sort by

47 publications mentioning hsa-mir-744

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-744. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 341
These results, together with the facts that lentirival downregulated miR-744 suppressed and upregulated miR-744 promoted the xenograft tumor growth in nude mice (Figure 3 and Supplementary Figure 3) and luciferase report assay (Figure 4), suggested that miR-744 exerts the capacity of tumor promotion by targeting NKD1. [score:10]
For example, by down -regulating Bcl-2, miR-744 enhanced apoptosis and inhibited cervical cancer cell proliferation; in hepatocellular carcinoma miR-744 exerted tumor suppressor function by targeting c-Myc [15]; miR-744 was reported to promote the progression of nasopharyngeal carcinoma via directly interacting with the promoter region of ARHGAP5 [20]. [score:9]
And in PCa cells, we not only observed that miR-744 inhibited the expression of SFRP1, a well known secreted negative regulators, and but also down-regulated significantly the production of GSK3β and TLE3. [score:9]
Figure 2MiR-744 promotes PCa cells proliferation, migration, and invasion, but suppresses apoptosis in vitro(A) The expression of miR-744 was significantly up-regulated in CRPC cell lines (PC3 and DU145) than ADPC cell lines (LNCAP). [score:8]
Importantly, we have identified that miR-744 downregulated the expressions of multiple negative modulators of Wnt signaling, particularly the expression of NKD1, thereby aberrantly activated Wnt/β-catenin pathway, as the consequence, promoted the progression of CRPC. [score:8]
To provide the further evidence that NKD1 is a direct downstream mediator of miR-744, we first detected the expression of NKD1 between these PCa cells and found that the expression of NKD1 in PC3 and DU145 cells were less than LNCaP cells, then we conducted the siRNA -mediated NKD1 knockdown experiments on LNCaP cells (Figure 5A and 5B). [score:7]
By utilizing this expressing vector, we generated stably expressing-miR-744 inhibitor PCa cells by infected PC3 cells with the lentivius particles of LV-anti-miR-744 and corresponding negative control (Figure 3A), and subsequently implanted these infected PC3 cells into nude mice. [score:7]
We derived the original microRNA expression data and related clinical data from MSKCC prostate cancer database (GSE21032) and performed the re-analyses including the expression of miR-744 in different prostate cancer stages, mainly based on Gleason scores, and the correlation between miR-744 expression levels and biochemical relapse-free time of patients after radical prostatectomy. [score:7]
MiR-744 activates Wnt/β-catenin pathway by targeting multiple negative regulators and NKD1 is a crucial direct target of miR-744. [score:7]
Even though Huang et al. reported that short-term expression of miR-744 enhanced the proliferation of mouse prostate adenocarcinoma cells whereas long-term expression of miR-744 suppressed tumor growth in vivo [25]. [score:7]
In contrast, when transfected synthetic miR-744 mimics in the miR-744-low expression LNCaP cells, we have observed that the enforced expression of miR-744 significantly enhanced LNCaP cells proliferation and suppressed the apoptosis of LNCaP cells (from 6.72% to 3.28%) (Figure 2B3, 2C3 and 2D3). [score:7]
These data demonstrated that reduced miR-744 expression inhibits prostate tumor regeneration and growth by suppression of proliferation, angiogenesis, invasion and promotion of apoptosis. [score:7]
Altogether, above results clearly indicate that miR-744 activates Wnt/β-catenin pathway by targeting multiple negative regulators and NKD1 is a main functional target of miR-744 in prostate cancer development. [score:7]
Given that PC3, Du145 and LNCaP-AI cells expressed much more miR-744 than LNCaP cells did, we next assessed the effects of downregulation of miR-744 on cell growth of PCa cells. [score:6]
Consistent with the results in PCa tumor tissues, we found that miR-744 expression levels were dramatically increased in, we found that miR-744 expression levels were dramatically increased in CRPC cells (Du145 and PC3) and AIPC (androgen-independent prostate cancer) cells (LNCaP-AI) than in ADPC cells (LNCaP) (Figure 2A and Supplementary Figure 1A). [score:5]
For this purpose, we constructed a lentiviral expression vector (LV-anti-miR-744) that encodes miR-744 inhibitor. [score:5]
It has been reported that miR-744 not only highly expressed in head and neck cancer, pancreatic cancer and nasopharyngeal carcinoma, and promoted tumor growth in these cancers, but miR-744 also exhibited an inhibitory effect on the progression of breast cancer, cervical cancer, colon cancer and hepatocellular carcinoma. [score:5]
Thus, we next used three bioinformatics tools (TargetScan, miRANDA, RNA22-HSA) to search whether NKD1 is one of putative targets of miR-744. [score:5]
In order to clarify whether the miR-744 expression was associated with the outcome of PCa patients, we performed Cox regression analysis to confirm the variables of potential prognostic significance and the results suggested that the miR-744 expression (P = 0.006), Gleason score (GS) (P = 0.002), prostate-specific antigen (PSA) (P = 0.005) and lymph node invasion (LNI) (P = 0.002) were independent prognostic factors for biochemical relapse-free survival in patients with PCa. [score:5]
Consistent with our result, the findings from Zhou's study also demonstrated that high level of miR-744 displayed the capacity to aberrantly activate Wnt/β-catenin signaling by directly suppressing the production of three negative regulators of Wnt/β-catenin pathway (SFRP1, GSK3β and TLE3), resulted in promoting the carcinogenesis of pancreatic cancer [23]. [score:5]
The results revealed that reduced Ki67 -positive cells, CD31 -positive cells and CD34 -positive cells, and significantly increased caspase-3 -positive cells in miR-744 inhibitor -overexpressing PC3 tumors. [score:5]
Interestingly, we detected that knockdown of miR-744 in PC3 cells significantly increased the expression of NKD1, a well-known negative regulator of Wnt signaling (Supplementary Table 3). [score:5]
MiR-744 was initially identified in 2007, and a few years later miR-744 has been shown to serve as a tumor suppressor in several cancers including breast cancer, cervical cancer, colon cancer, and hepatocellular carcinoma [15– 18]; on the other hand, miR-744 was highly expressed in head and neck cancer, pancreatic cancer, and nasopharyngeal carcinoma, and mediated the tumor-promotion effects on these cancers [19– 23]. [score:5]
Reverse complement sequence of miR744 mature was synthesized and subcloned into the AgeI/EcoRI site of GV280 vector (GeneChem, Shanghai, China) to generate the construct that inhibits miR744 expression, and this construct was named LVanti-miR744. [score:5]
As shown in Figure 3B–3E, silencing miR-744 by its inhibitor obviously suppressed tumor growth as manifested by reduced tumor size and tumor weight. [score:5]
In contrast, when endogenous miR-744 was stably overexpressed using LV-miR744 that encodes miR-744 mimic by infected LNCaP cells which expressed lower miR-744 than PC3 cells, the tumors were larger in size and had increased weight than those formed by corresponding negative control cells (Supplementary Figure 3A–3C). [score:5]
Mutation of the miR-744 binding site in the NKD1- 3′-UTR abrogated this miR-744 effects (Figure 4I), testifying NKD1 as a direct target of miR-744. [score:5]
Patients with high miR-744 expression had a lower survival rate than those with low miR-744 expression (P < 0.0001). [score:5]
The expression level of miR-744 in CRPC samples was much higher than in ADPC samples, and its expression level is inversely associated the survival of CRPC patients. [score:5]
These conclusions indicate that miR-744 may represent a potent novel targets for development of new therapeutic strategy for treatment of CRPC and pancreatic cancer. [score:4]
Thus, it would be of great interest to further explore the relation between upregulation of miR-744 and reactivating of AR pathway in the progress of in CRPC. [score:4]
Above results, together with several pieces of evidence that NKD1 is a well-known negative regulator of Wnt signaling in a variety of tumor types, we therefore hypotheses that NKD1 is a main direct regulators of miR-744. [score:4]
Futhermore, silencing NKD1 disrupted the repression efficacy of the miR-744-regulated Wnt/ β-catenin activity (Figure 4C), suggesting that miR-744 activates Wnt/β-catenin signaling through suppressing NKD1. [score:4]
Moreover, revealed that reduction of miR-744 not only enhanced NKD1 protein level, but also increased that the expression of other three negative regulators of Wnt signaling (GSK3β, SFRP1 and TLE3). [score:4]
Indeed, the prediction analysis revealed that NKD1 is a direct target of miR-744 since the 3′-UTR of NKD1 gene contains a binding site that perfectly complements with the seed sequence of miR-744 (Figure 4G). [score:4]
From the microarray dataset, we discovered 167 miRNAs were upregulated in CRPC, including miR-744, miR-3945, miR-1292 etc. [score:4]
In a previous miRNA microarray analysis, we have detected a panel of miRNAs are upregulated in CRPC clinical samples, including miR-744 [24]. [score:4]
The results in Figure 5F–5H, revealed that knockdown NKD1 by siRNA moderately attenuated the inhibitory effects on cell proliferation, colony formation, migration and invasion of PCa cells induced by reduction of miR-744 level. [score:4]
This data suggested that enforced expression of miR-744 increases nuclear β-catenin activity and NKD1 is the key regulator for miR-744 -induced Wnt/β-catenin activation. [score:4]
Thus, our results indicate that miR-744 enhances Wnt signaling through suppression of different negative modulators of Wnt signaling in PCa cells. [score:3]
Reduction of MiR-744 suppresses the formation of prostate xenograft tumors in vivoTo determine whether miR-744 possesses tumor-promotion effects in PCa, we carried out xenograft tumor experiments in nude mice by monitoring tumor latency, incidence and endpoint weight. [score:3]
