MIR26B is a microRNA implicated in the regulation of gene expression, specifically involved in the repression of EZH2, an enzyme that contributes to gene silencing through histone methylation [PMC6925750]. The genetic locus of MIR26B has been experimentally manipulated by incorporating loxP sites, a technique that allows for the conditional deletion of the 160 base pair segment of genomic DNA containing MIR26B [PMC8243710]. This modification is significant for research as it enables scientists to study the functional consequences of MIR26B deletion on EZH2 expression and potentially on broader genomic regulation mechanisms.
ga - U UC u ug ccgg ccc agU CAAGUAAU AGGAUAGGUug g c |||| ||| ||| |||||||| ||||||||||| | ggcc ggg UCG GUUCAUUA UCUUGUCCgac c u ag c - CC - ug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000083 |
Description | Homo sapiens hsa-miR-26b-5p mature miRNA |
Sequence | 12 - UUCAAGUAAUUCAGGAUAGGU - 32 |
Evidence |
experimental
cloned [1,3-5], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004500 |
Description | Homo sapiens hsa-miR-26b-3p mature miRNA |
Sequence | 47 - CCUGUUCUCCAUUACUUGGCU - 67 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|