miRBase entry: hsa-mir-28

Stem-loop hsa-mir-28


Accession
MI0000086
Symbol
HGNC: MIR28
Description
Homo sapiens hsa-mir-28 precursor miRNA mir-28
Gene
family?
RF00655; mir-28

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

hsa-mir-28 is a microRNA that has been identified as one of several miRNAs overexpressed in resting CD4+ T cells, which target the 3' end of the HIV-1 RNA, leading to the silencing of viral protein transcription [PMC4070032]. This miRNA has also been observed to have lower expression levels in monomorphic malignant ventricular premature contractions (MMVP) specimens compared to focal ectopic dysplasia (FED) samples, suggesting a potential role in cardiac conditions [PMC4881574]. Studies on hsa-mir-28-5p, a specific variant of hsa-mir-28, have shown that it generally exerts an inhibitory effect on tumor cells in vitro [PMC8752235]. Furthermore, hsa-mir-28 is part of a group that includes the hsa-miR-548 family and is derived from genetic elements that contribute to its expression and function [PMC2952848]. Despite its involvement in various biological processes and conditions, hsa-mir-28 has been identified as one of the less frequently highly expressed miRNAs in certain contexts [PMC4486185].

Literature search
90 open access papers mention hsa-mir-28
(309 sentences)

Sequence

150523 reads, 644 reads per million, 158 experiments
gguccuugcccucAAGGAGCUCACAGUCUAUUGAGuuaccuuucugacuuuccCACUAGAUUGUGAGCUCCUGGAgggcaggcacu
(((.(((((((((.((((((((((((((((.(((((((......)))))....)).)))))))))))))))).))))))))).)))

Structure
   c         A                U  ----     cc 
ggu cuugcccuc AGGAGCUCACAGUCUA UG    AGuua  u
||| ||||||||| |||||||||||||||| ||    |||||   
uca ggacgggAG UCCUCGAGUGUUAGAU AC    ucagu  u
   c         G                C  ccuu     cu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr3: 188688781-188688866 [+]

Disease association
hsa-mir-28 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-28-5p

Accession MIMAT0000085
Description Homo sapiens hsa-miR-28-5p mature miRNA
Sequence 14 - AAGGAGCUCACAGUCUAUUGAG - 35
Evidence experimental
cloned [1-3], Northern [1]
Database links
Predicted targets

Mature hsa-miR-28-3p

Accession MIMAT0004502
Description Homo sapiens hsa-miR-28-3p mature miRNA
Sequence 54 - CACUAGAUUGUGAGCUCCUGGA - 75
Evidence experimental
cloned [2-4]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52