Stem-loop hsa-mir-7-3

Accession

MI0000265

Symbol

HGNC: MIR7-3

Description

Homo sapiens hsa-mir-7-3 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR7-3 is one of the three genes encoding the mature miR-7 microRNA, which is involved in the regulation of gene expression, and is located in the intron of the PGSF1 gene on chromosome 19, not the PIT1-encoding gene [PMC7918072]. This gene, along with MIR7-1 and MIR7-2, contributes to miR-7 expression, with each locus being transcribed separately [PMC7918072]. MIR7-3 was selected for mutation screening in patients with normosmic congenital hypogonadotropic hypogonadism (ncHH) based on literature and bioinformatic analyses [PMC6479198]. However, no mutations were found in MIR7-3 among these patients, suggesting that it may not be commonly mutated in ncHH and that its encoded miRNA may not be implicated in this condition [PMC6479198]. The majority of miR-7 expression in the human pituitary is presumed to come from MIR7-3 due to its location within an intron of PGSF1 (pituitary gland specific factor 1) [PMC6479198]. Despite being widely expressed at low levels throughout various brain regions including the pituitary gland, it appears that mutations within this specific microRNA gene are not a common cause for ncHH [PMC4600152].

Literature search

335 open access papers mention hsa-mir-7-3
(2059 sentences)

Sequence

948403 reads, 6734 reads per million, 159 experiments

agauuagaguggcuguggucuagugcugugUGGAAGACUAGUGAUUUUGUUGUUcugauguacuacgacaacaagucacagccggccucauagcgcagacucccuucgac
......(((.((....(((((.((((((((.((..(.((.(((((((.((((((.((......)).))))))))))))))).)..)).))))))))))))))).)))...

Structure

agauua   u  cugu     a        U  AA A  A       U      c  au 
      gag gg    ggucu gugcugug GG  G CU GUGAUUU GUUGUU ug  g
      ||| ||    ||||| |||||||| ||  | || ||||||| |||||| ||   
      cuu cc    ucaga cgcgauac cc  c ga cacugaa caacag au  u
---cag   c  ----     -        u  gg c  -       -      c  ca 

Annotation confidence Not enough data

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression in human was later verified by cloning [1,2].

Genome context

chr19: 4770670-4770779 [+]

Disease association

hsa-mir-7-3 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-7-5p

• Accession: MIMAT0000252
• Description: Homo sapiens hsa-miR-7-5p mature miRNA
• Sequence: 31 - UGGAAGACUAGUGAUUUUGUUGUU - 54
• Evidence: experimental ; cloned [2-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540