MIR203A is a microRNA whose expression is crucial for maintaining the epithelial phenotype, and its low expression levels have been observed in the A2780 cell line, which were not significantly altered by estrogen treatments [PMC7766742, PMC7308478].. The hypermethylation of the MIR203A gene is proposed as a potential marker for predicting metastasis in ovarian cancer (OvCa), indicating its significance in cancer progression [PMC8835734]. The genomic location of MIR203A is identified on chromosome 14, which suggests its distinct regulatory region compared to other microRNAs in the MIR200 family [PMC7766742]. In advanced-stage IV OvCa patients, MIR203A is one of six microRNAs found to have altered expression levels [PMC9599289]. The study aimed to explore the dependency of estrogen receptor alpha (ERα) on the expression of miR200s and MIR203A, highlighting the potential hormonal regulation of these microRNAs [PMC7766742].
g gg a u g c U G A - ug uguug g c cgc cgcuggguc AGUGGUUCU AACA UUCA CAGUU c u ||||| | | ||| ||||||||| ||||||||| |||| |||| ||||| | gcgac c g gcg gcggcccaG UCACCAGGA UUGU AAGU Guuaa g a a ag g c g A U A - c cg
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000264 |
Description | Homo sapiens hsa-miR-203a-3p mature miRNA |
Sequence | 65 - GUGAAAUGUUUAGGACCACUAG - 86 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() |
Accession | MIMAT0031890 |
Description | Homo sapiens hsa-miR-203a-5p mature miRNA |
Sequence | 27 - AGUGGUUCUUAACAGUUCAACAGUU - 51 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|