MIR29B2 is a microRNA that has been implicated in various biological processes and diseases, including cancer. However, there is currently a lack of data on the specific role of MIR29B2 and its host gene MIR29B2CHG in cancer [PMC7859645]. In MDA-MB-231S cells, knockdown of LASP-1 resulted in the upregulation of two key microRNAs, miR29B1 and MIR29B2, which correlated with reduced levels of matrix metalloproteinase 9 (MMP9) [PMC4651668]. In humans, two genes on different chromosomes (MIR29B1 on chromosome 7 and MIR29B2 on chromosome 1) encode two precursors that give rise to mature miR-29b-1 and miR-29b-2 with identical sequences [PMC5643533]. Activation of MIR29B2 has been shown to inhibit the expression of the monocarboxylate transporter 1 (MCT1), leading to a disruption in insulin secretion [PMC7795239]. Differential expression of MIR29B2 has also been observed in late-relapse Hodgkin lymphoma samples compared to early-relapse samples [PMC7667426]. Furthermore, alterations in the expression levels of MIR29B2 have been associated with cancer-related genomic regions [PMC2683874]. Additionally, MIR29B2 has been identified as one of several differentially expressed genes (DEGs) in late-relapse Hodgkin lymphoma samples compared to early-relapse samples [PMC8345394]. Finally, elevated levels of miR-29b family members including MIR29B2 have been observed in a mouse brain endothelial cell line under conditions associated with elevated homocysteine levels [PMC6651274].
- C G U uuuucc cuucuggaa gCUGGUUUCA AUGGUG CU AGau a ||||||||| |||||||||| |||||| || |||| gaggauuUU UGACUAAAGU UACCAC GA Ucua u G U - - uguuuc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000100 |
Description | Homo sapiens hsa-miR-29b-3p mature miRNA |
Sequence | 52 - UAGCACCAUUUGAAAUCAGUGUU - 74 |
Evidence |
experimental
cloned [1-4], Northern [2] |
Database links | |
Predicted targets |
Accession | MIMAT0004515 |
Description | Homo sapiens hsa-miR-29b-2-5p mature miRNA |
Sequence | 11 - CUGGUUUCACAUGGUGGCUUAG - 32 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|