12 publications mentioning mtr-MIR169j

Open access articles that are associated with the species Medicago truncatula and mention the gene name MIR169j. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

During nodulation in M. truncatula, miR169 is essential for proper nodule development by restricting MtHAP2-1 transcripts primarily to the meristematic region of the nodule through posttranscriptional cleavage and overexpression of miR169 leads to the inhibition of nodule development presumably due to the lack of temporal-spatial control over MtHAP2-1 expression [37].

At 15 dpi, miR169 expression was downregulated with respect to 10 dpi at α = 0.05.

However, we observed no difference in nodule formation in response to Zn or between genotypes and given miR169 expression is related to nodule development and function by limiting the expression of MtHAP2-1to the meristematic region [37] it is unlikely that examination of nodule tissue only would show any meaningful trends.

Complimentary to other experiments monitoring expression of the precursor, MtMIR169a, we found mature miR169 to be downregulated at the 15 dpi point compared to the 10 dpi point [37].

The involvement of miR169 in nodulation is thought to be through maintenance of the meristematic region by restricting MtHAP2-1 expression primarily to this developmental region [37].

Whole root tissue was used for both time points and our results imply that miR169 is downregulated at the 15 dpi time point in both plant genotypes under both Zn treatments.

qRT-PCR analysis shows mature miR169 is downregulated at the 15 dpi time point.

Suggesting that expression of mature miR169 in whole nodule containing root tissues may mimic what has previously been observed in root nodules.

Expression levels of miR169 did not show any statistically significant trend in response to Zn in WT or raz plants at either time point (Figure  6).

We also found no difference in expression of miR169 between genotypes.

We found no relationship between Zn exposure and expression of miR169.

We examined nodule development and structure over a 28 day time course, recorded whole root system parameters, examined metal concentrations associated with shoot and root tissues, and quantified Zn responses of the nodulation-related miRNAs, miR166 and miR169, in nodulated WT and raz plants exposed to ideal and excess Zn.

To amplify miR166 and miR169 along with the reference mRNA gene, actin-11, simultaneously it was necessary to modify the method established by Chen et al. [44] and refined by Varkonyi-Gasic et al. [43].

As described above, miR166 and miR169 are thought to be involved in different aspects of nodulation.

Figure 6 Real-time RT-PCR analysis of miR169.

Rapid drops in miR169 transcript levels in phloem sap in response to N and P limitation also indicate the possibility of miR169 as a long-distance signal, whereby N and P deficiency are first detected in the shoots [36]; currently this hypothesis remains untested.

2

For example, miR399 and miR2111 have been reported to be up-regulated by phosphate starvation [23, 65], while miR169 with target of CCAAT Binding Factor is down-regulated in response to drought stress [14, 17].

Li et al. (2008) found that miR169a and miR169c are substantially down-regulated by drought, leading to the enhanced resistance to drought in Arabidopsis because one of the miR169's targets, NFYA5 (Nuclear Factor YA5), is a crucial transcription factor regulating the expression of a number of drought stress-responsive genes [14].

For example, in Arabidopsis, miR169 is down-regulated by drought stress through an ABA -dependent pathway, resulting in accumulation of NFYA5 with high affinity and sequence specificity for the CCAAT box, which is crucial for the expression of a number of drought-responsive genes [14].

Conversely, 10 members belonging to 6 miRNA families, i. e., miR164, miR169, miR171, miR396, miR398 and miR1510, were down-regulated in response to drought stress (Figure 3b and 3c).

It has been reported that miR169g is the only member induced by drought in the miR169 family of rice and its expression is regulated by drought [17].

In contrast, our results from both the high-throughput sequencing and RT-qPCR showed that miR169 was down-regulated under drought stress in M. truncatula (Figure 3b and 3c, Additional file 4).

Under drought stress, miR169 exhibited different expression patterns among different species.

In the present study, we found that the known or predicted targets of miR164, miR169, miR171, miR396, miR1510 and miR5558 were either transcription factors or F-box proteins (Table 3, 4).

Trindade et al. (2010) reported that the expression of miR169 in leaves of M. truncatula is not responsive to drought stress [15].

Several studies have revealed that miR169 is responsive to abiotic stresses such as drought, cold and salinity in different species [14, 15, 17, 22, 33].

