MIR192 is a microRNA that has been implicated in a variety of pathological conditions, including diabetes and heart failure [PMC5376412, PMC8773242].'>PMC8773242].. Research involving diabetic mice has shown that MIR192 levels are elevated in the renal cortex, which suggests a role in the development of diabetic nephropathy [PMC5376412]. MIR192 is also being considered as a potential biomarker for heart failure, as it is found in exosomes that could be used for early detection of the disease [PMC8773242]. The recurrent observation of increased MIR192 levels in these conditions underscores its potential importance as a biomarker and as a target for therapeutic intervention [PMC5376412, PMC8773242]..
gccgagacc u -- g g C - A ugcucuc
gag gc aca g cu UGACCUAUG AAUUG CAGCCag g
||| || ||| | || ||||||||| ||||| |||||||
cuc cg ugu u GA ACUGGAUAC UUAAC GUCgguc u
cgaccguaa - cu a g C C C uccccuc
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000222 |
| Description | Homo sapiens hsa-miR-192-5p mature miRNA |
| Sequence | 24 - CUGACCUAUGAAUUGACAGCC - 44 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004543 |
| Description | Homo sapiens hsa-miR-192-3p mature miRNA |
| Sequence | 67 - CUGCCAAUUCCAUAGGUCACAG - 88 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
|