MIR29B1 is a microRNA gene that encodes for the miR-29b-3p sequence, a member of the miR-29 family, which is implicated in various cellular processes and diseases [PMC9601486]. In the context of Alzheimer's disease (AD), MIR29B1 has been found to be downregulated in the cortex of AD patients, suggesting a potential role in the disease's pathogenesis [PMC7564652]. This downregulation may influence AD by targeting genes directly involved in its pathogenesis, such as BACE1, which is involved in amyloid precursor protein processing [PMC7564652]. Additionally, MIR29B1's downregulation could indirectly affect neuron survival and thus contribute to AD progression [PMC7564652]. In other studies, MIR29B1 has been associated with various biological processes; for instance, it has been implicated in increasing milk yield in dairy cattle when co-expressed with MIR148A [PMC6898964], and its upregulation was observed upon knockdown of LASP-1 correlating with reduced MMP9 transcript levels in MDA-MB-231S cells [PMC4651668]. Furthermore, mutations in MIR29B1 have been linked to altered physiological responses such as reduced urine volume and increased renal fibrosis under certain dietary conditions in rats [PMC6156712], highlighting its significance beyond neurodegenerative diseases.
- - U GU uuaaa cuucaggaa GCUGGUUUCA AUGGUG UUAGAu u ||||||||| |||||||||| |||||| |||||| a gggguucUU UGACUAAAGU UACCAC GAUcug g g G U -- uuagu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004514 |
Description | Homo sapiens hsa-miR-29b-1-5p mature miRNA |
Sequence | 10 - GCUGGUUUCAUAUGGUGGUUUAGA - 33 |
Evidence |
experimental
cloned [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000100 |
Description | Homo sapiens hsa-miR-29b-3p mature miRNA |
Sequence | 51 - UAGCACCAUUUGAAAUCAGUGUU - 73 |
Evidence |
experimental
cloned [1-4], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|