MIR217 is a microRNA that has been observed to have varying expression levels in different biological contexts and disease states. In kidney renal papillary cell carcinoma (KIRP), MIR217, along with IGF2BP3 and NCAPG, showed higher expression in type 2 compared to type 1, suggesting a potential role in tumor differentiation or progression [PMC7744790]. In cancer studies, MIR217 has been implicated in the suppression of pulmonary metastasis when expressed in 6DT1 cells, although it did not significantly affect the primary tumor growth [PMC3912413]. Furthermore, MIR217 is known to downregulate SIRT1 mRNA and protein levels, which may contribute to vascular endothelial aging by weakening the antioxidant capacity [PMC9513221]. The interactions of MIR217 with other cellular components have been explored; for instance, its relationship with LINC01268 and SOS1 was investigated to understand its effects on cell viability, cycle progression, and apoptosis in acute myeloid leukemia (AML) cells [PMC7326380]. Additionally, MIR217 is known to interact with long non-coding RNA MALAT1 which can affect the regulatory interactions between miRNAs and mRNAs [PMC6351443]. In inflammatory conditions induced by TNBS (2,4,6-trinitrobenzenesulfonic acid), the expression of MIR217 was significantly downregulated; however, this effect was reversed by BEY-treatment which upregulated its expression [PMC9101272].
aguauaauuauuacaua uu c c a C C U - aag guuu gaugu g ag UA UGCAU AGGAACUGAU G GAu a |||| ||||| | || || ||||| |||||||||| | ||| caaa cuacg c uC GU ACGUA UCCUUGACUA c cug a --------------gaa -u a u C U A C a acu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000274 |
Description | Homo sapiens hsa-miR-217-5p mature miRNA |
Sequence | 35 - UACUGCAUCAGGAACUGAUUGGA - 57 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0037308 |
Description | Homo sapiens hsa-miR-217-3p mature miRNA |
Sequence | 72 - CAUCAGUUCCUAAUGCAUUGCC - 93 |
Evidence | not_experimental |
|