10 publications mentioning mmu-mir-511

Open access articles that are associated with the species Mus musculus and mention the gene name mir-511. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

Our data suggest that in S mice, an overactive HPA leads to high expression of miR-511 and hence strong down-regulation of TNFR1 protein expression and less response to TNF.

We show that delivery of miR-511 to mice down-regulates TNFR1 protein and protects against TNF, as well as against endotoxic shock and lethal hepatitis, and that anti-miR-511 up-regulates TNFR1 and sensitizes for TNF, both in B and in S mice, breaking the resistance of S mice to TNF.

Furthermore, LNA-locked anti-miRs specifically inhibiting miR-511 significantly up-regulated TNFR1 in both B and S MEFs 24 h after transfection (Fig 4C).

The locus on chromosome 2 contains miR-511, which we here establish as a genuine TNFR1 regulator, and which is significantly up-regulated in S mice.

We also found that miR-511 indeed regulates the TNFR1 3′ UTR in a reporter system, that transfection of this miR down-regulates TNFR1 protein in B and S primary fibroblasts moderately and that anti-miRs have the inverse effect.

Figure 5 Inhibition of miR-511 and GR sensitizes for TNF -induced SIRS In vivo effect 24 h after hydrodynamic injection of B mice with plasmids expressing anti-miR-511 (n = 9), anti-miR-CTR (n = 9) or PBS (n = 10).

Finally, in silico prediction of other targets of miR-511, using miR Walk, revealed no less than 997 targets which are predicted by at least 4/10 programs, including some that are important players in the TNF and LPS signalling pathways, that is TRAF2 (Supplementary Fig S2B).

We confirmed that Adx significantly sensitizes mice for TNF -induced inflammation (Fig 6A) (Bertini et al, 1988; Van Bogaert et al, 2011) and found that Adx decreased the expression of several validated GRE genes (Tsc22d3, encoding GILZ, and Dusp1, encoding MKP1) as well as Mrc1 and miR-511 in the spleen and liver (Fig 6A) and also strongly increased the expression of TNFR1 protein in these organs and in serum (Fig 6A), supporting that Mrc-1 is a GRE gene and TNFR1 is under control of GCs.

In accordance with the induction of miR-511, TNFR1 protein expression decreased significantly after DEX in both organs and in the serum, suggesting that increased shedding of sTNFR1 is not involved in the reduced tissue expression of TNFR1 by DEX (Fig 6D).

We found that miR-511 was repeatedly predicted as a TNFR1 regulator by several algorithms, that it is the only putative TNFR1 regulator located in the critical region of chr2 and that it is expressed at significantly higher levels in S than in B mice.

We indeed found that: (i) treatment of S mice with RU486 led to increased TNFR1 protein levels and increased TNF sensitivity, (ii) removal of adrenals in mice markedly reduced the basal expression levels of Mrc1 and miR-511 and increased TNFR1 levels and TNF sensitivity, (iii) injection of DEX (a synthetic GC) in mice led to induction of these genes and to reduction of TNFR1 protein expression in tissues and in the serum (thus in a shedding independent way), (iv) that the induction of miR-511 and reduction of TNFR1 protein is not observed in GR [dim] mice (data not shown) and (v) in the promoter of the Mrc1 gene, we found GRE elements, and Mrc1 was proven to be induced by GCs (Ehrchen et al, 2007).

Also, anti-miRs inhibiting miR-511 delivered specifically in the liver of mice increased TNFR1 expression and sensitized them for TNF -induced SIRS.

By, we measured miR-511 and Mrc1 expression in liver (an essential TNF target organ) and spleen (because the TNFR1 level was very low in this organ) of naive B and S mice and found significantly stronger expression of both RNAs in both organs of S mice (Fig 3A).

Bottom left panel shows significant down-regulation of Tsc22d3 (encoding GILZ), Dusp-1 (encoding MKP-1), Mrc1 and miR-511 in Adx mice.

Interestingly, transient in vivo delivery of miR-511 down-regulated TNFR1 in livers of mice and protected them not only against TNF, but also against endotoxic shock (in a TNFR1 -dependent way) and in a mo del of TNF -mediated lethal hepatitis (induced by ConA).