At molecular level, by employing the analysis of microarray, Western blot, bioinformatics tool and luciferase reporter assay, we further confirmed that miR-744 could directly targeted the 3′-UTR region of NKD1 transcripts, which abolished the blocking effect of NKD1 on the nuclear accumulation of β-catenin, therefore greatly activates Wnt/β-catenin pathway. [score:3]
To examine whether NKD1 is a functional important target of miR-744, we performed “antagonistic effects” experiments by co-transfecting Du145 and PC3 cells with sh-anti-miR-744 and siNKD1. [score:3]
Firstly, we performed qRT-PCR to determine the expression levels of miR-744 in different PCa cell lines. [score:3]
Total RNA from PC3 cells infected with lentivirus expressing either LV-anti-miR-744 or LV-Vector was extracted using Trizol reagents. [score:3]
Figure 3Reduction of MiR-744 suppresses the formation of prostate xenograft tumors in vivo(A) Fluorescence microscope is used for detecting transfection efficiency for LV-anti-miR-744 transfection and the results suggested transfection efficiencies are all more than 90%. [score:3]
Taken together, these results suggested that miR-744 function as an oncogenic factor in the progression of prostate cancer and its expression level is associated with the transformation of ADPC to CRPC. [score:3]
Indeed, we found these miRNAs (such as miR-744, miR3945, miR-1292, miR-30c-1 and miR-4635) were significantly upregulated in CRPC samples compared to ADPC samples (P < 0.001, Figure 1B and Supplementary Table 1). [score:3]
Significant differentially expressed genes between PC3 cells treated with LV-anti-miR-744 and LV-Vector were selected based on the following criteria: P value < 0.05 and absolute fold changes ≤ 1.5 or ≥ 1.5. [score:3]
In addition, Hatano K et al. demonstrated that miR-744-3p inhibit DNA repair and sensitize prostate cancer cells to ionizing radiation [26]. [score:3]
All these findings imply that miR-744 could function either as oncogene or as tumor suppressor in a cellular context -dependent manner. [score:3]
From the analyses of in vitro and in vivo, we observed that miR-744 exhibited its abilities to promote cell proliferation, enhance the abilities of migration, and inhibit apoptosis. [score:3]
Strikingly, when we performed ISH and IHC staining on 10 ADPC tissues and 10 CRPC tissues with a miR-744 probe and an anti-NKD1 antibody, we observed that NKD1 expression was inversely correlated with miR-744 level (Figure 4F). [score:3]
Conversely, LNCaP cells stably overexpressing miR-744 vectors (GV209) or control vector constructed by GeneChem (Shanghai, China) were established by infection with lentivirus named LV-miR-744. [score:3]
In our current study, we discovered that miR-744 levels are much higher in human CRPC specimens than in human ADPC samples, and its high expression was positively correlated with the advanced stage and poor prognosis of CRPC patients. [score:3]
Most importantly, we identified that miR-744 dramatically reduced the expression of NDK1 protein in CRPC cells. [score:3]
Moreover, NKD1 positive cells in LNCaP xenograft tumors overexpressed miR-744 were lower than in the negative control tumors (Supplementary Figure 3D). [score:3]
However, the exact biological function of miR-744 on development of human prostate cancer has not been reported. [score:2]
MiR-744 was overexpressed in CRPC and positively associated with CRPC progression. [score:2]
To verify whether NKD1 gene is a functional target of miR-744, we carried out the luciferase report assay by co-transfecting miR-744 mimics with psi-CHECK-NKD1-WT (harbors the wild-type miR-744 binding site in NKD1 3′-UTR downstream of the firefly luciferase gene) or psi-CHECK-NKD1-MUT (contains a mutated miR-744 binding site in NKD1 3′-UTR) into Du145 and PC3 cells (Figure 4H). [score:2]
Correspondingly, overexpression of miR-744 mimics significantly enhanced the migration and invasion in LNCaP cells, compared with miR-NC transfection (Figure 2E3 and 2F3). [score:2]
MiR-744 promotes PCa cells proliferation, migration, and invasion, but suppresses apoptosis in vitro. [score:2]
I. The luciferase activity was detected that psiCHECK-2 luciferase reporter vector containing wild type and mutations of the binding sites in the 3′UTR of NKD1 mRNA with the miR-744 minics or miR-NC were co -transfected into PC3 and DU145 cells for 48 h. NKD1 mut was replaced the complementary region by a mutant as negative control. [score:2]
MiR-744 promotes PCa cells proliferation, migration, and invasion, and suppresses apoptosis in vitro. [score:2]
Reduction of MiR-744 suppresses the formation of prostate xenograft tumors in vivo. [score:2]
Recently, the deregulation of miR-744 has been frequently observed in many types of cancers. [score:2]
As nuclear β-catenin is the critical effector of Wnt pathway, we therefore performed TOPflash/FOPflash luciferase reporter assay to determine whether the transcriptional activities of β-catenin will be enhanced in PCa cells when miR-744 is overexpressed. [score:2]
As expected, anti-miR-744 oligos apparently inhibited the migration and invasion in PC3, DU145 and LNCaP-AI cells, compared with the anti-NC oligos (Figure 2E1, 2E2, 2F1, 2F2 and Supplementary Figure 1E, 1F). [score:2]
As a result, a total of 49,397 mRNAs were identified, however, only 214 of them were differentially regulated with fold changes ≤ 1.5 or ≥ 1.5 (LV-anti-miR-744 vs. [score:2]
MiR-744 expression with clinical patient data was downloaded from the MSKCC database (http://www. [score:2]
Compared to anti-NC oligos, we have observed that anti-miR-744 oligos not only greatly inhibited the cell growth of PC3, Du145 and LNCaP-AI cells (Figure 2B1, 2B2, 2C1, 2C2 and Supplementary Figure 1B, 1C), but also dramatically increased apoptosis of the three PCa cell types from 5.55% to 12.07% in Du145 cells, 6.21% to 14.39% in PC3 cells and 3.51% to 5.29% in LNCaP-AI cells (Figure 2D1, 2D2 and Supplementary Figure 1D). [score:2]
Furthermore, immunohistochemistry analysis also revealed that, compared to the control tumors, miR-744 -overexpressing tumors had higher percentages of Ki-67–positive cells (Supplementary Figure 3D). [score:2]
Thus, our results uncover a novel mechanism that the tumor-promotion effects of miR-744 on the progression of CRPC are accomplished by disrupting three different layers of negative regulations of Wnt/β-catenin signaling. [score:2]
Their sequences were as follow: (1) miR-744 mimic sense: 5′-UGCGGGGCUAG GGCUAACAGCA-3′; (2) miR-744 mimic antisense: 5′-CUGUUAGCCCUAGCCCCGCAUU-3′; (3) miR-NC sense: 5′-UUCUCCGAACGUGUCACGUTT-3′; (4) miR- NC antisense: 5′-ACGUGACACGUUCGGA GAATT-3′; (5) anti-miR-744 oligos: 5′-UGCUGUUAGCCCUAGCCC CGCA-3′; (6) anti-miR-NC: 5′-CAGUACUUUUGUGUA GUACAA-3′; NKD1 siRNA (siNKD1) and negative control siRNA (siNC) were all purchased from Santa Cruz Biotechnology (Santa Cruz, USA). [score:1]
All results from MSKCC database implied that miR-744 represents a poor prognostic factor of CRPC patient. [score:1]
NKD1 is a critical downstream mediator of miR-744 effects prostate cancer progression. [score:1]
To investigate the molecular mechanisms through which miR-744 exerts its prostate cancer-promoting effects, we conducted Affmetrix human gene expression array analysis on two transfected-PC3 cell lines that have been transfected with lentiviral constructs (LV-anti-miR-744 vs. [score:1]
Correspondingly, nuclear β-catenin levels in both PC3 and Du145 cells were reduced when miR-744 were depleted by anti-miR-744 oligos (Figure 4D). [score:1]
As our expectation, co-transfection of the two cell lines with the luciferase construct (wild type) and miR-744 mimic led to reduce luciferase activity significantly. [score:1]
also demonstrated that siRNA -mediated downregution of NKD1 apparently antagonized the enhancement of NKD1 protein induced by anti-miR-744 in both Du145 and PC3 cells (Figure 5I). [score:1]
Given that above data suggested that NKD1 may be a target of miR-744 in PCa cells, we decided to investigate the relationship between NKD1 and miR-744 in PCa tumor samples. [score:1]
Since miR-744 has been reported to play the critical roles in multiple other malignancies, but there is no report of miR-744 involved in human PCa. [score:1]
By conducted IHC staining with an anti-NKD1 antibody on PC3 and LNCaP xenograft tumors, we found that NKD1 positive cells in anti-miR-744 treated PC3 xenograft tumors were much more than in the negative control tumors (Figure 4E). [score:1]
The contradictory effects of miR-744 on the various tumors indicate that miR-744 might exhibit its biological functions in tumor type-specific ways [15, 17]. [score:1]
These findings implied that Wnt signaling might be one major pathway involved in the progression of PCa mediated by miR-744. [score:1]
In this study, we provided the convincing evidences for the conclusion that miR-744 behaved as an oncogenic factor in the progress of prostate cancer, especially in the transition from ADPC to CRPC. [score:1]
To determine whether miR-744 possesses tumor-promotion effects in PCa, we carried out xenograft tumor experiments in nude mice by monitoring tumor latency, incidence and endpoint weight. [score:1]
Based on miRBase database, miR-744 mimic, negative control of miRNA (miR-NC), anti-miR-744 oligos (anti-miR-744) and negative control anti-miRNA (antiNC) were designed and synthesized by GeneChem (Shanghai, China). [score:1]
NKD1 is a critical downstream mediator of miR-744 effects in prostate cancer progression. [score:1]
These results demonstrated that miR-744 has the capacity to promote the PCa cell growth. [score:1]
Altogether, the above experiments further confirmed that miR-744 serves as an oncogenic factor in tumorigenesis of prostate cancer. [score:1]
Among the involved mechanisms, the activation of Wnt/β-catenin signaling by miR-744 might represent more clinical significance. [score:1]
Our results suggested that miR-744 serves as an oncogenic factor to promote PCa cells growth. [score:1]
The consequence showed PC3 and DU145 cells with anti-miR-744 oligos demonstrate a higher apoptosis than control, on the contrary, the apoptosis in LNCAP cells transfected with miR-744 minics was lower than control. [score:1]
As shown in Figure 1C, Kaplan-Meier analysis with the log-rank test revealed, after radical prostatectomy, that the biochemical relapse-free survival in the patients with low level of miR-744 was significant longer than that in the patients with high level of miR-744 (P < 0.0001). [score:1]
