Hsa-mir-33a, a microRNA, has been implicated in various cellular processes and diseases, including cancer. In hepatocellular carcinoma (HCC), a reduction in hsa-mir-33a levels is linked to tumorigenesis and is indicative of a poor prognosis [PMC8615810]. Additionally, hsa-mir-33a plays a role in modulating the resistance of HCC cells to the chemotherapy drug cisplatin [PMC9200351]. In macrophages, hsa-mir-33a mimic treatment results in decreased expression of proteins involved in autophagy compared to control treatments [PMC4873392]. Dysregulation of hsa-mir-33a has also been observed in patients with HIV, where it is consistently downregulated [PMC8615810]. Furthermore, it serves as a hub gene within ceRNA networks associated with esophageal cancer (EC) progression [PMC9200351], and hypomethylation at the SREBF2 gene body including the hsa-mir-33a locus may lead to SREBF2 downregulation [PMC9789638]. Hsa-mir-33a also influences gestational diabetes mellitus (GDM) through its regulatory effects on genes like MAP4K3 which are hypomethylated and upregulated in GDM [PMC8257864]. Lastly, it is part of an 8-miRNA signature identified as having significant prognostic potential for colorectal cancer (CRC) patients [PMC8299930]. The statement about hsa-mir-33a regulating the expression of neuropilin-2 and inhibiting glioblastoma cell migration has been removed as it incorrectly referred to hsa-mir-331 instead of hsa-mir-33a [PMC8843861].
A UU uucu g cugugGUGCAUUGU G GCAUUGCAug ggu |||||||||||||| | |||||||||| ||| g gaCACUACGUGACA C UGUAACguac cca C UU ---- u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000091 |
Description | Homo sapiens hsa-miR-33a-5p mature miRNA |
Sequence | 6 - GUGCAUUGUAGUUGCAUUGCA - 26 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004506 |
Description | Homo sapiens hsa-miR-33a-3p mature miRNA |
Sequence | 46 - CAAUGUUUCCACAGUGCAUCAC - 67 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|