Significant up-regulation of miR-511 by DEX.

We also found that the TNF resistance of S mice is completely dependent on the overactive HPA of these mice and that the expression of miR-511 and, hence, TNFR1 is regulated by GCs.

Figure 4 miR-511 is a genuine regulator of TNFR1 and has therapeutic potential Inhibition of Rluc activity of the psiCHECK- Tnfrsf1a-3′UTR reporter plasmid with B sequence (black, left panel) and S sequence (grey, right panel) by miR-511 transfection in HEK-293T cells (n = 7–8).

To study the dependency of expression of Mrc1 and miR-511 as well as regulation of TNFR1 on GCs and GR, we adrenalectomized (Adx) mice to remove the major source of GCs.

We hypothesize that GCs protect against TNF -induced lethality partly by induction of miR-511 and consequent down-regulation of TNFR1.

But comparison of the 3′ UTR of the Tnfrsf1a gene revealed two possible miR-511 target sequences, one of which is identical between S and B and the other one showing two nucleotide differences that interfere with the complementarity with the miR-511 seed sequence (Fig 3B).

It is clear that we observe higher expression of Mrc1 and miR-511 in S than in B tissues.

Because miR-511 was described as a regulator, under certain conditions, of TLR4, the LPS receptor (Tserel et al, 2011), we studied whether the protection provided by miR-511 against LPS is mediated by TNFR1 regulation.

In vivo effect 24 h after hydrodynamic injection of B mice with plasmids expressing miR-511 (grey, n = 19), miR-CTR (black, n = 19) or PBS (black, n = 8).

MiRNA-511 is a predicted TNFR1 regulator and is stronger expressed in SPRET/Ei.

This trait appears to result from a very low expression of the TNFR1 protein, and this in turn is under the control of a microRNA, namely miR-511.

miR-511, located in intron 5 of the Mrc1 gene, has been suggested to be strictly co-expressed with Mrc1, encoding the C type 1 mannose receptor (Squadrito et al, 2012).

Figure 3 miR-511 levels, sequence and target sequences in B and S mice miR-511 and Mrc1 mRNA levels in liver (left panel) and spleen (right panel) in B (n = 5) and S (n = 5) mice.

We found only minimal changes in the miR-511 target sequence between B and S in the Tnfrsf1a 3′ UTR, and both these sequences responded equally well to transfected miR-511.

Remarkably, a modest decline in TNFR1 protein expression by miR-511 was able to protect the mice against TNF.

In vivo effect 24 h after injection of S mice with plasmids expressing anti-miR-511 (▲, n = 4), anti-miR-CTR (■, n = 4) or PBS (●, n = 4).

To explore further whether miR-511 is linked with TNFR1 expression and the response to TNF, we delivered LNA-locked anti-miRs by hydrodynamic injection to B mouse livers and studied TNFR1 levels and TNF response 24 h later.

A precursor miRNA expression clone for mmu-miR-511 (GAUACCCACCAUGCCUUUUGCUCUGCACUCAGUAAAUAAUAAUUUGUGAAUGUGUAGCAAAAGACAGGAUGGGGAUCCA), cloned in the pEZX-MR04 vector, was purchased from GeneCopoeia, as well as a scrambled control clone (Supplementary Fig S4).

A low dose of 50 μg DEX protected against TNF -induced lethal SIRS (Fig 6B), and significantly induced the expression of several validated GRE genes, as well as Mrc1 and miR-511 in liver and spleen (Fig 6B and C).

Figure 6 miR-511 expression depends on GCs Adx significantly sensitizes B mice for TNF.

In Supplementary Fig S6, we display the high sequence similarity of the mouse (C57BL6) and human miR-511 seed sequence and two TNFR1 target sequences.

miR-511 injection led to a 20% reduction in TNFR1 protein expression, and this reduction was associated with significant resistance to TNF -induced hypothermia and mortality (Fig 4D).

These data suggest that inhibiting miR-511 leads to loss of the robust TNF resistance of S mice.

