WARNING: This summary was generated by AI. MIR197 is a microRNA that has been identified as a key player in various biological processes and diseases. It is one of several miRNAs whose expression is altered immediately after a single bout of resistance training, suggesting a role in muscle adaptation or recovery [PMC8505326]. In the context of cancer, MIR197 has been associated with the regulation of PD-L1 expression and may serve as a potential surrogate biomarker for PD-L1 levels in certain cancers, including non-small cell lung cancer (NSCLC) [PMC7529545]. Moreover, MIR197 levels have been measured in sera using quantitative real-time PCR, indicating its potential as a biomarker for various physiological states or conditions [PMC7414326]. It also appears to have an inverse correlation with glycemia in the context of insulin resistance [PMC6197154] and plays an important role in maintaining embryogenic callus in rice [PMC10049443]. In breast cancer research, an up-regulation of MIR197 has been observed that had not been previously reported [PMC2850898]. Additionally, changes in MIR197 levels have been associated with metabolic syndrome [PMC8793096] and it may interact with single nucleotide polymorphisms (SNPs) to influence gene expression related to diseases such as hepatocellular carcinoma (HCC) [PMC9712371]. Furthermore, microRNAs including MIR197 can influence cancer cell proliferation and dormancy related to bone marrow metastasis [PMC4699086]. Lastly, it has been identified that MIR197 targets the tumor suppressor protein FUS1 which could have implications for its role in tumorigenesis [PMC3877139].
C A CA A - a
ggcugugc GGGU GAGAGGG GUGGG GGu aag g
|||||||| |||| ||||||| ||||| ||| |||
ccgguaCG CCCA CUCUUCC CACUU cca uuc c
A C AC c c u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000227 |
| Description | Homo sapiens hsa-miR-197-3p mature miRNA |
| Sequence | 48 - UUCACCACCUUCUCCACCCAGC - 69 |
| Evidence |
experimental
cloned [1-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022691 |
| Description | Homo sapiens hsa-miR-197-5p mature miRNA |
| Sequence | 9 - CGGGUAGAGAGGGCAGUGGGAGG - 31 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|