miRBase entry: hsa-mir-222

Stem-loop hsa-mir-222


Accession
MI0000299
Symbol
HGNC: MIR222
Description
Homo sapiens hsa-mir-222 precursor miRNA mir-221
Gene
family?
RF00651; mir-221

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR222 is a microRNA implicated in various cellular processes, including adipogenesis and vascular smooth muscle cell (vSMC) proliferation [PMC8762293; PMC7123062].'>PMC7123062].. In 3T3-L1 cells, the lentivirus-mediated introduction of the MIR222 gene was shown to enhance adipogenesis, as evidenced by the increased expression of key adipogenic transcription factors C/EBPα and PPARγ [PMC8762293]. Further research has established a post-transcriptional interaction between MIR222 and stearoyl-CoA desaturase 5 (SCD5), as well as MIR222's role in the transcriptional regulation of myocyte enhancer factor 2C (MEF2C), through both in vitro and in vivo studies [PMC7584575]. Additionally, MIR222, along with miR221, is regulated by angiotensin-2 through its effect on the long non-coding RNA lncAng362; both microRNAs are associated with vSMC proliferation [PMC7123062]. The expression levels of MIR222 have also been analyzed in small extracellular vesicles (sEVs) and medium/large extracellular vesicles (m/lEVs), highlighting its presence across different extracellular compartments [PMC10056600].

Literature search
396 open access papers mention hsa-mir-222
(2020 sentences)

Sequence

1155219 reads, 3117 reads per million, 157 experiments
gcugcuggaagguguagguacccucaauggCUCAGUAGCCAGUGUAGAUCCUgucuuucguaaucagcAGCUACAUCUGGCUACUGGGUcucugauggcaucuucuagcu
...(((((((((((......((.(((..(((((((((((((((((((...(((...........)))...))))).))))))))))))))..))).))))))))))))).

Structure
gcu           uaggua  c   au              -     AUC   ucuu 
   gcuggaaggug      cc uca  ggCUCAGUAGCCAG UGUAG   CUg    u
   |||||||||||      || |||  |||||||||||||| |||||   |||    c
   cgaucuucuac      gg agu  cUGGGUCAUCGGUC ACAUC   gac    g
--u           ------  u   cu              U     GAc   uaau 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR was validated in zebrafish, and the ends mapped by cloning. Subsequent cloning studies have also verified the expression of miR-222 in human ES cells. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chrX: 45747015-45747124 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-222
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-222 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-222-5p

Accession MIMAT0004569
Description Homo sapiens hsa-miR-222-5p mature miRNA
Sequence 31 - CUCAGUAGCCAGUGUAGAUCCU - 52
Evidence experimental
cloned [4]
Database links
Predicted targets

Mature hsa-miR-222-3p

Accession MIMAT0000279
Description Homo sapiens hsa-miR-222-3p mature miRNA
Sequence 69 - AGCUACAUCUGGCUACUGGGU - 89
Evidence experimental
cloned [2-5], Northern [2]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540