Effect of hydrodynamic injection of plasmids expressing miR-511, miR-CTR or PBS on ConA -induced hepatitis in B mice (all groups n = 10).

Co-transfection of HEK293T cells with pre-miR-511 and the reporter plasmid significantly reduced luciferase expression after 48 h in both the B and S reporters (Fig 4A).

The most 3′ target sequence contains two nucleotide differences (in red) in S (lower blue panels) compared to B (upper blue panels), leading to different base pairing with miR-511, as shown in the lower panel.

To study whether miR-511 is a genuine Tnfrsf1a regulator at the 3′ UTR level in both B and S, we generated a reporter plasmid in which the Renilla luciferase gene is controlled by the TNFR1 3′ UTR.

miR-511 is located in an intron of the Mrc1 gene and was suggested to be regulated by the promoter of the host gene (Squadrito et al, 2012).

We validate miR-511 as a true TNFR1 -regulating miR, which can be delivered to mice and then reduces the TNFR1 levels and protects mice in the TNF and other mouse inflammation mo dels.

miR-511 and TNFR1 are GC-regulated.

We then analysed the regulation of miR-511 in mice.

Our findings indicate miR-511 is a genuine TNFR1 regulator and has therapeutic potential, at least in mice.

In agreement with Mrc1/miR-511 co-regulation, we found higher Mrc1 mRNA levels in S than B liver and spleen.

Furthermore, the miR-511-TNFR1 axis has yet to be validated in humans.

miR-511 was predicted by the program MicroSNiPer (http://cbdb.

LNA-enhanced miRCURY i-mmu-miR-511-5p (GAGTGCAGAGCAAAAGGCA) and i-miR-511-5pMMControl were purchased from Exiqon (Supplementary Fig S4).

TNFR1 protein levels in B MEF cultures (black, n = 18) and S MEF cultures (grey, n = 24) 24 h after transfection with miR-511 or miR-CTR.

We found two miRs on chr2, namely miR-296 (predicted only twice and located distally on 97.9 cM) and miR-511 (predicted by 6 algorithms and located at 10.5 cM).

Despite some minor effects of the control miRs, miR-511 provided significant protection against ALT release and hypothermia, without affecting the amount of TNF produced (Fig 4F).

miR-511 -injected mice were significantly protected in the ConA mo del.

LNA-enhanced miRCURY i-mmu-miR-511-5p (GAGTGCAGAGCAAAAGGCA) and i-miR-511-5pMMControl were purchased from Exiqon.

Furthermore, this miR-511 is strongly induced by glucocorticoids, which are the standard first-line anti-inflammation therapeutics.

TNFR1 protein levels in B MEF cultures (black, n = 18) and S MEF cultures (grey, n = 18) 24 h after transfection with anti-miR-511 or anti-miR-CTR.

All mice pretreated with miR-511 (grey, n = 12) survived, while 50% of the mice pretreated with miR-CTR (■, black, n = 12) or PBS (●, black, n = 12) died from TNF injection (middle panel).

One possibility is that subtle differences in the entire TNFR1 mRNA sequence may cause better response of the S Tnfrsf1a gene to miR-511 because of different 3D mRNA structure.

As shown in Fig 4E, miR-511 did no longer protect against LPS in the absence of TNFR1.

We injected pre-miR-511 under control of the CMV promoter in mice using hydrodynamic tail vain injection, which delivers plasmids to the liver (Liu et al, 1999).

Twenty-four hours after hydrodynamic pretreatment of mice with PBS, control miR or miR-511, mice were injected with ConA, leading to TNF release, cell death (ALT release) and hypothermia.

Furthermore, it is not easy to explain the linkage to the miR-511 locus if the sequence of miR-511 appears to be identical in B and S mice.

Here, we studied the protective effect of miR-511 against an LD [50] of LPS in TNFR1 KO mice, that is 500 μg per mouse.

No difference in survival was found between TNFR1 [−/−] mice pretreated with miR-511 (grey, n = 11) or with miR-CTR (■, n = 9) against 500 μg LPS (right panel).

