MIR199B is a microRNA implicated in various biological processes and disease states. Overexpression of MIR199B does not significantly alter HIF-1α mRNA or NFκB mRNA and protein levels [PMC3645752]. The specific PCR primers for MIR199B have been designed to amplify a 66 bp product [PMC3645752]. MIR199B deficiency in a mouse model leads to increased levels of ACR, BUN, Cr, and proteinuria, suggesting that MIR199B has a protective role that is lost when it is absent [PMC8257373]. In the context of SARS-CoV-2 infection, MIR199B is one of the differentially expressed pri-miRNAs that show increased levels in patients' plasma [PMC9677482]. In breast cancer (BC), MIR199B has been reported as up-regulated [PMC3828615], and it has been studied for its potential role in VEGF transcriptional activation and secretion [PMC4737258]. The microRNA also plays a role in cancer biology by inhibiting the transcription factor HES1, which leads to reduced pluripotency in cancer stem cells and decreased growth of medulloblastoma [PMC3645752]. Furthermore, higher expression levels of MIR199B are associated with shorter progression-free survival (PFS) in patients with certain cancers [PMC6183594].
a -acacc - c C U U U gacu cc gagg ucca cuc gucua CCAGUGU UAGACUA CUGU Cag c || |||| |||| ||| ||||| ||||||| ||||||| |||| ||| gg cucc gggu ggg cggAU GGUUACA GUCUGAU GACA guu c - cagauu c u U C - u aaac
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000263 |
Description | Homo sapiens hsa-miR-199b-5p mature miRNA |
Sequence | 26 - CCCAGUGUUUAGACUAUCUGUUC - 48 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004563 |
Description | Homo sapiens hsa-miR-199b-3p mature miRNA |
Sequence | 65 - ACAGUAGUCUGCACAUUGGUUA - 86 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|