Further, we found that miR-744 dramatically promoted cell proliferation, migration and invasion of CRPC in vitro, as well as enhanced xenograft tumor growth in vivo, indicating that miR-744 behaves as an oncogenic factor in the progression of ADPC to CRPC. [score:1]
In this study, we have systemically investigated the biological functions of miR-744 and its potential targets in the progression of PCa by utilizing a variety of approaches. [score:1]
Prostate cancer cells were seeded in 24-well plates and co -transfected them with reporters and miR-744 mimics and miR-NC together with Renilla luciferase internal normalization plasmid (phRL-CMV). [score:1]
MiR-744 promotes PCa cells proliferation, migration, and invasion, and suppresses apoptosis in vitroTo elucidate the mechanism of action of miR-744, we evaluate the impact of miR-744 on several biological properties of prostate cancer cells in vitro. [score:1]
Their sequences were as follow: (1) miR-744 mimic sense: 5′-UGCGGGGCUAG GGCUAACAGCA-3′; (2) miR-744 mimic antisense: 5′-CUGUUAGCCCUAGCCCCGCAUU-3′; (3) miR-NC sense: 5′-UUCUCCGAACGUGUCACGUTT-3′; (4) miR- NC antisense: 5′-ACGUGACACGUUCGGA GAATT-3′; (5) anti-miR-744 oligos: 5′-UGCUGUUAGCCCUAGCCC CGCA-3′; (6) anti-miR-NC: 5′-CAGUACUUUUGUGUA GUACAA-3′; NKD1 siRNA (siNKD1) and negative control siRNA (siNC) were all purchased from Santa Cruz Biotechnology (Santa Cruz, USA). [score:1]
PC3 (4 × 10 [6]) cells and LNCaP (8 × 106) cells that have been stably transfected with LV-anti-miR744 and LV-miR-744 were inoculated subcutaneously together with Matrigel into the oxter flank of nude mice. [score:1]
However, the biological functions of miR-744 in tumorigenesis of human prostate cancer remain largely unknown. [score:1]
PC3 cells were transfected with LVanti-miR744, or control vector. [score:1]
In brief, the double (5′–3′) digoxigenin (DIG)-labeled miR-744 probe and U6 probe were purchased from Boster (Wuhan, China) and ISH was conducted according to the manufacturer's instructions of the microRNA ISH Optimization Kit (Boster, Wuhan, China). [score:1]
The fragments of NKD1 3′-UTR containing either putative miR-744 seed sequence (wild-type, 5′-TACATTTAGCCCATGAGCCTGGC-3′) or mutated seed sequence (mutant, 5′-TACATAATCGGG ATGAGCCTGGC-3′) were synthesized by GeneChem (Shanghai, China). [score:1]
In summary, above results suggested, at cellular level, that miR-744 promotes PCa cell growth through enhancing cell proliferation, metastasis and reducing apoptosis. [score:1]
As shown in Figure 4B, the ratios of TOP/FOP in both PC3 and Du145 cells transfected with miR-744 mimics are significantly higher than in the two types PCa cells transfected with NC oligos. [score:1]
[1 to 20 of 107 sentences]
2
[+] score: 286
Herein, we found that overexpression of miR-744 enhanced, while suppression of miR-744 inhibited Wnt/β-catenin signaling through directly targeting different levels of negative regulators of the pathway, including SFRP1, GSK3β and TLE3. [score:11]
In the current study, SFRP1, GSK3β and TLE3 were directly targeted and simultaneously downregulated by miR-744 in pancreatic cancer, and the expression of SFRP1, GSK3β and TLE3 was inversely correlated with the expression of miR-744 in pancreatic cancer tissues. [score:11]
Furthermore, we found that miR-744 overexpression significantly upregulated the mRNA expression levels of multiple pluripotency factors, including BMI1, ABCG2, OCT4, SOX2, and NANOG (Fig. 2E). [score:8]
However, neither miR-744 overexpression nor miR-744 inhibition has effect on the mRNA levels of SFRP1, GSK3β, and TLE3, suggesting that the inhibitory effect of miR-744 on SFRP1, GSK3β, and TLE3 was regulated at the post-transcriptional level (Supplemental Fig. 4A). [score:8]
In addition, the results of the luciferase reporter assay indicated that miR-744 overexpression significantly repressed, whereas inhibition of endogenous miR-744 increased, the luciferase activity of 3′UTRs of SFRP1, GSK3β, and TLE3, while ectopically expressing mutant miR-744 had no inhibitory effect on the 3′UTRs luciferase activity (Fig. 5C). [score:8]
In the present study, we found that microRNA miR-744 was significantly upregulated in pancreatic cancer and enhanced a stem cell-like phenotype by inhibition of multiple negative regulators of Wnt/β-catenin pathway, including frizzled-related protein 1 (SFRP1), GSK3β, and TLE3. [score:7]
Whereas the levels of SFRP1, GSK3β and TLE3 in the CD133+ pancreatic cancer cells were dramatically lower compare with CD133 [−] pancreatic cancer cells (Supplemental Fig. 5B– 5C), which further support the hypothesis that miR-744 upregulation activates the Wnt/β-catenin signaling via downregulation of SFRP1, GSK3β and TLE3 in pancreatic cancer. [score:7]
Herein, we found that the overexpression of miR-744 in pancreatic cancer enhanced, whereas suppression of miR-744 inhibited, the CSC-like phenotypes. [score:7]
Importantly, patients with higher miR-744 expression had a shorter survival time, whereas patients with lower miR-744 expression showed a longer survival time and disease-free survival (P < 0.05; P < 0.05; Fig. 1E–1F). [score:7]
Moreover, the expression of miR-744 and nuclear β-catenin was significantly increased in the tumors formed by miR-744 -overexpressing cells but decreased in mR-744 -inhibited tumors. [score:7]
Using publicly available algorithms (TargetScan6.2 and miRanda), we found that SFRP1, GSK3β, and TLE3, negative regulators of the Wnt/β-catenin pathway, might be the potential targets of miR-744 (Fig. 5A). [score:6]
In summary, this study demonstrated that overexpression of miR-744 promoted stem cell-like phenotype and tumorigenecity in pancreatic cancer cells by directly targeting multiple negative modulators of Wnt/β-catenin pathway, namely SFRP1, GSK3β and TLE3. [score:6]
In addition, tumor sphere formation showed that the inhibitive effect of downregulating miR-744 was antagonized by silencing of SFRP1, GSK3β, and TLE3 (Supplemental Fig. 4D). [score:6]
Furthermore, nuclear β-catenin positively correlated, while SFRP1, GSK3β and TLE3 expression inversely correlated with the expression of miR-744 in pancreatic cancer clinical specimen. [score:5]
Furthermore, we found that miR-744 inhibition significantly reduced the populations of CD133 [+] and SP [+] cell and decreased mRNA expression of BMI1, ABCG2, OCT4, SOX2, and NANOG (Fig. 3C–3E). [score:5]
Inhibition of miR-744 suppresses a CSC-like phenotype in pancreatic cancer cells. [score:5]
Whereas, the levels of SFRP1, GSK3β and TLE3 dramatically decreased in the mice tumors formed by miR-744 -overexpressing cells and increased in the mR-744 -inhibited tumors (Supplemental Fig. 3A and 4C). [score:5]
As expected, we found that miR-744 overexpression increased, while miR-744 inhibition reduced the luciferase activity of the TOP flash/ FOP flash reporter, and mutant miR-744 had no effect (Fig. 5E), indicating that miR-744 activates Wnt/β-catenin signaling. [score:5]
Thus, it would be of great interest to further investigate whether upregulation of miR-744 in pancreatic cancer is attributed to NF-κB and/or TGF-β -mediated transcriptional upregulation. [score:5]
Using 8 freshly collected clinical pancreatic cancer samples, we found that miR-744 expression was inversely correlated with expression of β-catenin (r = 0.62, P < 0.05), SFRP1 (r = −0.89, P < 0.05), GSK3β (r = −0.61, P < 0.05), TLE3 (r = −0.82, P < 0.05) (Fig. 6A–6C). [score:5]
Overall survival E. and disease-free survival F. of pancreatic cancer patients with low- versus high -expression of miR-744 (n = 80; P < 0.05). [score:5]
MiR-744 inhibition suppresses pancreatic cancer stem cell-like phenotype. [score:4]
In the current study, we found that miR-744, an endogenous small RNA, markedly activated the Wnt/β-catenin signaling via inhibition of multiple negative regulators of the pathway, including GSK3β. [score:4]
Upregulation of miR-744 promotes CSC-like traits in pancreatic cancer cells. [score:4]
Upregulation of miR-744 promotes tumorigenicity of pancreatic cancer cells in vivoThe biological effect of miR-744 on pancreatic cancer progression was further examined using an in vivo tumor mo del. [score:4]
Silencing SFRP1, GSK3β and TLE3 disrupted the repression efficacy of the miR-744-regulated Wnt/ β-catenin activity (Supplemental Fig. 4B and Fig. 5F), suggesting that miR-744 activates Wnt/β-catenin signaling through suppressing SFRP1, GSK3β, and TLE3. [score:4]
Figure 4Upregulation of miR-744 promotes tumorigenicity of pancreatic cancer cells in vivo A. Tumors formed by MIA PaCa-2/pMSCV-miR-744 cells in a nude mouse xenograft mo del were larger in diameter than vector control tumors in the 1 × 10 [5] cells group. [score:4]
Upregulation of miR-744 promotes tumorigenicity of pancreatic cancer cells in vivo. [score:4]
MiR-744 is clinically correlated with nuclear β-catenin and expression of its targets in pancreatic cancer. [score:4]
Figure 6 A. qRT-PCR of miR-744 expression in 8 fresh pancreatic cancer tissues and 2 normal pancreatic tissues. [score:3]
Representative micrographs A. and quantification B. of tumorsphere formation in pMSCV-miR-744 -overexpressing cells or pMSCV-vector cells. [score:3]
Collectively, our results suggest that miR-744 overexpression promotes a stem cell-like phenotype in pancreatic cancer cells. [score:3]
To further determine the clinical correlation between miR-744 and the Wnt/β-catenin signaling pathway, we examined whether miR-744–induced suppression of SFRP1, GSK3β, and TLE3 and β-catenin nuclear accumulation in pancreatic cancer are relevant in clinical samples. [score:3]
U6 was used as the control for RNA loading; miRNA levels were normalized to miR-744 expression of sample one. [score:3]
Taken together, these results indicate a possible link between miR-744 overexpression and human pancreatic cancer progression. [score:3]
Moreover, the expression of miR-744 was positively correlated with tumorgenesis both in vitro and in vivo. [score:3]
Consistently, in vivo studies revealed that silencing mir-744 significantly inhibited the tumorigenicity of pancreatic cancer cells. [score:3]
Figure 1 A. Expression profiling of miR-744 from published microarray -based high-throughput datasets (n = 158; NCBI/GEO/GSE24279). [score:3]
