MIR7-2 is a microRNA gene implicated in the regulation of lipid metabolism in the liver, specifically through its interaction with peroxisome proliferator-activated receptor (PPAR) [PMC6591351]. It is one of the fifteen microRNA candidate genes identified, and like its human counterparts MIR7-1 and MIR7-3, it contributes to the production of mature miR-7 [PMC6479198]. The gene is located in an intergenic region on chromosome 15 [PMC8004586], and its expression is regulated by PPAR-α, as evidenced by qRT-PCR analysis [PMC5762714]. Additionally, transcription factors such as Forkhead box P3 (FOXP3) and Hepatocyte Nuclear Factor 4 alpha (HNF4α) have been shown to positively regulate miR-7 expression by binding to MIR7 promoter regions [PMC4600152]'>PMC4600152], with RELA also identified as a direct binding factor to MIR7 promoter regions [PMC4600152]. The transcriptional regulation of miR-7 involves separate loci for each gene encoding it—MIR7-1 on chromosome 9q21, MIR7-2 on chromosome 15q26, and MIR7-3 on chromosome 19q13—highlighting the complexity of its regulatory mechanisms [PMC7918072].
cuggauacaga acc c cU A A U U ucuua gugg ggcuggc ccau GG AGACU G GAUUU GUUGUUg c |||| ||||||| |||| || ||||| | ||||| ||||||| cgcu ccgaccg gguA CC UCUGA C CUAAA CAACaac u ----------a --a u AU A C - - ucgcg
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000252 |
Description | Homo sapiens hsa-miR-7-5p mature miRNA |
Sequence | 32 - UGGAAGACUAGUGAUUUUGUUGUU - 55 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004554 |
Description | Homo sapiens hsa-miR-7-2-3p mature miRNA |
Sequence | 72 - CAACAAAUCCCAGUCUACCUAA - 93 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|