MIR181A2, a microRNA, is transcribed from the MIR181A2HG host gene and is implicated in various cellular processes, including the modulation of cancer progression and glucose metabolism [PMC6781644], [PMC9430013]. Its transcription is influenced by a multitude of transcription factors and is associated with enhancer and promoter regions, making it a significant target for research [PMC8979821]. MIR181A2 overexpression has been observed to downregulate PCAF mRNA and protein levels, suggesting a regulatory role in gene expression [PMC5573355]. Furthermore, MIR181A2 downregulation has been linked to increased HIV transcription and infectivity of progeny virus, indicating its potential role in HIV latency and reactivation mechanisms [PMC5573355]. The interaction between HIV's Env glycoprotein and cellular receptors can lead to the downregulation of MIR181A2, which may facilitate viral LTR acetylation and transcription upon cessation of HAART treatment [PMC5573355]. The modulation of PCAF expression by MIR181A2 further underscores its regulatory capacity in cellular signaling pathways [PMC5573355], while its host gene MIR181A2HG's overexpression in certain tissues suggests additional layers of regulatory complexity yet to be fully understood [PMC6380385], [PMC7891834], [PMC10111190].
agaagggcuaucaggccagccuuca A U CU A ggga gaggacuccaagg ACA UCAACG GUCGGUG GUuu u ||||||||||||| ||| |||||| ||||||| |||| u uuccugggguuCC UGU AGUUGC CAGUCAC CAaa u ------------------------a A C -- - aaag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000256 |
Description | Homo sapiens hsa-miR-181a-5p mature miRNA |
Sequence | 39 - AACAUUCAACGCUGUCGGUGAGU - 61 |
Evidence |
experimental
cloned [2,4-6] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004558 |
Description | Homo sapiens hsa-miR-181a-2-3p mature miRNA |
Sequence | 77 - ACCACUGACCGUUGACUGUACC - 98 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|