miRBase entry: hsa-mir-129-1

Stem-loop hsa-mir-129-1


Accession
MI0000252
Symbol
HGNC: MIR129-1
Description
Homo sapiens hsa-mir-129-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR129-1, a microRNA involved in gene expression regulation, is transcribed from a genomic locus that includes several underexpressed miRNAs in SMZL [PMC8064455], [PMC8138178]. There is no direct evidence suggesting that MIR129-1 is affected by miRNA eQTL mechanisms due to the proximity of a Parkinson’s disease risk SNP to MIR132, as the original context refers to MIR132 and not MIR129-1 [PMC9645562]. MIR129-1 is implicated in various biological processes including cell proliferation and migration, and its dysregulation has been observed post-spinal cord injury [PMC6394761], [PMC6515063]. Additionally, miR-129-5p, produced by MIR129-1, has been recognized for its role in liver function improvement and anti-inflammatory effects in liver disease models [PMC8138178]. While there is no CpG island near the MIR129-1 promoter, unlike MIR129-2, both are important for transcriptional regulation and are located on different chromosomes [PMC3576298]. Experimental studies on hypoxia have utilized transfection of MIR129-1 mimic to assess its expression under such conditions using qPCR with specific TaqMan probes for validation [PMC7399878].

Literature search
120 open access papers mention hsa-mir-129-1
(1023 sentences)

Sequence

58241 reads, 320 reads per million, 99 experiments
ggauCUUUUUGCGGUCUGGGCUUGCuguuccucucaacaguagucaggAAGCCCUUACCCCAAAAAGUAUcu
(((((((((((.(((..((((((.(((..(..((....))..).))).))))))..))).))))))).))))

Structure
    -       C   CU      G   uu cu  c 
ggau CUUUUUG GGU  GGGCUU Cug  c  cu a
|||| ||||||| |||  |||||| |||  |  ||  
ucUA GAAAAAC CCA  CCCGAA gac  g  ga a
    U       C   UU      g   -u au  c 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MIR:MI0000473) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgraf et al. show that the 5' product of mir-129-1 (this entry) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (MIR:MI0000585) [3].

Genome context
chr7: 128207872-128207943 [+]

Disease association
hsa-mir-129-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-129-5p

Accession MIMAT0000242
Description Homo sapiens hsa-miR-129-5p mature miRNA
Sequence 5 - CUUUUUGCGGUCUGGGCUUGC - 25
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-129-1-3p

Accession MIMAT0004548
Description Homo sapiens hsa-miR-129-1-3p mature miRNA
Sequence 49 - AAGCCCUUACCCCAAAAAGUAU - 70
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739