Only miR-744 -overexpressing cells formed tumors following implantation of 1 × 10 [3] cells. [score:3]
These findings suggest miR-744 as a potential therapeutic target. [score:3]
A. Predicted miR-744 target sequences in the 3′-UTRs of SFRP1, GSK3β, TLE3 and a mutant containing three altered nucleotides in the seed sequence of miR-744 (miR-744-mu). [score:3]
A. qRT-PCR of miR-744 expression in 8 fresh pancreatic cancer tissues and 2 normal pancreatic tissues. [score:3]
revealed that the expression of SFRP1, GSK3β and TLE3 was markedly decreased in miR-744-transduced cells but elevated in antagomir-744 -transfected cells (Fig. 5B). [score:3]
Figure 5 A. Predicted miR-744 target sequences in the 3′-UTRs of SFRP1, GSK3β, TLE3 and a mutant containing three altered nucleotides in the seed sequence of miR-744 (miR-744-mu). [score:3]
Collectively, these findings suggest that miR-744 expression is increased in pancreatic cancer. [score:3]
C. RT- PCR analysis of miR-744 expression in 8 pancreatic cancer samples and 2 normal pancreatic tissues. [score:3]
We found that miR-744 was significantly upregulated in tumor tissues compared to normal tissues (Fig. 1A). [score:3]
In contrast, when endogenous miR-744 was inhibited using miRZip744, the tumors were smaller in size and had decreased weight than those formed by control cells (Fig. 4A–4C). [score:3]
B. RT- PCR analysis of miR-744 expression in 8 pancreatic cancer cell lines and 2 HPDECs. [score:3]
C. Correlation between miR-744 expression levels and SFRP1, GSK3β, TLE3 and nuclear β-catenin in pancreatic cancer clinical tissues. [score:3]
D. miR-744 expression was positively correlated with clinical stages of pancreatic cancer. [score:3]
These findings reveal a novel molecular mechanism on how aberrant activation of the Wnt/β-catenin pathway is maintained in cancer and suggests that miR-744 might serve as a potential therapeutic target for pancreatic cancer. [score:3]
revealed that miR-744 expression was positively correlated with clinical stage in patients with pancreatic cancer (P < 0.05) (Fig. 1D and Supplementary Table 1). [score:3]
A. Expression profiling of miR-744 from published microarray -based high-throughput datasets (n = 158; NCBI/GEO/GSE24279). [score:3]
MiR-744 directly targets SFRP1, GSK3β and TLE3. [score:3]
Furthermore, we found that the expression of miR-744 and nuclear β-catenin was significant higher in CD133 [+] pancreatic cancer cells higher than that in CD133 [−] pancreatic cancer cells. [score:3]
Moreover, univariate and multivariate analyses indicated that miR-744 expression and clinical stage are independent prognostic factors in pancreatic cancer (Supplementary Table 2). [score:3]
MiR-744 overexpression positively correlates with pancreatic cancer progression. [score:2]
These results demonstrate that SFRP1, GSK3β and TLE3 are key regulators for miR-744 -induced Wnt/β-catenin activation and stem cell-like traits in pancreatic cancer cell lines. [score:2]
Importantly, results of the miRNP immunoprecipitation assay showed that miR-744 selectively associated with SFRP1, GSK3β and TLE3 (Fig. 5D), further demonstrating that SFRP1, GSK3β, and TLE3 are targets of miR-744. [score:2]
Therefore, our results suggest that deregulation of miR-744 may play an important role in maintenance of CSCs stemness and progression of pancreatic cancer. [score:2]
MiR-744 overexpression correlates with pancreatic cancer progression. [score:2]
MiR-744 activates Wnt/β-catenin pathway by targeting SFRP1, GSK3β, and TLE3. [score:2]
C. Hoechst 33342 dye exclusion assay showing the effect of pMSCV-miR-744 -overexpressing cells or pMSCV-vector cells on side population cells. [score:2]
MiR-744 overexpression promotes pancreatic cancer stem cell-like traits. [score:2]
Cloning miR-744: 5′-GCCAGATCTTTTCACT GCAG AGGACTTGAAAGAC-3′ and 5′-GCCGAATTC AATAGGACACTAATAGGAAGATG AT -3′; Cloning sFRP1-3′UTR-luci: GCCCCGCGGCGCCTGTCAGTA GTGGACATTGTAA -3′ and 5′-GCCCTGCAG TCC ATAGGCAATCAAGTTCAAAGGA -3′; Cloning GSK3β- 3′UTR-luci: 5′-GCCCCGCGG TTTCACTCGCTG TTTAGC -3′ and 5′-GCCCTGCAG GGTCTATCAA CGCCACTA-3′; Cloning TLE3–3′UTR-luci: 5′-GCCCC GCGG GTTGGTTTGATTGTTGCGTCTT-3′and 5′-GC CCTGCAG TGCTGCG ATGCTGGGTAT-3′. [score:1]
The biological effect of miR-744 on pancreatic cancer progression was further examined using an in vivo tumor mo del. [score:1]
Consistently, real-time PCR analysis revealed that miR-744 was ubiquitously overexpressed in 8 pancreatic cancer cell lines compared with two HPDECs, and in 8 pancreatic cancer samples compared with two normal pancreatic tissues (Fig. 1B–1C). [score:1]
These results indicate that miR-744 promotes pancreatic cancer tumorigenicity in vivo. [score:1]
The tumors formed by MIA PaCa-2/miR-744 cells were significantly larger than the vector control tumors, when 1 × 10 [5] or 1 × 10 [4] cells mixed with matrigel were subcutaneously inoculated into the mice. [score:1]
A. Tumors formed by MIA PaCa-2/pMSCV-miR-744 cells in a nude mouse xenograft mo del were larger in diameter than vector control tumors in the 1 × 10 [5] cells group. [score:1]
MIA PaCa-2/miR-744 or MIA PaCa-2/vector cells were subcutaneously xenografted into NOD/SCID mice. [score:1]
pMSCV-miR-744, pSin4-miR-744 or miRZip-744 were cotransfected with the pIK packaging plasmid in HEK293T cells using the standard calcium phosphate transfection method. [score:1]
Analysis of the miR-744 promoter region using the CONSITE program predicted two typical NF-κB-responsive elements and one typical TGF-β-responsive elements (SRE). [score:1]
These findings uncover a novel mechanism for pancreatic CSCs maintenance and suggest a potential therapeutic effect of miR-744. [score:1]
To understand the biological role of miR-744 in pancreatic cancer progression, miR-744 was stably transduced into the MIA PaCa-2 and AsPC-1 pancreatic cancer cell lines via retroviral- and lentiviral-vector to generate MIA PaCa-2/miR-744 and AsPC-1/miR-744 cell lines (Supplemental Fig. 1A). [score:1]
Thus, our experiments further indicate that miR-744 might act as a CSC inducer. [score:1]
The human miR-744 gene was PCR-amplified from genomic DNA and cloned into a pMSCV-puro retroviral vector or pSin4-EF2-IRES-Puro lentiviral vector. [score:1]
The miR-744 anti-sense was cloned into miRZip plasmid purchased from System Biosciences and used according to previous report [51]. [score:1]
Importantly, only MIA PaCa-2/miR-744 cells formed tumors when 1 × 10 [3] cells were implanted (Fig. 4D). [score:1]
[1 to 20 of 80 sentences]
3
[+] score: 264
In the present study, our data show that compared with adjacent normal liver tissues, miR-744 expression in HCC is significantly down-regulated, suggesting that miR-744 is a candidate tumor suppressor in the pathogenesis of HCC. [score:7]
miR-744 was able to inhibit the proliferation of breast cancer cells by targeting eukaryotic translation elongation factor 1A2 (eEF1A2) [16]. [score:7]
miR-744 directly downregulates c-Myc and inhibits HCC cell proliferation. [score:7]
Figure 3 miR-744 directly targets and regulates c-Myc expression in HCC cells. [score:7]
Our data suggest that miR-744 exerts its tumor suppressor function by targeting c-Myc, leading to the inhibition of HCC cell growth. [score:7]
As expected, ecoptic c-Myc in HepG2 cells enhanced the accumulation of Cyclin D1, while restoration the miR-744 expression in HepG2 cells partially inhibited expression of Cyclin D1 (Figure  5A). [score:7]
As miRNAs function mainly through inhibition of target genes, the target gene of miR-744 that functions in HCC pathogenesis was further analyzed. [score:7]
Furthermore, c-Myc, which is usually overexpressed in a variety of human cancers including HCC, was identified as a direct target of miR-744. [score:6]
Down-regulation of miR-744 and up-regulation of c-Myc were detected in HCC specimens compared with adjacent normal tissues. [score:6]
Moreover, miR-744 down-regulated c-Myc protein level through targeting its protein-coding sequence but not 3′UTR. [score:6]
In cell proliferation assay, restoration of miR-744 in HepG2 and SMMC-7721 cells resulted in significant suppression of cell proliferation, the proliferation rate was suppressed in HepG2 and SMMC-7721 cells after transfection with miR-744, and the inhibitory efficiencies were 45.8% and 36.7%, respectively (Figure  2B). [score:6]
We had resulted that restoration of miR-744 could suppress the growth and proliferation of HCC cells and c-Myc was a direct target of miR-744. [score:6]
Our results showed that the expression of miR-744 was frequently down-regulated in both HCC tissues and cells. [score:6]
Long-term overexpression of miR-744 may cause chromosomal instability and inhibit tumor growth by prolonging activation of Ccnb1 in mouse [31]. [score:5]
Our identification of c-Myc as a target of miR-744 provides new insights into the mechanisms underlying HCC proliferation and miR-744 have potential as novel therapeutic targets for the treatment of HCC. [score:5]
In addition, miR-744 also inhibited the c-Myc -dependent expression of endogenous Cyclin D1 in SMMC-7721 cells (Figure  5B). [score:5]
Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was conducted to detect the expression of miR-744 and was performed to detect expression of c-Myc in HCC specimens and adjacent normal tissues. [score:5]
So we hypothesized that miR-744 regulated cell growth in HCC cells by targeting c-Myc. [score:4]
Taken together, our results demonstrated that c-Myc was a direct target of miR-744 in HCC cells. [score:4]
was performed to confirm whether miR-744 regulated the expression of c-Myc. [score:4]
Figure 1 miR-744 is down-regulated in HCC samples and HCC cell lines. [score:4]
miR-744 down-regulated in HCC. [score:4]
Our data demonstrated for the first time that restoration of miR-744 significantly inhibited HCC cells proliferation through down -regulating c-Myc protein level. [score:4]
Taken together, our results revealed that miR-744 was abnormally down-regulated both in human HCC samples and cell lines. [score:4]
In our current study, we evaluated miR-744 expression levels in 40 tumor tissues of patients with HCC and found that miR-744 was significantly down-regulated in HCC. [score:4]
Our findings demonstrated that miR-744 was frequently down-regulated in HCC cell lines and clinical samples. [score:4]