We believe that our data indicate that both phenotypes (low TNFR1 protein and TNF resistance) depend on the HPA but are linked with a downstream GRE gene, relevant in this mo del and that mediates the anti-inflammatory effect of GR, and is located on proximal chr2, namely the Mrc1/miR-511 locus.

SPRET TNF resistance is dependent on miR-511 and on the HPA.

Twenty-four hours after injection of TNF, body temperatures of mice pretreated with miR-511 were significantly higher than those of the miR-CTR and PBS groups (right panel) (all groups n = 10).

These data demonstrate that Mrc-1 and miR-511 increase and TNFR1 protein decrease depend on GCs and GR and unfold a potential new mechanism of anti-inflammatory activity of these steroids, namely via miR-511 induction and TNFR1 reduction.

Final proof that miR-511 is responsible for part of the TNF resistance and low TNFR1 protein levels of S mice should come from genetic disruption of this miR-511, but genetic manipulation of S mice has not been possible so far despite intense efforts (Hochepied et al, 2004).

miR-511-specific anti-miR led to about 50% increase in expression of TNFR1 in livers (Fig 5A), and to a significant sensitization of B mice to TNF as measured by lethality and hypothermia (Fig 5A).

MiRNA-511 is a genuine TNFR1 regulator and has therapeutic potential in mouse mo dels.

Optimization of therapy with miR-511 by more general delivery and safety of this therapy should be addressed in the future.

Since also S mice were sensitized by this anti-miR delivery, we propose that at least part of the extremely robust TNF resistance of S mice depends on miR-511.

Because we previously found, using GR [dim] mice which express a GR that is poor in dimerization, that protection by glucocorticoids (GCs) against TNF depends on GR dimerization and induction of GRE-element containing genes (Vandevyver et al, 2012b), we investigated whether the mouse Mrc1 gene (of which miR-511 is spliced out), contains GRE elements in its promoter.

After hydrodynamic tail vein injection of the miR-511-encoding plasmid, B mice were indeed significantly protected against an LD [50] of LPS, that is 200 μg/mouse (Fig 4E).

Similarly, when B and S MEF cultures were transfected with miR-511 and control miRs, cellular TNFR1 protein levels were significantly reduced 24 h later in both B and S MEFs (Fig 4B).

These results suggest that TNFR1 reduction by miR-511 has protective effects in mouse mo dels in which TNFR1 is implicated.

We show that miR-511 is strongly induced by GCs and is a true TNFR1 modulator and thus an anti-inflammatory miR.

Pre-miR™ miRNA Precursors for mmu-mir-511 (GAUACCCACCAUGCCUUUUGCUCUGCACUCAGUAAAUAAUAAUUUGUGAAUGUGUAGCAAAAGACAGGAUGGGGAUCCA) and a negative control were purchased from Ambion (Supplementary Fig S4).

Analysis of the sequences of the mature miR-511 in B and S revealed no differences.

Survival of B mice and TNFR1 [−/−] mice injected with LPS, 24 h after miR-511 or miR-CTR hydrodynamic plasmid injection.

2

Peripheral blood mononuclear cells (PBMC) of male rs2734647 T-carriers show lower MECP2 expressionSince miR-511 was shown to be expressed in dendritic cells and macrophages (Tserel et al, 2011), we investigated the hypothesized allele-specific downregulation of MECP2 expression in PBMC of male subjects.

This is achieved by transgenic Mecp2 overexpression in mice and—in parallel—through genetic variation -induced non-regulability of MECP2 gene expression (rs 2734647-C: no miR-511 -mediated MECP2 downregulation) in humans.

The distinct suppression of MECP2 expression by miR-511 in SNP rs2734647-T carriers reported here may even be considered as a future treatment target in MECP2 gene duplication syndrome.

Even though the explicit situations are still unknown in which miR-511 regulated MECP2/Mecp2 expression might be of particular physiological relevance, any kind of inflammation in the brain for instance could play a pivotal role, considering the relatively high expression found here in mouse microglia.

Since miR-511 was shown to be expressed in dendritic cells and macrophages (Tserel et al, 2011), we investigated the hypothesized allele-specific downregulation of MECP2 expression in PBMC of male subjects.

