Stem-loop hsa-mir-29b-2

Accession

MI0000107

Symbol

HGNC: MIR29B2

Description

Homo sapiens hsa-mir-29b-2 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR29B2 is a microRNA gene located on chromosome 1, encoding a precursor miRNA that is processed into mature miR-29bs, which have identical sequences to those encoded by MIR29B1 on chromosome 7 [PMC5643533]. MIR29B2 has been implicated in various cellular processes and its role in cancer has been observed, such as being up-regulated in late-relapse Hodgkin lymphoma samples [PMC7667426]. In MDA-MB-231S cells, the knockdown of LASP-1 led to the upregulation of MIR29B2 and a decrease in MMP9 transcript levels [PMC4651668]. MIR29B2 also inhibits the expression of its target gene MCT1 when activated by MAPK signaling cascades, potentially affecting insulin secretion [PMC7795239]. MicroRNAs, including MIR29B2, are frequently located in chromosomal regions susceptible to alterations in cancer models, with MIR29B2 specifically situated on the long arm of chromosome 1 [PMC2683874]. Differential expression of MIR29B2 has been noted not only in late-relapse Hodgkin lymphoma samples compared to early-relapse samples but also among precursor RNAs in various biological contexts [PMC6801644]. Additionally, in mouse brain endothelial cells exposed to homocysteine, an increase in miR-29b family members, including MIR29B2, was observed [PMC6651274].

Literature search

652 open access papers mention hsa-mir-29b-2
(4396 sentences)

Sequence

344587 reads, 2264 reads per million, 138 experiments

cuucuggaagCUGGUUUCACAUGGUGGCUUAGauuuuuccaucuuuguaucUAGCACCAUUUGAAAUCAGUGUUuuaggag
(((((((((((((((((((.((((((.((.((((..............)))))))))))).)))))))))).)))))))))

Structure

         -          C      G  U    uuuucc 
cuucuggaa gCUGGUUUCA AUGGUG CU AGau      a
||||||||| |||||||||| |||||| || ||||       
gaggauuUU UGACUAAAGU UACCAC GA Ucua      u
         G          U      -  -    uguuuc 

Annotation confidence High

Comments

This sequence was named mir-102-1 in reference [1]. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.

Genome context

chr1: 207802443-207802523 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-29b-2

Disease association

hsa-mir-29b-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-29b-3p

• Accession: MIMAT0000100
• Description: Homo sapiens hsa-miR-29b-3p mature miRNA
• Sequence: 52 - UAGCACCAUUUGAAAUCAGUGUU - 74
• Evidence: experimental ; cloned [1-4], Northern [2]

Mature hsa-miR-29b-2-5p

• Accession: MIMAT0004515
• Description: Homo sapiens hsa-miR-29b-2-5p mature miRNA
• Sequence: 11 - CUGGUUUCACAUGGUGGCUUAG - 32
• Evidence: experimental ; cloned [3]

References

1. PubMed ID: 15183728
   Human embryonic stem cells express a unique set of microRNAs
   "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
   "Dev Biol (2004) 270:488-498


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


4. PubMed ID: 11914277
   miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
   "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
   "Genes Dev (2002) 16:720-728