Accession
MI0000286
Symbol
HGNC:
MIR210
Description
Homo sapiens
hsa-mir-210 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR210 is a microRNA associated with inflammatory and hypoxic responses, and its expression is indicative of its role in various physiological and pathological processes [PMC7215947]. In the context of Parkinson's disease (PD), MIR210, along with other microRNAs, has been observed to change in expression levels, suggesting a potential role in the disease's pathogenesis [PMC7215947]. Additionally, MIR210 has been identified as a pro-angiogenic factor within a secretory body from the human ADSC line, which implies its therapeutic potential in chronic wound healing [PMC9742286]. In cancer research, MIR210 overexpression has been correlated with advanced stages of human hepatocellular carcinoma (HCC), poor survival outcomes, and higher recurrence rates post-chemotherapy [PMC8799276]. Experimental studies using transgenic mice have further established the importance of MIR210 by utilizing doxycycline-inducible transgenic mice to investigate its functions [PMC8088433]. The regulation of MIR210 by hypoxia-inducible factor 1-alpha (HIF-1α) has been demonstrated in activated T cells, reinforcing the connection between hypoxia responses and MIR210 expression [PMC3996831]. This relationship is further supported by findings that show HIF-1α's regulation precedes and potentially induces MIR210 expression under varying oxygen levels [PMC3996831], highlighting its significance in both cancer progression and immune responses as well as metabolic activity [PMC6862702].
Literature search
334 open access papers mention hsa-mir-210
(2490 sentences)
(2490 sentences)
Sequence
53214
reads,
423
reads per million, 159 experiments
acccggcagugccuccaggcgcagggcAGCCCCUGCCCACCGCACACUGcgcugccccagacccaCUGUGCGUGUGACAGCGGCUGAucugugccugggcagcgcgaccc
....((..((((.(((((((((((..(((((.(((..(((((((((.((.((((...))).).)).)))))).))).))).)))))..)))))))))))..))))..)).
....((..((((.(((((((((((..(((((.(((..(((((((((.((.((((...))).).)).)))))).))).))).)))))..)))))))))))..))))..)).
Structure
accc ca -c gg C CC - C c - c
gg gugc uccaggcgcag cAGCC CUG CAC CGCACA UG g cug
|| |||| ||||||||||| ||||| ||| ||| |||||| || | ||| c
cc cgcg ggguccguguc GUCGG GAC GUG GCGUGU ac c gac
---c ag ac uA C -A U C c a c
Annotation confidence
High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [2].
Genome context
chr11: 568089-568198 [-]
Disease association
hsa-mir-210 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-210-3p
| Accession | MIMAT0000267 |
| Description | Homo sapiens hsa-miR-210-3p mature miRNA |
| Sequence | 66 - CUGUGCGUGUGACAGCGGCUGA - 87 |
| Evidence |
experimental
cloned [2-4], Illumina [5] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-210-5p
| Accession | MIMAT0026475 |
| Description | Homo sapiens hsa-miR-210-5p mature miRNA |
| Sequence | 28 - AGCCCCUGCCCACCGCACACUG - 49 |
| Evidence |
experimental
Illumina [5] |
| Database links |
|
| Predicted targets |
|
References
|