The level of c-Myc protein was consistently and substantially down-regulated by miR-744 (Figure  3D). [score:4]
Taken together, these results demonstrated that miR-744 could regulate HCC cells growth partially through targeting c-Myc. [score:4]
Consistently, HCC tissues with low miR-744 showed much higher c-Myc expression, compared with normal liver tissues with high level of miR-744 but lower c-Myc expression (Figure  4A,B). [score:4]
Moreover, we identified c-Myc, which is an oncogenic transcription factor, as a direct and functional target of miR-744 in HCC cells. [score:4]
Based on gain-of-function approach, we proved that miR-744 could inhibit HCC cell proliferation in vitro. [score:3]
miR-744 mimics or negative control oligonucleotides was transiently transfected into human HCC cell lines that have lowly endogenous expression levels of miR-744 (Figure  1B). [score:3]
However, miR-185-3p and miR-744 in our study have been reported to target protein-coding sequence of c-Myc mRNA. [score:3]
Expression of miR-744 was verified by qRT-PCR. [score:3]
Figure 4 Expression analyses of miR-744 and c-Myc in HCC tissues. [score:3]
Luciferase assay and analysis revealed that c-Myc is a direct target of miR-744. [score:3]
To determine the levels of miR-744 in HCC samples and cell lines, total RNAs were extracted from HCC tissues and cell lines, and the expression levels of miR-744 were analyzed using qRT-PCR and normalized against an endogenous control (U6 RNA). [score:3]
In summary, our data show that miR-744 is down-regulated in HCC tissues compared with normal liver tissues. [score:3]
miR-744 targets c-Myc. [score:3]
Our results showed that the reporter plasmid with wild type targeting sequence of c-Myc mRNA caused a significant decrease in luciferase activity in cells transfected with miR-744, whereas reporter plasmid with mutant sequence of c-Myc produced no change in luciferase activity (Figure  3B). [score:3]
qRT-PCR results determined that transfection of miR-744 restored its expression in HepG2 and SMMC-7721 cells (Figure  2A). [score:3]
miR-744 inhibits HCC growth. [score:3]
HEK-293 cells were cotransfected with miR-744 mimics or control oligo nucleotides, pRL-TK and firefly luciferase reporter plasmid containing putative miR-744 targeting sequences of c-Myc. [score:3]
c-Myc mRNA expression was not affected by miR-744 (Figure  3C). [score:3]
miR-744 may serve as a potentially useful target for the miRNA -based therapies of HCC in the future. [score:3]
To confirm whether miR-744 could regulate the expression of c-Myc, we first performed luciferase reporter assays in HEK293 cells. [score:3]
These data indicate that miR-744 may serve as a new target for cancer therapy. [score:3]
miR-744 mimics restorated miR-744 expression in both HepG2 and SMMC-7721 cells. [score:3]
HepG2 and SMMC-7721 cells were transfected with miR-744 and/or pGL3-c-Myc, and the expression of c-Myc and Cyclin D1 were analyzed byting. [score:3]
We checked the newly published CLASH data [18], we found that about 402 genes were targeted by miR-744 in HEK293 cells. [score:3]
Figure 5 miR-744 inhibits c-Myc -dependent activity and cell proliferation in HCC cells. [score:3]
Because deregulation of miR-744 is common to a number of cancers, it has been hypothesized that miR-744 may play an important role in tumor development and tumorigenesis. [score:3]
It was also shown that miR-744 was down-regulated in 4 HCC cell lines, compared with 5 normal liver tissues and normal liver cell line LO2 (Figure  1B). [score:3]
U6 small RNA was used as an internal control for normalization and quantification of miR-744 expression. [score:3]
miR-744 has been reported to be frequently deregulated in various kinds of cancers. [score:2]
miR-744 is significantly deregulated in several cancers, including HCC [14], colon cancer [15], breast cancer [16], and gastric cancer [17]. [score:2]
Figure 2 MiR-744 restoration inhibit the viability of HCC cells. [score:2]
These results demonstrate that miR-744 regulates proliferation of HCC cells. [score:2]
Increasing evidences indicate that miR-744 deregulated in numerous human cancers including hepatocellular carcinoma (HCC). [score:2]
Our findings will help to elucidate the functions of miR-744 and their roles in HCC tumorigenesis. [score:1]
HepG2 and SMMC-7721 cells were cotransfected with miR-744 mimics or negative control oligonucleotides. [score:1]
Sense sequence of human miR-744 mimics was 5′- UGC GGG GCU AGG GCU AAC AGC A -3′ and antisense sequence was 5′- UGC UGU UAG CCC UAG CCC CGC A-3′. [score:1]
HepG2 (C) and SMMC-7721 (D) cells were transfected with miR-744 mimics or negative control oligonucleotides. [score:1]
Moreover, restoration of miR-744 rescues c-Myc induced HCC proliferation. [score:1]
HepG2 and SMMC-7721 cells were transfected with miR-744 mimics or negative control oligonucleotides, and c-Myc mRNA and protein levels were examined by qRT-PCR and western blotting, respectively. [score:1]
In this study, we focused on miR-744 which was decreased in HCC tissues and four HCC cell lines. [score:1]
However, the association of miR-744 with HCC cell proliferation is unknown. [score:1]
Restoration of miR-744 rescues c-Myc induced HCC proliferation. [score:1]
In line with these results, miR-744 partially alleviated c-Myc -induced cell proliferation in HepG2 and SMMC-7721 cells (Figure  5C and D). [score:1]
Similar effects of miR-744 were found in SMMC-7721 cells (Figure  2D), with 70.95% ± 8.92% of miR-744 -transfected cells in G0/G1 versus 53.32% ± 8.52% of negative control oligonucleotides -transfected cells. [score:1]
Additional experiments demonstrated that restoration of miR-744 significantly decreased the proliferation of the HepG2 and SMMC-7721 cell lines. [score:1]
Furthermore, cell lines transfected with miR-744 mimics were analyzed in vitro. [score:1]
Previous studies identified a panel of serum miRNAs including miR-744 as potential biomarkers for gastric cancer detection [17]. [score:1]
HepG2 or SMMC-7721 cells were seeded into 96-well plates and incubated in the presence of miR-744 mimics or negative control oligonucleotides. [score:1]
Furthermore, restoration of miR-744 in HCC cells was statistically correlated with decrease of cell growth and restored G1 accumulation. [score:1]
As shown in Figure  1A, miR-744 was significantly decreased in HCC tissues versus adjacent normal tissues. [score:1]
From the CLASH data in KEK293 cells, the potential targeting sequence for miR-744 with a calculated energy of −24.1 kcal/mol is within the protein coding region of c-Myc mRNA from 1162 to 1206. [score:1]
However, the function of miR-744 remains unclear, especially in HCC. [score:1]
Forty-eight hours after transfection with the miR-744 mimics or negative control oligonucleotides, HepG2 and SMMC-7721 cells were analyzed byting, with β-actin as an internal control. [score:1]
However, the role of miR-744 in cancers especially in HCC is not very much known. [score:1]
qRT-PCR -based detection of mature miR-744 was performed as described previously [14]. [score:1]
The result showed that the cell cycle was arrested in G1 phase, with 69.17% ± 8.74% of miR-744 -transfected cells in G0/G1 versus 54.02% ± 7.16% of negative control oligonucleotides -transfected cells in HepG2 cells (Figure  2C). [score:1]
Cell cycle analysis was performed to determine whether the effect of miR-744 on cell proliferation was due to cell cycle arrest. [score:1]
We created luciferase reporter plasmid with wild type or mutant targeting sequence of c-Myc mRNA (Figure  3A), which were cotransfected with miR-744 mimics or negative control oligonucleotides into HEK293 cells for 48 h, followed by measurement of luciferase activity in transfected cells. [score:1]
[1 to 20 of 84 sentences]
4
[+] score: 233
Other miRNAs from this paper: hsa-mir-125a, hsa-mir-146a
And by statistical analysis we found that PTP1B was indeed reduced by the overexpression of miR-744 and up-regulated by the inhibition of miR-744 inhibitors in RMCs (Supplementary Fig. S3A, Supplementary Fig. S3B). [score:10]
To examine the effects of miR-744 on the expression of type-I-IFN-inducible genes, we used mimics (synthesized RNA oligos the same as miR-744) to overexpress miR-744 and inhibitors (synthesized RNA oligos complementary to miR-744) to inhibit miR-744. [score:9]
The expression of some IFN-inducible inflammatory genes (such as CCL2, CCL5, CXCL10, and IL6) was significantly up-regulated by miR-744 in human RMCs, whereas the expression of other IFN-inducible antiviral genes (such as MX1 and IFIT3), which are mainly induced through the classical JAK–STAT signaling pathway 35, were largely unaffected by miR-744. [score:8]
CCL2 expression was also down-regulated by the miR-744 inhibitor 24 h after type I IFN stimulation (Supplementary Fig. S1C). [score:8]
Interestingly, when an miR-744 inhibitor was introduced into RMCs, the coordinated activation of the type I IFN signaling pathway was significantly reduced, as revealed by the down-regulated expression of several IFN-inducible genes. [score:8]
In summary, our data show that miR-744 acts as a feed-forward component of the type I IFN signaling pathway in RMCs, and exclusively affects the expression of inflammatory chemokines and cytokines but not the expression of antiviral genes, by targeting PTP1B. [score:7]
While the miR-744 inhibitor suppressed the expression of those IFN-inducible inflammatory genes (except CCL2) 6 h after stimulation with type I IFN (Fig. 1E). [score:7]
The levels of PTP1B mRNA were detected after stimulation with type I IFN for 6 h. (E) RMCs were transfected with miR-744 mimic or inhibitor and the corresponding control mimic or inhibitor for either 24 h for the mimics or for 48 h for the inhibitors. [score:7]
As expected, mutation of the 3′-UTR of PTP1B abolished the inhibitory effect of miR-744 (Fig. 3C), implying that the inhibitory effect of miR-744 requires the predicted binding sites. [score:6]
RMCs were treated with an miR-744 inhibitor (400 nM) or control inhibitor (400 nM) for 48 h, then the cells were incubated for 6 hours with type I IFN. [score:5]
Further studies of renal biopsies from patients with lupus nephritis will show whether the expression of miR-744 is abnormal, to advance our knowledge of the pathogenesis of lupus nephritis and identify new drug targets. [score:5]
