miRBase entry: hsa-let-7a-1

Stem-loop hsa-let-7a-1


Accession
MI0000060
Symbol
HGNC: MIRLET7A1
Description
Homo sapiens hsa-let-7a-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7A1 is a gene encoding the microRNA let-7a, which is located on chromosome 9q22.3 and plays a role in gene regulation [PMC5356719]. This microRNA gene was found to be deleted in 49% of the samples in a study investigating deletions of the let-7a cluster, highlighting its potential involvement in genomic alterations [PMC5400605]. However, it is MIRLET7BHG, not MIRLET7A1, that is implicated in auto-regulation as it is targeted by several members of the let-7 family [PMC7961530]. In pediatric patients undergoing treatment for acute lymphoblastic leukemia (ALL), a variant of MIRLET7A1 (rs10739971) was associated with a reduced risk of developing severe hematologic toxicity by 82%, suggesting its potential as a protective factor [PMC10003057]. Additionally, MIRLET7A1 was upregulated to inhibit the expression of the target gene IGF1R, indicating its role in cellular pathways and cancer progression [PMC8840188]. Despite these findings, no significant differences were observed for genotype and allele frequencies between cases and controls for SNPs located near MIRLET7A1 in one study population [PMC4650490]. The gene's involvement extends to cancer and DNA damage response pathways, as it was ranked among the top ten genes related to these processes [PMC6202974].

Literature search
1270 open access papers mention hsa-let-7a-1
(8115 sentences)

Sequence

18680131 reads, 36574 reads per million, 158 experiments
ugggaUGAGGUAGUAGGUUGUAUAGUUuuagggucacacccaccacugggagauaaCUAUACAAUCUACUGUCUUUCcua
(((((.(((((((((((((((((((((.....(((...((((....)))).)))))))))))))))))))))))))))))

Structure
     U                     uuagg   aca    c 
uggga GAGGUAGUAGGUUGUAUAGUU     guc   ccca c
||||| |||||||||||||||||||||     |||   ||||  
aucCU UUCUGUCAUCUAACAUAUCaa     uag   gggu a
     -                     -----   --a    c 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
let-7a-3p cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
chr9: 94175957-94176036 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7a-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7a-5p

Accession MIMAT0000062
Description Homo sapiens hsa-let-7a-5p mature miRNA
Sequence 6 - UGAGGUAGUAGGUUGUAUAGUU - 27
Evidence experimental
cloned [1-3,5-8], Northern [1], Illumina [9]
Database links
Predicted targets

Mature hsa-let-7a-3p

Accession MIMAT0004481
Description Homo sapiens hsa-let-7a-3p mature miRNA
Sequence 57 - CUAUACAAUCUACUGUCUUUC - 77
Evidence experimental
cloned [6]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  4. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  5. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  6. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  7. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  8. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  9. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6