Accession
MI0000079
Symbol
HGNC:
MIR23A
Description
Homo sapiens
hsa-mir-23a precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Hsa-mir-23a is a microRNA that was identified as significantly deregulated in the saliva of patients with resectable pancreatic ductal adenocarcinoma (PDAC) when compared to a healthy control group [PMC4486170]. Despite its deregulation, hsa-mir-23a was not selected for further investigation in the study because it did not meet the criterion of exhibiting at least a four-fold change in expression between PDAC patients and healthy individuals [PMC4486170]. Additionally, hsa-mir-23a was among the microRNAs that were found to be elevated in PDAC patients, indicating its potential involvement in the disease process, although its exact role and mechanism were not elucidated within this study [PMC4486170]. However, the statement that microRNAs, including hsa-mir-23a, have been implicated in various biological processes and diseases such as central nervous system development, congenital abnormalities, and heart problems cannot be substantiated with the provided reference [PMC9004059], and therefore should be excluded from the summary.
Literature search
329 open access papers mention hsa-mir-23a
(1790 sentences)
(1790 sentences)
Sequence
945129
reads,
5463
reads per million, 135 experiments
ggccggcuGGGGUUCCUGGGGAUGGGAUUUgcuuccugucacaaAUCACAUUGCCAGGGAUUUCCaaccgacc
((.(((.((((((((((((.((((.((((((..........)))))).)))).))))))).))))).))).))
((.(((.((((((((((((.((((.((((((..........)))))).)))).))))))).))))).))).))
Structure
c c - G G cuuc gg cgg uGGGG UUCCUGG GAUG GAUUUg c || ||| ||||| ||||||| |||| |||||| cc gcc aCCUU AGGGACC UUAC CUAaac u a a U G A acug
Annotation confidence
High
Do you think this miRNA is real?
Comments
This miRNA was previously named miR-23 [1,2] but is renamed here to avoid confusion with the more recently described miR-23b (MIR:MI0000439). Kawasaki and Taira reported that miR-23 regulates the transcriptional repressor Hairy enhancer of split (HES1) [3]. This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown.
Genome context
chr19: 13836587-13836659 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-23a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-23a is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-23a-5p
| Accession | MIMAT0004496 |
| Description | Homo sapiens hsa-miR-23a-5p mature miRNA |
| Sequence | 9 - GGGGUUCCUGGGGAUGGGAUUU - 30 |
| Evidence |
experimental
cloned [6-7] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-23a-3p
| Accession | MIMAT0000078 |
| Description | Homo sapiens hsa-miR-23a-3p mature miRNA |
| Sequence | 45 - AUCACAUUGCCAGGGAUUUCC - 65 |
| Evidence |
experimental
cloned [1,4-7], Northern [1] |
| Database links |
|
| Predicted targets |
|
References
|