And consistently, we found that overexpressing miR-744 in RMCs reduced the protein levels of PTP1B by western blot (Fig. 3E, left), while inhibition of miR-744 increased the protein levels of PTP1B (Fig. 3E, right). [score:5]
We verified successful overexpression and inhibition of miR-744 by measuring the change of miR-744 expression (Supplementary Fig. S1A and Supplementary Fig. S1B). [score:5]
Consistent with this, the inhibitory effects of the miR-744 inhibitor reduced the CCL2, CCL5, CXCL10, and IL6 protein levels (Fig. 1G,H). [score:5]
miR-744 subsequently represses PTP1B expression, leading to the enhanced activation of TYK2, STAT1, STAT3, ERK, p38, and NF-κB, thus enhancing the expression of IFN -induced inflammatory genes. [score:5]
Then, we found that overexpressing miR-744 in RMCs reduced the mRNA levels of PTP1B (Fig. 3D, left), while inhibition of miR-744 increased the mRNA levels of PTP1B (Fig. 3D, right). [score:5]
The results described above demonstrate that miR-744 positively regulates the type I IFN signaling pathway in RMCs by targeting PTP1B in the signaling cascade. [score:4]
miR-744 regulates the type I IFN signaling pathway by targeting PTP1B in human RMCs. [score:4]
The expression of miR-744 is significantly increased in the glomeruli of diabetic mice 31, and miR-744 regulates transforming growth factor β signal transduction 53. [score:4]
Therefore, we concluded that miR-744 positively regulates the type I IFN signaling pathway in human RMCs by targeting PTP1B. [score:4]
miR-744 targets PTP1B, which is responsible for its regulation of type I IFN signaling pathway. [score:4]
The overexpression of miR-744 promoted the expression of the inflammatory genes downstream of type I IFN, such as CCL2, CCL5, CXCL10, and IL6, at both the mRNA and protein levels, compared with cells transfected with the normal control (NC) (p < 0.01) (Fig. 1A,C,D). [score:4]
To clarify the mechanism of miR-744 in regulating type I IFN signaling, we used western blotting to test whether the overexpression of miR-744 affected the JAK–STAT signaling pathway. [score:4]
Therefore, PTP1B may be a promising target of miR-744. [score:3]
Type I IFN triggers an unknown transcription factor to induce miR-744 expression. [score:3]
Each point shows the mean relative expression level of miR-744 for three independent experiments. [score:3]
Intriguingly, miR-744 had no effect on the expression of traditional antiviral IFN-inducible genes, such as MX1 and IFIT3 (Fig. 1B,F). [score:3]
The expression of miR-744 was detected with qRT–PCR. [score:3]
Because miR-744 does not affect genes with antiviral activities and its functions are cell-type specific, our results suggest that miR-744 has the potential to be one of the drug targets. [score:3]
To confirm that miR-744 binds to the 3′-UTR of PTP1B, we constructed two target-site mutant vectors (Fig. 3A) and transfected RMCs with them, as described above. [score:3]
miR-744 enhances the expression of type-I-IFN-inducible genes in primary human RMCs. [score:3]
In this study, miR-744 clearly increased the expression of some type-I-IFN-inducible genes, such as CCL2, CCL5, CXCL10, and IL6, in human RMCs. [score:3]
Consistent with our previous data, miR-744 did not affect the downstream signaling events of type I IFN in another two cell types (Hela and HEK293T), and no changes were observed in the phosphorylation of STAT1 or STAT3 when miR-744 was overexpressed in Hela cells or HEK293T cells (Supplementary Fig. S2C, Supplementary Fig. S2D). [score:3]
Type I IFN increases the expression of miR-744 in human RMCs. [score:3]
Therefore, we tested the expression of miR-744 in RMCs stimulated with type I IFN for specific times. [score:3]
The results showed that overexpression of miR-744 promoted the phosphorylation of TYK2 and STAT1 (Fig. 2A). [score:3]
Our data showed that silencing PTP1B promoted type I IFN signaling in RMCs, with elevated levels of CCL5 (Fig. 3F), and enhanced the phosphorylation of STAT1 and STAT3 (Fig. 3H), mimicking the effects of miR-744 overexpression. [score:3]
We found that miR-744 base-paired with sequences in the 3′-untranslated region (UTR) of PTP1B (Fig. 3A). [score:3]
How to cite this article: Zhang, X. et al. miR-744 enhances type I interferon signaling pathway by targeting PTP1B in human primary renal mesangial cells. [score:3]
The overexpression of miR-744 not only enhanced the phosphorylation of TYK2, STAT1, and STAT3, but also enhanced the activation of ERK and p38 by IFN. [score:3]
We observed the expression of miR-744 increased at 3 h and peaked at 6 h, after which it gradually declined (Fig. 4A). [score:3]
To confirm the targeting relationship between miR-744 and PTP1B, we conducted a biological validation. [score:3]
The results showed that overexpressed miR-744 caused a considerable increase of the phosphorylation of p38 and STAT3 at 15 min (Fig. 2B). [score:3]
To identify the molecular mechanisms of miR-744 functions, we used a bioinformatic tool to predict the potential targets of miR-744. [score:3]
Further experiments demonstrated that the genes regulated by miR-744 depend most strongly on the activation of MAPKs and NF-κB. [score:2]
Our findings thus far have shown that miR-744 is a positive regulator of type I IFN signaling. [score:2]
As expected, the overexpression of miR-744 effectively attenuated the luciferase activity, compared with NC (Fig. 3B). [score:2]
Thus, miR-744 selectively regulates a subset of IFN-inducible genes in RMCs. [score:2]
Finally, to determine whether miR-744 is regulated by type I IFN, we treated RMCs with IFN and found that mature miR-744 is induced by type I IFN. [score:2]
To determine whether the regulation of type I IFN signaling by miR-744 in human RMCs can be extended to other cells, we used two other cell lines originating from different tissues (Hela cells and HEK293T cells). [score:2]
Therefore, we speculated that other signaling events other than the JAK–STAT signaling pathway were regulated by miR-744 in human RMCs. [score:2]
We compiled a list of all the key negative regulators of the IFN signaling pathway and searched each of their genes for potential miR-744 -binding sites with an algorithm called RNAhybrid (available at http://bibiserv. [score:2]
miR-744 is induced by type I IFN and may act as a feed-forward regulator of the type I IFN signaling pathway. [score:2]
Based on the data described above, miR-744 might act as a feed-forward regulator of the type I IFN signaling pathway (Fig. 4B). [score:2]
And band signal intensity was analyzed using Image J. To create 3′-UTR–luciferase reporter constructs, fragments of the 3′-UTR from the protein-tyrosine phosphatase 1B (PTP1B) gene, containing the predicted miR-744 -binding site, were cloned downstream of the firefly luciferase gene in the psiCHECK™-2 vector (Promega). [score:1]
miR-744 enhances the classical JAK–STAT pathway and non-classical MAPK and NF-κB pathways downstream of type I IFN. [score:1]
These results indicate that miR-744 is induced by type I IFN. [score:1]
Therefore, we tested whether miR-744 affects the type-I-IFN -induced phosphorylation of ERK, p38, and STAT3. [score:1]
Therefore, in this study, we selected primary human RMCs and the type I IFN signaling pathway to explore the functions of mesangial miR-744. [score:1]
Cells were transfected with miR-744 mimic or NC mimic (200 nM) for 24 h, then stimulated with type I IFN for 0 min or 15 min. [score:1]
In Hela and HEK293T cells, these genes were either not affected or reduced or promoted and the extent was not very big (Supplementary Fig. S2A, Supplementary Fig. S2B), which was not consistent with the effects caused by miR-744 in RMCs. [score:1]
However, miR-744 had no apparent effect on the phosphorylation of JAK1 and STAT2 (Fig. 2A). [score:1]
miR-744 enhances both the classical JAK–STAT pathway and non-classical MAPKs and NF-κB pathways downstream of type I IFN. [score:1]
Human RMCs were seeded in a 96-well plate at a concentration of 2 × 10 [4] per well in 100 μL of medium and transfected with a mixture of 50 ng of 3′-UTR luciferase reporter vector or empty vector and 200 nM miR-744 mimic or NC mimic with Lipofectamine 2000 (Gibco), according to the manufacturer’s instructions. [score:1]
We were interested to know whether miR-744 levels are affected by type I IFN. [score:1]
Collectively, the information described above at least partly explains why those antiviral genes, the transcription of which is activated by the STAT1 -dependent transcription factor complex (ISGF3) (Fig. 4B), are not significantly affected by miR-744. [score:1]
Therefore, we propose here that miR-744 acts as a feed-forward component of the type I IFN signaling pathway (Fig. 4B). [score:1]
Therefore, miR-744 promotes the type I IFN signaling pathway (Fig. 4B). [score:1]
Mutant 1 abolished the binding to miR-744 without changing the nucleotide composition of the sequence, while mutant 2 affected both the nucleotide composition of the sequence and the binding of the 3′-UTR to miR-744. [score:1]
RMCs were transfected with an miR-744 mimic (200 nM) or negative control (NC) mimic (200 nM) 24 h before type I IFN was added. [score:1]
Human RMCs were then transiently transfected with the construct, together with either an miR-744 mimic or an NC mimic. [score:1]
[1 to 20 of 71 sentences]
5
[+] score: 74
The TGF-β [1] 137-nucleotide UTR is a direct target of miR-744We performed an initial screen in human tissues, and found widespread expression of miR-744 (Fig. 8). [score:6]
microRNA-744 is highly conserved, and predicted to target TGF-β [1] MicroRNAs are a recently described and generally important mechanism of post-transcriptional regulation of gene expression. [score:6]
These data confirm that miR-744 directly targets the predominant, short, isoform of the TGF-β [1] 3′UTR, and are suggestive that reduced miR-744 expression may be associated with increased TGF-β [1] synthesis. [score:6]
Subsequently, miR-744 was confirmed experimentally to repress TGF-β [1] synthesis, and direct targeting of TGF-β [1] was established using a 3′UTR reporter construct. [score:4]
The TGF-β [1] 137-nucleotide UTR is a direct target of miR-744. [score:4]
