MIR222 is a microRNA implicated in various cellular processes, including adipogenesis and vascular smooth muscle cell (vSMC) proliferation [PMC8762293; PMC7123062].'>PMC7123062].. In 3T3-L1 cells, the lentivirus-mediated introduction of the MIR222 gene was shown to enhance adipogenesis, as evidenced by the increased expression of key adipogenic transcription factors C/EBPα and PPARγ [PMC8762293]. Further research has established a post-transcriptional interaction between MIR222 and stearoyl-CoA desaturase 5 (SCD5), as well as MIR222's role in the transcriptional regulation of myocyte enhancer factor 2C (MEF2C), through both in vitro and in vivo studies [PMC7584575]. Additionally, MIR222, along with miR221, is regulated by angiotensin-2 through its effect on the long non-coding RNA lncAng362; both microRNAs are associated with vSMC proliferation [PMC7123062]. The expression levels of MIR222 have also been analyzed in small extracellular vesicles (sEVs) and medium/large extracellular vesicles (m/lEVs), highlighting its presence across different extracellular compartments [PMC10056600].
gcu uaggua c au - AUC ucuu gcuggaaggug cc uca ggCUCAGUAGCCAG UGUAG CUg u ||||||||||| || ||| |||||||||||||| ||||| ||| c cgaucuucuac gg agu cUGGGUCAUCGGUC ACAUC gac g --u ------ u cu U GAc uaau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004569 |
Description | Homo sapiens hsa-miR-222-5p mature miRNA |
Sequence | 31 - CUCAGUAGCCAGUGUAGAUCCU - 52 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000279 |
Description | Homo sapiens hsa-miR-222-3p mature miRNA |
Sequence | 69 - AGCUACAUCUGGCUACUGGGU - 89 |
Evidence |
experimental
cloned [2-5], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|