MIR98 is a microRNA implicated in the regulation of breast cancer metastasis, as evidenced by in vivo experiments where MDA-MB-231 breast cancer cells, infected with a lentivirus carrying MIR98, were inoculated into the mammary fat pads of nude mice and stimulated with CCL18 [PMC4653020]. This microRNA was among seven selected for validation of array-based expression data using Taqman quantitative RT-PCR, highlighting its significance in the study [PMC3288043]. Furthermore, MIR98 is involved in a regulatory pathway where its expression is increased upon the silencing of N-Ras, leading to the inactivation of the ERK/PI3K/NFκB/Lin28b pathway and loss of its inhibitor Lin28b; this upregulation of MIR98 contributes to further inhibition of N-Ras expression [PMC4653020].
a uc - U U --------- aggg ggau ugcu caugccaggg GAGGUAGUAAGUUGUAU GUUg uggggu a |||| |||| |||||||||| ||||||||||||||||| |||| |||||| u cuua acgg gugugguCCC UUUCAUCAUUCAACAUA Caau accccg a a -u u - U agaagauua gauu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000096 |
Description | Homo sapiens hsa-miR-98-5p mature miRNA |
Sequence | 22 - UGAGGUAGUAAGUUGUAUUGUU - 43 |
Evidence |
experimental
cloned [1-3], SOLiD [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0022842 |
Description | Homo sapiens hsa-miR-98-3p mature miRNA |
Sequence | 80 - CUAUACAACUUACUACUUUCCC - 101 |
Evidence |
experimental
SOLiD [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|