Subsequently, we have identified miR-744 as targeting the 137-nucleotide UTR, identifying a microRNA -mediated mechanism of post-transcriptional regulation of TGF-β [1]. [score:4]
0025044.g008 Figure 8 The relative expression of miR-744 in RNA from 8 human tissues. [score:3]
Use of multiple predictive algorithms suggested targeting of the short UTR by miR-744. [score:3]
microRNA-744 is highly conserved, and predicted to target TGF-β [1]. [score:3]
In the current study, we have shown widespread expression of miR-744 in human tissues. [score:3]
We performed an initial screen in human tissues, and found widespread expression of miR-744 (Fig. 8). [score:3]
Increased expression of miR-744 has been detected in B lymphocyte-derived cell lines and peripheral blood mononuclear cells from patients with lupus nephritis [25]. [score:3]
Interestingly a second miR, miR-663, shows considerable seed region homology with miR-744, and exhibits overlapping potential targeting sites within the TGF-β [1] UTR (Fig. 7a). [score:3]
The expression of miR-744 in human tissues. [score:3]
The relative expression of miR-744 in RNA from 8 human tissues. [score:3]
Subsequently, the potential for direct targeting of the TGF-β [1] 3′UTR by miR-744 was evaluated. [score:2]
In contrast, transfection of miR-744 or of control miRs did not significantly alter luciferase mRNA generation (Fig. 10b). [score:1]
control (p = n. s,) miR-744 precursor transfection, 34.0% reduction (p<0.05)). [score:1]
Three of the four miR-744 sites appear highly conserved in vertebrates, while the fourth site is identified only in H sapiens and simians (Fig. 7a). [score:1]
However, while miR-744 appears highly conserved in vertebrates, this is not the case for miR-663 (Fig. 7b). [score:1]
Transfection with miR-744 precursor led to a significant decrease in TGF-β [1] release (Fig. 9a, control transfection 118.5pg/ml, miR-663 precursor transfection 87.0 pg/ml (p = n. s. ), miR-744 precursor transfection 71.7 pg/ml (p<0.05)). [score:1]
0025044.g010 Figure 10Effect of miR-663 and miR-744 transfection on TGF-β [1] short UTR reporter vector. [score:1]
Multiple sites were identified for miR-663 and miR-744. [score:1]
Effect of miR-663 and miR-744 transfection on TGF-β [1] short UTR reporter vector. [score:1]
Vertebrate conservation and multi-species sequence alignments for the short form 3′-UTR of the TGF-β [1] gene at 19q13.2 as well as miR-633 and miR-744 genomic loci. [score:1]
This contrasts with the reduction in endogenous TGF-β [1] mRNA seen following miR-744 transfection (Fig. 9b). [score:1]
miR-744 has been identified in a broad range of cells and tissues in sequencing -based screens of small RNA libraries [23], [24]. [score:1]
Four binding sites for miR-744 were identified in close proximity in the proximal UTR, and interestingly an additional potential miR-744 site was identified in the open reading frame, between nucleotides 1875 and 1895. [score:1]
In each figure, seed sequences are highlighted by horizontal bars for miR-633 (grey) and miR-744 (black). [score:1]
0025044.g007 Figure 7Vertebrate conservation and multi-species sequence alignments for the short form 3′-UTR of the TGF-β [1] gene at 19q13.2 as well as miR-633 and miR-744 genomic loci. [score:1]
Co-transfection of miR-744 precursor with pGL3short led to reduction in reporter vector activity (Fig. 10a, miR-663 precursor transfection, 15.8% reduction vs. [score:1]
[1 to 20 of 31 sentences]
6
[+] score: 24
The differentially expressed miR-744 was shown to target TGFβ, thus its downregulation in horses suffering from severe asthma, as shown in this study, likely leads to increased levels of TGFβ [86]. [score:8]
Hence, upregulation of miR-103 and miR-107 as well as downregulation of miR-744 in asthmatic horses highlight a potential role of this miRNA network in chronic inflammatory conditions. [score:7]
This study reported a deregulation of the cell cycle characterized by an upregulation of various miR-15/16 members, including miR-103 and miR-107a, as well as a downregulation of miR-744. [score:6]
Using DESeq2, we identified 11 miRNAs as statistically significant DEmiRs after accounting for the level of hemolysis: eca-miR-128, eca-miR-744, eca-miR-197, eca-miR-103 and the closely related eca-miR-107a, eca-miR-30d, eca-miR-140-3p, eca-miR-7, eca-miR-361-3p, eca-miR-148b-3p and eca-miR-215. [score:1]
The analysis with the tool edgeR showed following differenced in contrast to the analysis with DESeq2: four miRNAs were not significantly affected by the level of hemolysis (eca-miR-744, eca-miR-128, eca-miR-28-3p and eca-miR-125a-5p) and additionally five significantly affected miRNAs were reported: eca-miR-423-5p, eca-let-7g, eca-miR-19b, eca-miR-425, eca-miR-7177b (Table S6). [score:1]
Additionally, a modulated cytokine profile towards the IL6 and TGFβ side caused by decreased levels of miR-128 and miR-197, as well as increased levels of miR-744 positively affect the maturation of T cells towards the Th17 side. [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 14
Eight miRNAs (miR-183, miR-193a-5p, miR-222, miR-516b, miR-524-5p, miR-601, and miR-629, 99b) were upregulated and five miRNAs (miR-124, miR-32, miR-574-5p, miR-744, and miR-96) were downregulated. [score:7]
miR-184, miR-524-5p, miR-629, and miR-766 were upregulated, while miR-124, miR-222, miR-32, miR-744, and miR-765 were downregulated [28]. [score:7]
[1 to 20 of 2 sentences]
8
[+] score: 13
According to DS analysis, miR744 was up-regulated in 56% of the cases, but Mir34a was not differentially expressed in 78% of the cases and up-regulated in only 22% of the cases. [score:9]
Mir744 participates in post-transcriptional regulation of TGF-beta1 (Martin et al., 2011) which directs cellular processes such as proliferation, differentiation, migration, and survival (Blobe et al., 2000). [score:2]
Post-transcriptional regulation of transforming growth factor Beta-1 by microRNA-744. [score:2]
[1 to 20 of 3 sentences]
9
[+] score: 11
Out of the eight miRNAs, miR-648 was up-regulated and the seven remaining miRNAs were down regulated (miR-744-5p, miR-193b-3p, miR-212-3p, miR-143-3p, miR-93-5p, miR-423-3p and miR-766-3p). [score:5]
We used miScript Primer Assays for 9 miRNAs (miR-744-5p, miR-648, miR-193b-3p, miR-212-3p, miR-143-3p, miR-93-5p, miR-222-3p, miR-423-3p and miR-766-3p) and QuantiTect Primer assays for 9 target genes (CDKN1A, MYC, PTEN, ESR1, ETS1, SOD2, MGMT, KRAS and HNF4A) (Qiagen, Hilden, Germany) to validate the different expression levels of the miRNA and their target genes, which are determined by miRTargetLink prediction software. [score:5]
MiR-744 was deregulated in patients with chronic congestive heart failure [55]. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 11
Among the predicted targets of the deregulated miRNAs, E2F2 and TGFβ 1 have already been shown to be regulated by miR-98 and miR-744, respectively (39, 40). [score:5]
Similarly, miR-744 was down-regulated in macro GH-adenomas vs. [score:4]
Using Ingenuity Pathway Analysis Software on these 22 genes, we found that nine of these genes were linked to the “aggressive pathway” and were predicted to be regulated by four miRNAs (miR-183, miR-340*, miR98, and miR-744) (Table 3). [score:2]
[1 to 20 of 3 sentences]
11
[+] score: 11
AMPK is a known inhibitor of TGF 40, which was targeted by three miRNAs (miR-26a, miR-26b, and miR-744) that were upregulated by metformin in mouse lung. [score:8]
01 Stress response, cell proliferation miR-542 ↓2.60 NA miR-574 ↑2.09 Inflammation (Tlr9 activation), cell proliferation, apoptosis miR-669j ↑3.12 NA miR-672 ↑2.40 NA miR-674 ↑2.19 NA miR-744 ↑4.35Oncogene (Tgf) suppression miR-873 ↑2.53 ↑3.22 NA miR-1930 ↑3.31 NA miR-1934 ↑2.17 ↑3.27 NA miR-1942 ↑2.49 NA miR-3064 ↑2.50 NA miR-3065 ↑3.20 NA miR-3069 ↑2.98 NA miR-3071 ↑3.51 NA miR-3073 ↓2.78 NA miR-3092 ↑3.48 NA miR-3093 ↑3.28 NA miR-3109 ↓2.07 NAAll reported variations were statistically significant (P < 0.05). [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 9
This deletion may deregulate expression of miR-744-5p and may be associated with the abnormal phenotype of ocular albinism. [score:4]
Interestingly, miR-744-5p is expressed specifically in AMD patients and is a promising biomarker for the rapid diagnosis of AMD [56]. [score:3]
Further, both a GNAI3 3' UTR regulatory element, SECIS, and the binding site for miR-744-5p located within the SECIS sequence, are disrupted in Patients 11 and 13 by the deletion c. *1654 delA at Chr1 position 109593976 (Table 6). [score:2]
[1 to 20 of 3 sentences]
13
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
We also found that the expression levels of miR-221, miR-375, miR-223, and miR-744 in plasma have potential as biomarkers in PCa [64, 65, 66]. [score:3]
Moreover, we confirmed that the overexpression of miR-744 in PCa cells induced significant chemoresistance to gemcitabine in vitro [66]. [score:3]
Miyamae M. Komatsu S. Ichikawa D. Kawaguchi T. Hirajima S. Okajima W. Ohashi T. Imamura T. Konishi H. Shiozaki A. Plasma microRNA profiles: Identification of miR-744 as a novel diagnostic and prognostic biomarker in pancreatic cancer Br. [score:1]
We also found that a high miR-744 plasma level correlated with lymph node metastasis and recurrence, and was an independent poor prognostic factor in PCa patients after pancreatectomy. [score:1]
On the other hand, we reported that high miR-744 plasma levels contributed to poorer progression-free survival in non-operable PCa patients receiving gemcitabine -based chemotherapy [66]. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 9
Among 20 expressed miRNAs, the expression levels of hsa-mir-25, hsa-mir-221, hsa-mir-302b, hsa-mir-363, hsa-mir-372, hsa-mir-199a, hsa-mir-302d, hsa-mir-26a, hsa-mir-320, hsa-mir-744, hsa-mir-152 and hsa-let-7e in the study of Morin et al. exceed those obtained with miRExpress, but the levels of hsa-mir-423, hsa-let-7a, hsa-mir-1, hsa-mir-340, hsa-mir-302a, hsa-mir-130a, hsa-let-7f and hsa-mir-122 in the work by Morin et al. are lower than those obtained from miRExpress (Table 6) (full data are available in additional file 7). [score:9]
[1 to 20 of 1 sentences]
15
[+] score: 9
Our study indicates that miR-744 suppresses the expression of TGF-β cytokine which subsequently have the potential to inhibit the Treg cell differentiation and maturation in VL disease (Butz et al., 2012). [score:9]
