MIR29A is a microRNA involved in various biological processes, including matrix remodeling and fibrosis, as indicated by its formation being primed by myocardin [PMC7123062]. In the context of lung cancer, MIR29A levels were found to be significantly lower in patients with non-small cell lung cancer (NSCLC) compared to small cell lung cancer (SCLC) [PMC9987486]. Additionally, MIR29A is differentially expressed in Parkinson's disease (PD) compared with vascular parkinsonism (VP), suggesting its potential role in disease-specific pathologies [PMC8407885]. However, its elevated expression has been associated with poor patient survival across various conditions, suggesting a prognostic role for MIR29A [PMC6368411]. In the liver, TGF-β1 may induce Fstl1 partially through the downregulation of MIR29A, and there appears to be a reciprocal regulatory relationship between Fstl1 and MIR29A in hepatic stellate cells (HSCs) [PMC7493388]. Furthermore, upregulation of MIR29A has been observed in breast cancer stem cells (BCSCs), aggressive breast cancer cell lines, and breast cancer tissues [PMC9102147], highlighting its potential involvement in tumor aggressiveness. Lastly, research on liver fibrosis has underscored the importance of MIR29A during the regression of this condition [PMC6412626].
UUU C ucaa augACUGAUUUC UGGUGUU AGag u |||||||||||| ||||||| |||| a uAUUGGCUAAAG ACCACGA Ucuu u UCU - uuaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004503 |
Description | Homo sapiens hsa-miR-29a-5p mature miRNA |
Sequence | 4 - ACUGAUUUCUUUUGGUGUUCAG - 25 |
Evidence |
experimental
cloned [6] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000086 |
Description | Homo sapiens hsa-miR-29a-3p mature miRNA |
Sequence | 42 - UAGCACCAUCUGAAAUCGGUUA - 63 |
Evidence |
experimental
cloned [1-3,5-7], Northern [1,4], Illumina [8] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|