Accession
MI0000279
Symbol
HGNC:
MIR196A2
Description
Homo sapiens
hsa-mir-196a-2 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR196A2 is a non-coding RNA involved in the regulation of genes associated with lower limb development and has been implicated in clinical conditions related to infertility and pain severity [PMC4041413]. Specifically, the rs11614913 C allele of MIR196A2 has been linked to an increased risk of infertility with a significance level of p=0.016, and it is also associated with heightened pain severity, as indicated by a p-value of 0.012 [PMC5363543]. Contrasting the effects observed with MIR196A2, SNP rs7372209 in MIR26A1 did not show an association with clinical symptoms, highlighting the unique role that genetic variations in MIR196A2 may play in these conditions [PMC5363543].
Literature search
227 open access papers mention hsa-mir-196a-2
(1268 sentences)
(1268 sentences)
Sequence
156910
reads,
1227
reads per million, 95 experiments
ugcucgcucagcugaucuguggcuUAGGUAGUUUCAUGUUGUUGGGauugaguuuugaacuCGGCAACAAGAAACUGCCUGAGuuacaucagucgguuuucgucgagggc
..(((((..(((((((.((((((((((((((((((.((((((((((.((........)))))))))))).))))))))))))))))))...)))))))...).))))...
..(((((..(((((((.((((((((((((((((((.((((((((((.((........)))))))))))).))))))))))))))))))...)))))))...).))))...
Structure
-ug - -uc --c A a gag cucg c agcugau uguggcuUAGGUAGUUUC UGUUGUUGGG uu u |||| | ||||||| |||||||||||||||||| |||||||||| || gagc g uuggcug acauuGAGUCCGUCAAAG ACAACGGCuc aa u cgg u cuu acu A - guu
Annotation confidence
High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. miR-196a was later validated in human [3,4]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].
Genome context
chr12: 53991738-53991847 [+]
Disease association
hsa-mir-196a-2 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-196a-5p
| Accession | MIMAT0000226 |
| Description | Homo sapiens hsa-miR-196a-5p mature miRNA |
| Sequence | 25 - UAGGUAGUUUCAUGUUGUUGGG - 46 |
| Evidence |
experimental
cloned [3-5] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-196a-3p
| Accession | MIMAT0004562 |
| Description | Homo sapiens hsa-miR-196a-3p mature miRNA |
| Sequence | 62 - CGGCAACAAGAAACUGCCUGAG - 83 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
References
|
