miRBase entry: hsa-mir-183

Stem-loop hsa-mir-183


Accession
MI0000273
Symbol
HGNC: MIR183
Description
Homo sapiens hsa-mir-183 precursor miRNA mir-183
Gene
family?
RF00663; mir-183

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR183, a type of microRNA, was investigated in a study comparing its levels in the serum of mice with ototoxicity to levels in the cochlea and kidney using qRT-PCR [PMC6163699]. The study aimed to understand the role of MIR183 in ototoxicity and its potential as a biomarker [PMC6163699]. Additionally, MIR183 was found to be closely associated with lymph node metastasis in 54 sporadic MTCs [PMC8074316]. This suggests that MIR183 may play a role in the progression and metastasis of medullary thyroid carcinoma [PMC8074316]. The findings highlight the potential clinical significance of MIR183 as a biomarker for lymph node metastasis and its potential as a therapeutic target for medullary thyroid carcinoma [PMC8074316]. Further research is needed to elucidate the underlying mechanisms by which MIR183 contributes to these processes [PMC8074316]. The qRT-PCR analysis used in these studies provides quantitative data on microRNA expression levels, allowing for accurate comparisons between different tissues and conditions [PMC6163699]. Overall, these studies shed light on the involvement of MIR183 in ototoxicity and lymph node metastasis, providing valuable insights for future research and clinical applications [PMC6163699] [PMC8074316].

Literature search
202 open access papers mention hsa-mir-183
(1028 sentences)

Sequence

98249 reads, 635 reads per million, 129 experiments
ccgcagagugugacuccuguucugugUAUGGCACUGGUAGAAUUCACUgugaacagucucagucaGUGAAUUACCGAAGGGCCAUAAacagagcagagacagauccacga
.((..((.(.((.(((.((((((((.((((((.((((((..(((((((((((......)))..))))))))))))..)).)))))).))))))))))).)).)))..)).

Structure
c  ca  g g  a   c        g      A  --    GA        --   ac 
 cg  ga u ug cuc uguucugu UAUGGC CU  GGUA  AUUCACUg  uga  a
 ||  || | || ||| |||||||| |||||| ||  ||||  ||||||||  |||   
 gc  cu a ac gag acgagaca AUACCG GA  CCAU  UAAGUGac  acu  g
a  ac  - g  a   -        A      G  AG    --        ug   cu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression was later confirmed in human [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr7: 129774905-129775014 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-183
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-183 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-183-5p

Accession MIMAT0000261
Description Homo sapiens hsa-miR-183-5p mature miRNA
Sequence 27 - UAUGGCACUGGUAGAAUUCACU - 48
Evidence experimental
cloned [2-4]
Database links
Predicted targets

Mature hsa-miR-183-3p

Accession MIMAT0004560
Description Homo sapiens hsa-miR-183-3p mature miRNA
Sequence 66 - GUGAAUUACCGAAGGGCCAUAA - 87
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540