miRBase entry: hsa-mir-199a-2

Stem-loop hsa-mir-199a-2


Accession
MI0000281
Symbol
HGNC: MIR199A2
Description
Homo sapiens hsa-mir-199a-2 precursor miRNA mir-199
Gene
family?
RF00144; mir-199

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR199A2 is a gene encoding the microRNA miR-199a-3p, located on chromosome 1, which is a region frequently altered in various cancer models [PMC3281082][PMC2683874[PMC2683874]. This gene is situated in the intron region of DNM3OS and has been implicated in the regulation of gene expression, including genes with anti-apoptotic functions [PMC8326843]. The promoter region of MIR199A2 has been cloned and analyzed, suggesting that its expression can be regulated at the transcriptional level [PMC2889129'>PMC3668635][PMC2889129[PMC2889129]. In epithelial ovarian cancer (EOC) cells, MIR199A2 has been identified as responsible for hsa-miR-199a expression [PMC2889129]. Furthermore, differential methylation of MIR199A2 has been observed in a pilot study, which may contribute to its regulation [PMC4446486]. In Alzheimer's disease (AD) patients' brains, MIR199A2 was found to be upregulated; however, its exact role in AD pathology remains unclear [PMC7564652]. Additionally, restoration of MIR199A2 expression was shown to impact cell invasiveness and metastatic formation in vitro and in vivo [PMC6335767], indicating its potential significance as a therapeutic target.

Literature search
397 open access papers mention hsa-mir-199a-2
(2653 sentences)

Sequence

4340079 reads, 7387.0 reads per million, 189 experiments
aggaagcuucuggagauccugcuccgucgcCCCAGUGUUCAGACUACCUGUUCaggacaaugccguuguACAGUAGUCUGCACAUUGGUUAgacugggcaagggagagca
.....(((.((.....((((((((.(((...(((((((.((((((((.(((.((((......))..)).))))))))))).)))))))...))).)))).))))))))).

Structure
aggaa   u  ggaga    -    c   gcC       U        C   U  --  ac 
     gcu cu     uccu gcuc guc   CCAGUGU CAGACUAC UGU Ca  gg  a
     ||| ||     |||| |||| |||   ||||||| |||||||| ||| ||  ||   
     cga ga     ggga cggg cag   GGUUACA GUCUGAUG ACA gu  cc  a
----a   -  -----    a    u   AUU       C        -   u  ug  gu 


Annotation confidence High
Do you think this miRNA is real?
Comments
Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2, MIR:MI0000281). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4].

Genome context
chr1: 172144535-172144644 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-199a-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-199a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-199a-5p

Accession MIMAT0000231
Description Homo sapiens hsa-miR-199a-5p mature miRNA
Sequence 31 - CCCAGUGUUCAGACUACCUGUUC - 53
Evidence experimental
cloned [2-4]
Database links
Predicted targets

Mature hsa-miR-199a-3p

Accession MIMAT0000232
Description Homo sapiens hsa-miR-199a-3p mature miRNA
Sequence 70 - ACAGUAGUCUGCACAUUGGUUA - 91
Evidence experimental
cloned [4], Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  4. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  5. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179