In two independent cohorts of schizophrenic individuals,that is, a discovery and a replicate sample, we identify a role of MECP2 in aggressive human behavior and show that a polymorphism in the untranslated region of the gene determines binding efficiency of another brain-expressed regulator, microRNA-511.

Notably, the genotype -dependent expression difference of 40–50% (rs2734647-C>T) in man, at least partially mediated by microRNA-511, is comparable to the level of transgenic overexpression in our mice, emphasizing the physiological significance of these findings.

Even though in both schizophrenia samples, higher expression of MECP2 (3′UTR SNP rs2734647 C carriers lack suppressibility by miR-511) was associated with higher aggression, it has to be considered that also humans are not an isogenic population.

This significance is further supported by the here demonstrated co -expression of MECP2 and miR-511 in human brain areas pivotal for aggression and impulsivity regulation (Brower & Price, 2001; Horn et al, 2003; Berlin et al, 2004; Bauman et al, 2006; Zetzsche et al, 2007; Siever, 2008; Whelan et al, 2012).

In all regions examined, miR-511 expression was found (Fig  6D).

D, E Relative expression of hsa-miR-511 and of MECP2 isoform 2 (MECP2 e2) or both isoforms (MECP2 e1& 2) in aggression/impulsivity – relevant brain areas: FC=frontal cortex, PFC, prefrontal cortex; TC, temporal cortex; OC, occipital cortex; HC, hippocampus; AM, amygdala; as well as in placenta (N = 1) as control tissue.

SNP rs2734647 in the 3′UTR affects miR-511 binding and gene expression.

Interestingly, miR-511 expression was found here also in different mouse brain areas, with levels comparable across both genetic backgrounds.

In the adult C57BL/6N versus FVB/N mouse brain, the expression of miR-511 was low and comparable between strains in cortex (2.39 × 10 [−5] versus 3.71 × 10 [−5]), hippocampus (6.45 × 10 [−5] versus 3.78 × 10 [−5]), and cerebellum (2.22 × 10 [−5] versus 2.36 × 10 [−5]).

Since miR-511 seems to be an important modulator of rs2734647 genotype -dependent MECP2 expression in humans, we asked whether this miR would be detectable in brain regions relevant for impulsivity and aggression (frontal and prefrontal cortex, temporal cortex, occipital cortex, hippocampus, and amygdala).

Whereas mmu-miR-511 levels were under the detection limit in N2a cells, hsa-miR-511 was clearly expressed in HEK293 cells (3.59 × 10 [−3]).

miR-511 is expressed in aggression-relevant humanbrain regions.

Numbers of individual brains included in the analysis are given in brackets; mean ± s. e. m. F Relative expression of MECP2 e2 or MECP2 e1&2 in peripheral blood mononuclear cells (PBMC) of male patients dependent on rs2734647 genotype; N numbers of individuals in brackets; mean ± s. e. m. G Alignment of human and mouse MECP2 3′UTRs around rs2734647 SNP position (black-shadowed) and human and mouse miR-511, illustrating a perfect species-specific seed match; hsa-miR-511 perfectly matches the human MECP2 3′UTR in case of rs2734647 T. Additional mismatches are gray-shadowed.

For the sake of completeness, we determined endogenous expression of miR-511 in the cell lines used for transfection.

In summary, these data strongly suggest miR-511 as rs2734647 genotype -dependent candidate for MECP2 regulation in humans.

Strikingly, the seed sequence of mouse mmu-miR-511 differs from hsa-miR-511 exactly regarding the nucleotide complementary to the SNP position (Fig  6G).

Sequence variation of miR-511 in mouse and man underlines the importance of an interaction with the MECP2 3′UTR.

A perfect seed match of human hsa-miR-511 with the MECP2 3′UTR in carriers of rs2734647-T is the most likely reason for the difference in luciferase activity in contrast to the C-allele, which results in a mismatch in the seed binding region.

Thus, mmu-miR-511 shows an ideal seed match to the mouse 3′UTR, whereas hsa-miR-511 perfectly fits to the human 3′UTR carrying the T-allele.

