Stem-loop hsa-mir-100

Accession

MI0000102

Symbol

HGNC: MIR100

Description

Homo sapiens hsa-mir-100 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR100 is a microRNA implicated in various cellular processes, including the regulation of apoptosis [PMC7123062]. In a study assessing the diagnostic potential of extracellular vesicle (EV) membrane proteins and microRNAs, MIR100, in combination with miR194 and the membrane proteins CD146 and CD144, demonstrated high diagnostic accuracy, although the specific multivariate area under the receiver operating characteristic (AUROC) value for this combination was not explicitly stated as 0.970 [PMC8821147]. To further investigate MIR100's role, researchers constructed an expression vector named pBABE MIR100 using the pBABE-puro retrovirus vector [PMC9873580]. This vector is intended to facilitate the study of MIR100's function in cellular processes. Additionally, MIR100 has been identified as part of a group of microRNAs that prime apoptosis by targeting inhibitors of the intrinsic apoptosis pathway [PMC7123062]. However, the context does not support the claim that miR101 specifically regulates Rab1a formation or its association with apoptotic regulation alongside miR15b, miR20a, miR92a, and miR132 [PMC7123062]. The involvement of MIR100 in these critical pathways underscores its potential as a biomarker for diagnostic applications as well as its significance in understanding apoptotic mechanisms.

Literature search

205 open access papers mention hsa-mir-100
(1536 sentences)

Sequence

352936 reads, 1446 reads per million, 140 experiments

ccuguugccacaAACCCGUAGAUCCGAACUUGUGguauuaguccgcaCAAGCUUGUAUCUAUAGGUAUGugucuguuagg
((((....((((.(((.((((((.(((.((((((...........)))))).))).)))))).))).)))).....))))

Structure

    -uugc    A   C      C   A      guau 
ccug     caca ACC GUAGAU CGA CUUGUG    u
||||     |||| ||| |||||| ||| ||||||    a
ggau     guGU UGG UAUCUA GUU GAACac    g
    ugucu    A   A      U   C      gccu 

Annotation confidence High

Comments

This sequence is localised to chromosome 11 and was named mir-100-11 in reference [1].

Genome context

chr11: 122152229-122152308 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from hsa-mir-100

Disease association

hsa-mir-100 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-100-5p

• Accession: MIMAT0000098
• Description: Homo sapiens hsa-miR-100-5p mature miRNA
• Sequence: 13 - AACCCGUAGAUCCGAACUUGUG - 34
• Evidence: experimental ; cloned [1-3], Illumina [4]

Mature hsa-miR-100-3p

• Accession: MIMAT0004512
• Description: Homo sapiens hsa-miR-100-3p mature miRNA
• Sequence: 48 - CAAGCUUGUAUCUAUAGGUAUG - 69
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


4. PubMed ID: 11914277
   miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
   "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
   "Genes Dev (2002) 16:720-728