miRBase entry: hsa-mir-181a-2

Stem-loop hsa-mir-181a-2


Accession
MI0000269
Symbol
HGNC: MIR181A2
Description
Homo sapiens hsa-mir-181a-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR181A2, a microRNA, is transcribed from the MIR181A2HG host gene and is implicated in various cellular processes, including the modulation of cancer progression and glucose metabolism [PMC6781644], [PMC9430013]. Its transcription is influenced by a multitude of transcription factors and is associated with enhancer and promoter regions, making it a significant target for research [PMC8979821]. MIR181A2 overexpression has been observed to downregulate PCAF mRNA and protein levels, suggesting a regulatory role in gene expression [PMC5573355]. Furthermore, MIR181A2 downregulation has been linked to increased HIV transcription and infectivity of progeny virus, indicating its potential role in HIV latency and reactivation mechanisms [PMC5573355]. The interaction between HIV's Env glycoprotein and cellular receptors can lead to the downregulation of MIR181A2, which may facilitate viral LTR acetylation and transcription upon cessation of HAART treatment [PMC5573355]. The modulation of PCAF expression by MIR181A2 further underscores its regulatory capacity in cellular signaling pathways [PMC5573355], while its host gene MIR181A2HG's overexpression in certain tissues suggests additional layers of regulatory complexity yet to be fully understood [PMC6380385], [PMC7891834], [PMC10111190].

Literature search
487 open access papers mention hsa-mir-181a-2
(2580 sentences)

Sequence

2190059 reads, 4211 reads per million, 140 experiments
agaagggcuaucaggccagccuucagaggacuccaaggAACAUUCAACGCUGUCGGUGAGUuugggauuugaaaaaACCACUGACCGUUGACUGUACCuugggguccuua
.((((((((....)))...))))).(((((((((((((.(((.((((((..(((((((.((((...........))))))))))))))))).))).))))))))))))).

Structure
agaagggcuaucaggccagccuuca             A   U      CU       A    ggga 
                         gaggacuccaagg ACA UCAACG  GUCGGUG GUuu    u
                         ||||||||||||| ||| ||||||  ||||||| ||||    u
                         uuccugggguuCC UGU AGUUGC  CAGUCAC CAaa    u
------------------------a             A   C      --       -    aaag 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. and Lui et al. later verify expression in human [4-5].

Genome context
chr9: 124692442-124692551 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181a-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-181a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-181a-5p

Accession MIMAT0000256
Description Homo sapiens hsa-miR-181a-5p mature miRNA
Sequence 39 - AACAUUCAACGCUGUCGGUGAGU - 61
Evidence experimental
cloned [2,4-6]
Database links
Predicted targets

Mature hsa-miR-181a-2-3p

Accession MIMAT0004558
Description Homo sapiens hsa-miR-181a-2-3p mature miRNA
Sequence 77 - ACCACUGACCGUUGACUGUACC - 98
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  5. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73