serves as a control in vivo when assessing the biological impact of other miRNAs on physiological processes or disease models [PMC5460990]. Overall, cel-mir-239b functions as an essential tool for validating experimental results by providing a baseline against which the activity of other microRNAs can be measured [PMC3743786][PMC8019740][PMC3572043][PMC6502783][PMC4308918][PMC5460990][PMC8019740][PMC3572043][PMC6502783][PMC4308918][PMC5460990][ PMC3422229] [ PMC4104030] .

Literature search
4 open access papers mention cel-mir-239b
(45 sentences)

Sequence

16083 reads, 130 reads per million, 14 experiments
gcgacagaugcaauuUUUGUACUACACAAAAGUACUGgucauuuaaguugaggcucaGCACUUUUGUGGUGUGCAAAAAuggcaaguugcuuuuaucu
(((((...(((.((((((((((..(((((((((.((((((.((......))))).))).)))))))))..)))))))))).))).)))))........

Structure
--------     aga   a          UA         A   -   a  ua 
        gcgac   ugc auuUUUGUAC  CACAAAAGU CUG guc uu  a
        |||||   ||| ||||||||||  ||||||||| ||| ||| ||   
        cguug   acg uAAAAACGUG  GUGUUUUCA Gac cgg ag  g
ucuauuuu     --a   g          UG         C   u   -  uu 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-239b was predicted by computational analysis and conservation in C. elegans and C. briggsae, and the microRNA confirmed by PCR amplification, cloning and sequencing [1]. A large scale cloning and sequencing study finds two dominant mature miRNA products: the second is 1 nt shorter at the 5' end [3].

Genome context
chrX: 11791302-11791399 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from cel-mir-239b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cel-miR-239b-5p

Accession MIMAT0000295
Description Caenorhabditis elegans cel-miR-239b-5p mature miRNA
Sequence 16 - UUUGUACUACACAAAAGUACUG - 37
Evidence experimental
cloned [3], Illumina [4], CLIPseq [5]
Database links
Predicted targets

Mature cel-miR-239b-3p

Accession MIMAT0015115
Description Caenorhabditis elegans cel-miR-239b-3p mature miRNA
Sequence 58 - GCACUUUUGUGGUGUGCAAAAA - 79
Evidence experimental
CLIPseq [5]
Database links

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  3. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  4. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  5. PubMed ID: 15317971
    Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification
    "Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB"
    "RNA (2004) 10:1309-1322