MIR196A1 is a microRNA gene located within the homeobox (HOX) gene clusters on human chromosome 17q21.32 and plays a role in gene expression regulation [PMC5533727]. It belongs to the miR-196 family, which includes MIR196A2 and MIR196B, and it shares identical mature nucleotide sequences with MIR196A2 [PMC4413621]. This family of miRNAs is involved in various biological processes and diseases, with MIR196A1 expression being correlated with obesity-related traits such as body fat percentage and waist circumference [PMC5551414]. Additionally, MIR196A1 is linked to the regulation of HOX genes, associating with HOXB7, HOXB8, and HOTAIR [PMC5551414]. Aberrant expression of MIR196A1 has been noted in pancreatic cancer cells, influencing apoptosis, invasion, and proliferation [PMC4454596]. Furthermore, MIR196A1 is significant in cancer biology and serves as a potential biomarker for endometrial carcinoma (ECa) [PMC10134363]. Contrary to previous claims, there have been reports of aberrant methylation of MIR196A1 in human cancers, and methylation levels of this miRNA are inversely associated with the duration of smoking cessation [PMC5960087].
A A C - Gc ugg gugaauU GGU GUUU AUGUUGUUG G c g ||||||| ||| |||| ||||||||| | | u cacuuAG CCA CAAA UACAACAAC c g u C C U a aa ucu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000226 |
Description | Homo sapiens hsa-miR-196a-5p mature miRNA |
Sequence | 7 - UAGGUAGUUUCAUGUUGUUGGG - 28 |
Evidence |
experimental
cloned [3-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0037307 |
Description | Homo sapiens hsa-miR-196a-1-3p mature miRNA |
Sequence | 45 - CAACAACAUUAAACCACCCGA - 65 |
Evidence | not_experimental |
|