Stem-loop hsa-let-7f-2

Accession

MI0000068

Symbol

HGNC: MIRLET7F2

Description

Homo sapiens hsa-let-7f-2 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIRLET7F2 is a microRNA gene located on the X chromosome, specifically within a 122 kb maternal duplication at Xp11.22, which has been suggested to have potential epigenetic effects [PMC9338470]. This gene is part of a custom gene panel designed for pediatric cancer mutation profiling, which includes various microRNA genes known to be involved in cancer biology [PMC7341754]. Notably, MIRLET7F2 is one of the abundant miRNAs secreted by lymphoid tumor cell lines, indicating its significance in the context of lymphoid tumors [PMC9210832]. Additionally, MIRLET7F2 is involved in potential auto-regulation mechanisms as it targets MIRLET7BHG along with other members of the let-7 family [PMC7961530]. The targeted capture for mutation profiling includes MIRLET7F2 among other critical genes and regions associated with cancer to facilitate comprehensive genomic analysis and understanding of its role in oncogenesis [PMC7815088].

Literature search

1093 open access papers mention hsa-let-7f-2
(6134 sentences)

Sequence

24982758 reads, 65395 reads per million, 159 experiments

ugugggaUGAGGUAGUAGAUUGUAUAGUUuuagggucauaccccaucuuggagauaaCUAUACAGUCUACUGUCUUUCCcacg
.((((((.((((((((((((((((((((((((((((........))))))))....)))))))))))))))))))))))))).

Structure

u      U                    ----        cau 
 guggga GAGGUAGUAGAUUGUAUAGU    Uuuagggu   a
 |||||| ||||||||||||||||||||    ||||||||    
 cacCCU UUCUGUCAUCUGACAUAUCa    agguucua   c
g      -                    auag        ccc 

Annotation confidence High

Genome context

chrX: 53557192-53557274 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-let-7f-2

Disease association

hsa-let-7f-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-let-7f-5p

• Accession: MIMAT0000067
• Description: Homo sapiens hsa-let-7f-5p mature miRNA
• Sequence: 8 - UGAGGUAGUAGAUUGUAUAGUU - 29
• Evidence: experimental ; cloned [1,3-5], Northern [1], Illumina [6]

Mature hsa-let-7f-2-3p

• Accession: MIMAT0004487
• Description: Homo sapiens hsa-let-7f-2-3p mature miRNA
• Sequence: 58 - CUAUACAGUCUACUGUCUUUCC - 79
• Evidence: experimental ; cloned [4]

References

1. PubMed ID: 11679670
   Identification of novel genes coding for small expressed RNAs
   "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
   "Science (2001) 294:853-858


2. PubMed ID: 14573789
   Reduced accumulation of specific microRNAs in colorectal neoplasia
   "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
   "Mol Cancer Res (2003) 1:882-891


3. PubMed ID: 15325244
   Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
   "Kasashima K, Nakamura Y, Kozu T"
   "Biochem Biophys Res Commun (2004) 322:403-410


4. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


5. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


6. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6