miRBase entry: cel-mir-90

Stem-loop cel-mir-90


Accession
MI0000059
Description
Caenorhabditis elegans cel-mir-90 precursor miRNA mir-90
Gene
family?
RF00785; mir-90


Sequence

71260 reads, 480 reads per million, 16 experiments
gggcgccauuucgagCGGCUUUCAACGACGAUAUCAACcgacaacucacacuuuugcguguUGAUAUGUUGUUUGAAUGCCCCUugaauuggaugcca
.(((((((.((((((.(((.(((((((((.((((((((((.(((.........))))).)))))))))))).))))).))).)))))).))).)))).

Structure
g    -   u      C   U     -    G        -  a   cuc 
 ggcg cca uucgag GGC UUCAA CGAC AUAUCAAC cg caa   a
 |||| ||| |||||| ||| ||||| |||| |||||||| || |||   c
 ccgu ggu aaguUC CCG AAGUU GUUG UAUAGUug gc guu   a
a    a   u      C   U     U    -        u  -   uuc 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
mir-90 is has found to be most abundant in the L1 stage of larval development in Caenorhabditis elegans [1]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [4].

Genome context
chrIII: 8873987-8874084 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from cel-mir-90
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cel-miR-90-3p

Accession MIMAT0000061
Description Caenorhabditis elegans cel-miR-90-3p mature miRNA
Sequence 62 - UGAUAUGUUGUUUGAAUGCCCCU - 84
Evidence experimental
cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

Mature cel-miR-90-5p

Accession MIMAT0020326
Description Caenorhabditis elegans cel-miR-90-5p mature miRNA
Sequence 16 - CGGCUUUCAACGACGAUAUCAAC - 38
Evidence experimental
Illumina [7]
Database links

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  3. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  4. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  5. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  6. PubMed ID: 11679672
    An extensive class of small RNAs in Caenorhabditis elegans
    "Lee RC, Ambros V"
    "Science (2001) 294:862-864

  7. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577