miRBase entry: hsa-mir-24-1

Stem-loop hsa-mir-24-1


Accession
MI0000080
Symbol
HGNC: MIR24-1
Description
Homo sapiens hsa-mir-24-1 precursor miRNA mir-24
Gene
family?
RF00178; mir-24

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR24-1, a microRNA, is implicated in various biological processes and diseases, with its recognition sequence identified in the 3′UTR of the human SLITRK1 gene [PMC4215120]. This sequence shares a 91% nucleotide identity with its porcine counterpart [PMC4215120]. MIR24-1 is associated with conditions such as familial breast cancer and cervical cancer and is conserved across species, clustering with miR-23 and miR-27 on human chromosomes 9 and 19 [PMC4215120]. Overexpression of MIR24-1 enhances H3K27ac levels at numerous enhancers, suggesting a regulatory role in gene expression [PMC8954937]. In the context of long-term potentiation (LTP), MIR24-1 appears to be downregulated to permit the expression of certain genes [PMC3393663]'>PMC3393663], although its precise role in LTP consolidation remains to be fully elucidated [PMC3393663]. Target prediction algorithms have identified numerous potential mRNA targets for MIR24-1, indicating its broad regulatory potential [PMC3393663]. Moreover, CRISPR technology has been employed to create knockout mice for MIR24-1 to study its functions further [PMC8684555], while changes in its expression have been observed in various cellular contexts without direct external modulation [PMC7378464].

Literature search
347 open access papers mention hsa-mir-24-1
(2066 sentences)

Sequence

804290 reads, 2095 reads per million, 159 experiments
cuccggUGCCUACUGAGCUGAUAUCAGUucucauuuuacacacUGGCUCAGUUCAGCAGGAACAGgag
((((.((.(((.(((((((((..(((((.............))))).))))))))).))).)).))))

Structure
    g  G   A         UA     ucuca 
cucc gU CCU CUGAGCUGA  UCAGU     u
|||| || ||| |||||||||  |||||     u
gagG CA GGA GACUUGACU  GGUca     u
    A  A   C         -C     cacau 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr9: 95086021-95086088 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from hsa-mir-24-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-24-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-24-1 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-24-1 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-24-1-5p

Accession MIMAT0000079
Description Homo sapiens hsa-miR-24-1-5p mature miRNA
Sequence 7 - UGCCUACUGAGCUGAUAUCAGU - 28
Evidence experimental
cloned [7]
Database links
Predicted targets

Mature hsa-miR-24-3p

Accession MIMAT0000080
Description Homo sapiens hsa-miR-24-3p mature miRNA
Sequence 44 - UGGCUCAGUUCAGCAGGAACAG - 65
Evidence experimental
cloned [1,4-7], Northern [1], Illumina [8]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  7. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  8. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  9. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179