If miR169 is responsive to mild and/or early drought stress exclusively, the responsiveness of miR169 may not be detected by the more severe drought stress used by the authors [15].

3

To our knowledge, the first miRNA reported to regulate nodule development (Combier et al., 2006), was miR169, which acts as a negative regulator of HAP2.

MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula.

The miR169 [*] cleaved MtBCP1 transcripts coding for an arbuscule-specific protein in mycorrhizal roots whereas cleavage products of a GRAS TF predicted as a target of miR5204 [*] were also sequenced in mycorrhizal roots (Devers et al., 2011).

However, functional analyses of miRNAs remained rare and only two miRNAs, miR169, and miR166, were experimentally associated to nodule development before 2009 (Data Sheet 2; Combier et al., 2006; Boualem et al., 2008).

4

Six other variants of the miR169 family (Additional file 2: Table S2a) were identified in our process, suggesting that, despite the effect of mtr-miR169a ectopic over -expression, putative specialization/increased efficiency of the miR169 variants in legumes may have occurred.

Again, certain miRNAs already known to be involved in the regulation of symbiotic and pathogenic processes, such as miR169 variants [20], miR171h and other variants [22, 23], miR393 [16], miR396 [15], sly-miR482* and miR2118 [19], were found, suggesting co-regulatory roles for the newly discovered miRNAs present in those modules.

Differentially conserved miRNAs, already known to be involved in the regulation of symbiotic processes, belong to each module, such as miR164a variant [13], miR166a variant [14], miR169 and miR396.

In fact, few families contained more than five variants and the greatest complexity was found in three conserved families (Additional file 6: Figure S2; Additional file 2: Table S2a), miR156 and miR169 (6 variants each) as well as miR171 (7 variants).

In contrast, our procedure clearly led to an underestimation of certain families, in particular miR169, miR395 and miR399.

Interestingly, among the legume-specific miRNAs, two isoforms of miR169 (mtr-miR169p and mtr-miR169q) clearly diverged from the conserved mature variant (Additional file 2: Table S2a).

5

There, miR169 restricts the expression of its target MtHAP2-1 to the meristematic zone of the root nodule, to allow correct maturation of the root nodule.

An exemplary spatial restriction type important in regulating root nodule development has been documented for miR169 in M. truncatula [[25]].

Some miRNAs, e. g. miR166 and miR169, have also been found to be involved in root nodule symbiosis [[25]–[27]].

6

Figures 1, 2, 3, and 4 show this type of phasing pattern on the precursors of miR159a, miR169 m, miR319a/b, miR447, miR822 and miR839.

1 TAGCCAAGGATGACTTGCCTG 44,458 miR169j.

2-3p, miR169j.

1* AATCTTGCGGGTTAGGTTTCA 9 miR169j.

2)-QRTF, AATGGGAGCTGATTATTACGAGACTGC; At5g48300(miR169j.

2-3p TTATATGTTCTTCTCTTTCATC 9 At5g02710 miR169j - miR169j.

2-3p (At5g02710), miR169j.

2-3p)-QRTR, CCTTGTTGAATTTCTTTTCTTCAATCC; At5g48300(miR169j.

7

MtNF-YA1 is expressed in zones 1 and 2 of mature root nodules (El Yahyaoui et al., 2004; Combier et al., 2006; Moreau et al., 2011), regulated by microRNA169 and the small peptide uORF1p, and required for nodule meristem persistence and function (Combier et al., 2006, 2008).

The 3′UTR of MtNF-YA1 has been shown previously (Combier et al., 2006) to contain a recognition site for MIR169, which is important for its proper temporal and spatial regulation, and thus this 3′UTR sequence was also included in the reporter construct.

8

MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula.

For example, miR166 and miR169 regulate nodule organogenesis in Medicago trunctula (Combier et al., 2006; Boualem et al., 2008).

9

No targets were found in M. truncatula for miR163, miR169, miR394 and miR894.

10

MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula.

11

MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula.

12

In our previous study we characterized miRNA genes, such as miRNA169, that regulate the nodulation process by targeting CCAAT TFs under cold and/or freezing stress (Shu et al., 2016).