Hsa-mir-23a is a microRNA that was found to be significantly deregulated in the saliva of resectable pancreatic ductal adenocarcinoma (PDAC) patients compared to healthy controls during the discovery phase [PMC4486170]. However, it was not further investigated as it did not exhibit at least a 4-fold change in expression between the two groups [PMC4486170]. In addition to hsa-mir-23a, other miRNAs were also found to be deregulated in PDAC patients [PMC9004059]. Six miRNAs (hsa-miR-15a, hsa-let-7d, hsa-miR-142, hsa-mir-23a, hsa-miR-199, and hsa-miR-191) were found to be elevated in PDAC patients [PMC9004059]. MiRNA-regulated genes have been implicated in various biological processes such as central nervous system development, congenital abnormalities, and heart problems [PMC9004059].
c c - G G cuuc gg cgg uGGGG UUCCUGG GAUG GAUUUg c || ||| ||||| ||||||| |||| |||||| cc gcc aCCUU AGGGACC UUAC CUAaac u a a U G A acug
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004496 |
Description | Homo sapiens hsa-miR-23a-5p mature miRNA |
Sequence | 9 - GGGGUUCCUGGGGAUGGGAUUU - 30 |
Evidence |
experimental
cloned [6-7] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000078 |
Description | Homo sapiens hsa-miR-23a-3p mature miRNA |
Sequence | 45 - AUCACAUUGCCAGGGAUUUCC - 65 |
Evidence |
experimental
cloned [1,4-7], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|