[1 to 20 of 1 sentences]
16
[+] score: 8
Values are mean ± SD of hsa-miR-744-5p and hsa-miR-486-3p expression subtraction revealed that five out of 62 plasma samples show a minor risk of erythrocyte contamination (ranging from 5.01 to 5.7). [score:3]
Target sequences for the primer sets are shown in Additional file  4. The formula proposed by Blondal et al. identifies haemolysis based on the value obtained by substracting dCT hsa-miR-486-3p from dCT hsa-miR-744. [score:2]
Target sequences for the primer sets are shown in Additional file  4. The formula proposed by Blondal et al. identifies haemolysis based on the value obtained by substracting dCT hsa-miR-486-3p from dCT hsa-miR-744. [score:2]
Two microRNAs affected (hsa-miR-425-5p and hsa-miR-486-3p) and two non-affected by haemolysis (hsa-miR-744-5p and hsa-miR-340-5p) were selected [25]. [score:1]
[1 to 20 of 4 sentences]
17
[+] score: 7
Among these potential miRNA regulators, only 6 are actually expressed in CCs: MIR425, MIR744, MIR146b, Let-7d for the CC [youger]-CC [median] super group and MIR202, Let-7e for the CC [older]. [score:4]
Interestingly MIR202 is a potential regulator of the hyaluronan synthase-encoding gene HAS2 that is related to aging and angiogenesis [22] and MIR744 is a TGFB1 validated regulator [23]. [score:3]
[1 to 20 of 2 sentences]
18
[+] score: 6
Relative expression of mature miR-744, miR-19a, and miR-19b were determined as in (C). [score:3]
Relative expression of mature miR-744, miR-19a, and miR-19b were determined by miRNA-specific qRT-PCR. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 6
TGF-β signalling is regulated by miR-21, which can in turn regulate mature miR-21 expression [37], while our analysis of the TGF-β1 3′-UTR has shown evidence of post-transcriptional regulation by miR-744 [38]. [score:6]
[1 to 20 of 1 sentences]
20
[+] score: 6
A large number of overexpressed IR-responsive miRNAs that we identified in our work were found to be deregulated in human cancers, such as hsa-mir-513 [55], hsa-mir-744 [56], hsa-mir-92a [57], [58], hsa-mir-1228* [59], hsa-mir-671-5p [60], hsa-mir-638 [38], hsa-mir-370 [61], and hsa-mir-675 [62]. [score:4]
In addition, hsa-mir-744 and hsa-mir-17 were also found to be deregulated by IR exposures by others [20]. [score:2]
[1 to 20 of 2 sentences]
21
[+] score: 5
Altered expression of miRNA-221, miRNA-744, and miRNA-376c significantly give a positive identification of the disease (Sandoval-Borquez et al., 2015). [score:5]
[1 to 20 of 1 sentences]
22
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
It has been found that female aging alters the expression of variety of genes in human cumulus cells being essential for oocyte quality and potential targets of specific miRNAs previously identified in cumulus cells, such as miR-425, miR-744, miR-146b, and Let-7d for younger (<30 years) and middle-aged (31–34 years) women and miR-202 and Let-7e for elder (>37 years) women [41]. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 4
Martin, J. et al. Post-transcriptional regulation of Transforming Growth Factor Beta-1 by microRNA-744. [score:2]
For example, Neurogenic Locus Notch Homolog Protein 2 gene (NOTCH2) was regulated by miR-744-5p, -25-3p, -92a-3p, and -27b-3p in KIRC and by miR-744-5p, -106a-5p, -130b-5p, and let-7c-5p in KIRP. [score:2]
[1 to 20 of 2 sentences]
24
[+] score: 4
By performing microarray screening on exosomes, we found nine inflammatory miRNAs which were deregulated in sera of chronic alcohol-fed mice compared to controls including upregulated miRNAs: miRNA-192, miRNA-122, miRNA-30a, miRNA-744, miRNA-1246, miRNA 30b and miRNA-130a. [score:4]
[1 to 20 of 1 sentences]
25
[+] score: 3
Other miRNAs from this paper: bta-mir-744
Seven SNPs were identified within the 3′UTR of FADS2 gene and Target Scan analysis indicated that FADS2-19 (rs210169303) is situated within the binding site for bta-miR-744. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
Only five miRNAs were intronic in genes that play a role in the mRNA subtype classification (hsa-mir-324 in ACADVL, hsa-mir-153 in PTPRN2, hsa-mir-934 in VGLL1, hsa-mir-595 in PTPRN2, hsa-mir-744 in MAP2K4), demonstrating that the miRNA differential expression is not merely a recapitulation of the mRNA classification. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
Among them, the expression patterns of miR-221, miR-744 and miR-376c in serum could be used as biomarkers to distinguish gastric cancer patients from healthy individual (Ref. [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
Out of these, miR-208b-3p, miR-467b-5p, miR-345-3p, and miR-744-3p were differentially expressed during infection in both mouse strains. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 3
MiR-744 and miR-1186 induce Ccnb1 expression and manipulate mouse cell proliferation with putative binding site in the gene promoter [11]. [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-221, hsa-mir-331, hsa-mir-339, hsa-mir-574
From this dataset, we identified 6 Homo sapiens (hsa)-miRNAs targets that were significantly affected by RSV and were also holding a high degree of homology to the mRNA sequences encoding neurotrophic factors or receptors: miR-27a, miR-221, miR-339-5p, miR-453, miR-574, and miR-744 (Table 1). [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 3
In addition, expression patterns of miR-574-3p, miR-574-5p, miR-744*, miR-30a, miR-30d, miR-205 and miR-532-3p are also inconsistent with our results 29. [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
Several recent studies profiling miRNA expression in skeletal muscle of young and old mice have revealed that several miRNAs, including miR-206, miR-698, miR-744-5p, and miR-468, are increased, whereas others, such as miR-29, miR-434, miR-455, miR-382, miR-181a, and miR-221, are reduced in skeletal muscle cells of old animals [82– 84]. [score:3]
[1 to 20 of 1 sentences]
33
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Of these, miR-17-5p, miR-18a, miR-20a, miR-200c, miR-21, miR-218, miR-221, miR-222, miR-25, miR-27a, miR-376c, and miR-744 were found to be significantly elevated in GC patients, and their expression was significantly reduced after surgery [26, 27, 54, 68, 71, 80, 81, 155, 187, 192, 193, 195, 196, 198, 199, 200, 201, 202, 203, 204, 205]. [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1). [score:2]
[1 to 20 of 1 sentences]
35
[+] score: 2
Regulation of 1-acylglycerol-3-phosphate O-acyltransferase 2 by miR-744-5p is also of key importance. [score:2]
[1 to 20 of 1 sentences]
36
[+] score: 2
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
[1 to 20 of 2 sentences]
37
[+] score: 2
Additionally, miR-744 and let-7e levels were biomarkers of overall survival [22]. [score:1]
Recently, Kubiczkova et al have identified a miRNA profile deregulated in MM and MGUS serum, where miR-744, miR-130a, let-7d and let-7e levels were decreased and miR-34a levels were increased in MM and MGUS when compared to healthy controls [22]. [score:1]
[1 to 20 of 2 sentences]
38
[+] score: 2
The most abundant miRNAs associated with mitochondria of HEK293 and HeLa were hsa-miR-423-5p, hsa-miR-320a and let-7 family members (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7h and let-7i) followed by hsa-miR-103b, hsa-miR-140-3p, hsa-miR-744, hsa-miR-107 (Figure 4C, Figure 4D, Table S3). [score:1]
hsa-miR-10a, hsa-miR-128, hsa-miR-1307, hsa-miR-140-3p, hsa-miR-185, hsa-miR-196a, hsa-miR-25, hsa-miR-320a, hsa-miR-330-3p, hsa-miR-340, hsa-miR-423-5p, hsa-miR-629 and hsa-miR-744 significantly associated with the mitochondria of HEK293. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
An miRNA pairwise approach has demonstrated the potential use of two pairs of plasma miRNAs as biomarkers for cognitive-impaired HIV -positive individuals: miR-495-3p in combination with let-7b-5p, miR-151a-5p, or miR-744-5p; and miR-376a-3p/miR-16-5p (211). [score:1]
[1 to 20 of 1 sentences]
40
[+] score: 1
Additionally, the miRNAs mir-130, mir-636, and mir-744 are involved in subnetworks created from enriched GO terms corresponding to abnormal adult neurogenesis, apoptosis, and cell death. [score:1]
[1 to 20 of 1 sentences]
41
[+] score: 1
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
The four novel miRNAs identified by miRdentify partially overlapped with known miRNAs: the ecaub_novel-miR-1175 was only two nucleotides shorter than eca-mir-744, ecaub_novel-mir-1176 overlapped the position of an Ensembl predicted ENSECAG00000025869, whereas the ecaub_novel-mir-1177 was identified on the opposite strand of the eca-mir-486, and ecaub_novel-mir-1778 was located in the region of another Ensembl predicted ENSECAG00000026103. [score:1]
[1 to 20 of 1 sentences]
42
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Of most interest are miRNAs: let-7f, let-7i, miR-24, miR-26b, miR-27a, miR-221, miR-30b, miR-337, miR-339-5p, miR-453, miR-520a, miR-574, and miR-744. [score:1]
[1 to 20 of 1 sentences]
43
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
miR-30d and miR150 as well as other miRNAs were induced by long-term culture for 2 weeks in the absence of differentiation stimulus, while miR-503 and miR-744 were reduced by the long-term culture (Fig. 4C, F). [score:1]
[1 to 20 of 1 sentences]
44
[+] score: 1
We also noticed that a significant number of miRNAs (such as miR-516-3p, miR-744 and miR-506) that had not been previously annotated in male infertility studies were enriched in these gene sets. [score:1]
[1 to 20 of 1 sentences]
45
[+] score: 1
Another study delineated miR-221, miR-376c, and miR-744 as markers for GC detection, which were capable of identifying GC even 5 years prior to clinical diagnosis [28]. [score:1]
[1 to 20 of 1 sentences]
46
[+] score: 1
We confirmed time dependent induction of specific miRNAs (miR-663, miR-638, miR-503 and miR-744) in response to CHIKV infection thus validating the microarray data. [score:1]
[1 to 20 of 1 sentences]
47
[+] score: 1
Our study has shown that miR-122, -638, -572, and -575 were presented at higher levels while miR-744 is at lower levels in the sera of patients with CHB and nonalcoholic steatohepatitis (NASH). [score:1]
[1 to 20 of 1 sentences]