miRBase entry: hsa-mir-107

Stem-loop hsa-mir-107


Accession
MI0000114
Symbol
HGNC: MIR107
Description
Homo sapiens hsa-mir-107 precursor miRNA mir-103
Gene
family?
RF00129; mir-103

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

The microRNA hsa-mir-107 has been identified as significantly upregulated in the FGD5-AS1 KD CCC-HEH-2 cell line, which could indicate its involvement in specific cellular functions within this system [PMC8144506]. This cell line originates from cholangiocarcinoma, a cancer affecting the bile ducts, and the observed upregulation of hsa-mir-107 suggests it may influence the behavior of these cancer cells [PMC8144506]. In addition, hsa-mir-107 is also recognized for its potential tumor-suppressive effects in non-small cell lung cancer (NSCLC) cells, highlighting its relevance in cancer research [PMC6981095]. The connections of hsa-mir-107 with various cancer types underscore its significance in the field of cancer biology and emphasize the need for further studies to elucidate its role and therapeutic possibilities [PMC8144506; PMC6981095]..

Literature search
185 open access papers mention hsa-mir-107
(941 sentences)

Sequence

4415819 reads, 14654 reads per million, 155 experiments
cucucugcuuucagcuucuuuacaguguugccuuguggcauggaguucaAGCAGCAUUGUACAGGGCUAUCAaagcacaga
.(((.((((((.((((.((.(((((((((((.(((.(((.....))))))))))))))))).))))))...)))))).)))

Structure
c   c      --c    u  u           c   u   a 
 ucu ugcuuu   agcu cu uacaguguugc uug ggc u
 ||| ||||||   |||| || ||||||||||| ||| ||| g
 aga acgaaA   UCGG GA AUGUUACGACG Aac uug g
-   c      CUA    -  C           -   -   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA was identified by homology to miR-103 [1], and later verified by cloning in human [2].

Genome context
chr10: 89592747-89592827 [-]

Disease association
hsa-mir-107 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-107

Accession MIMAT0000104
Description Homo sapiens hsa-miR-107 mature miRNA
Sequence 50 - AGCAGCAUUGUACAGGGCUAUCA - 72
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728