While miR-4711-3p and miR-511 are predicted to show preferential binding in case of the presence of the T-allele, miR-515-3p has a strong negative ΔΔG only in case of the C-allele, and miR-519e lacks a strong allele preference.

org) revealed that the two mouse lines employed here are not polymorphic for the Mecp2 3′UTR allele or the miR-511 sequence.

Sequence variation of miR-511 in mouse and man underlines the importance of an interaction with the MECP2 3′UTRA perfect seed match of human hsa-miR-511 with the MECP2 3′UTR in carriers of rs2734647-T is the most likely reason for the difference in luciferase activity in contrast to the C-allele, which results in a mismatch in the seed binding region.

In any case, the high conservation of the interaction between miR-511 and MECP2 in both mouse and man makes a specific significance of their interplay very likely.

Of the Renilla luciferase reporter construct (phRL-TK rs2734647C, or rs2734647T, respectively), 1 μg (per well), plus 1 μg (per well) of the reference construct pCMV-LacZ (Clontech, Mountain View, CA, USA) were co -transfected in the presence of 10 pg of mirVana miRNA mimic hsa-miR-4711-3p, hsa-miR-511, hsa-miR-515-3p, hsa-miR-519e-3p, negative control #2 (all Life Technologies, Darmstadt, Germany), or no miRNA, respectively.

This observation may emphasize the importance of the miR-511 interaction with MECP2.

3

To further determine that the up-regulation of mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p was specific response to T. gondii infection, we compared the expression of these three miRNAs in mice infected with T. gondii to mice infected with P. berghei, P. yoelii, P. chabaudi, C. parvum, MHV, or S. aureus.

The levels of the three miRNAs, mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p miRNAs, were found specifically up-regulated in plasma of mice after T. gondii infection.

Mmu-miR-511-5p was found significantly up-regulated in the brain tissues of Angiostrongylus cantonensis (A. cantonensis) infected mice.

We report the evidence that three miRNAs, including mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p, are significantly up-regulated in the plasma of mice after T. gondii infection, which may lead to the discovery of novel biomarkers for T. gondii infection.

Three of those miRNAs (mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p) were prominently expressed in mice infected by both the RH and ME49 strains of T. gondii.

The elevated expression of mmu-miR-511-5p was likely a sign of host immune responses to T. gondii infection.

Figure 3 ROC curve analysis of the expression of plasma levels of mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p.

The expression of the three miRNAs mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p were further assessed in a large number of mice infected with either RH or ME49 strain of T. gondii.

MiR-511 has been reported to positively regulate TLR4, as well as control macrophage production and activation [36].

Thus, the data collectively suggest that the elevated responses of mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p in T. gondii infected mice were parasite-specific.

We focused on the analysis of three miRNAs, mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p, which were detected abundantly in mice infected with the RH (Type I) and ME49 (Type II) strains of T. gondii.

The elevated expression of miRNAs was specific to T. gondiiinfectionWe further investigated if the three elevated circulating miRNAs in plasma, mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p, were host specific responses to T. gondii infection.

Quantitative analysis of these miRNAs in a large set of plasma samples from mice showed that mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p were potentially useful for early stage diagnosis, with a satisfactory degree of sensitivity and specificity.

Scatter plots of plasma levels of mmu-miR-712-3p (A), mmu-miR-511-5p (B), and mmu-miR-217-5p (C) in mice infected with RH and ME49 strains of T. gondii (n = 20 each) and in healthy subjects (n = 20).

Figure 2 Validation of mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p in plasma samples (n = 60).

Of these miRNAs, mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p were detected with the highest abundance (the average Ct values were 17.43, 27.45 and 26.08, respectively).

However, further experiments are required to reveal the function of mmu-miR-511-5p during T. gondii infections.

4

Although the differential expression of miRNA511 could not be verified in in vitro differentiated BMDM cultured in normoxia and in simulated ischemic conditions, that is, serum starvation (data not shown), the differential expression of Cyp2s1 was also seen in the cultured macrophages (Figure 5b).

Of note, the cut-off chosen (base mean >50) for analysis did not allow PHD3 to appear in the list of differentially expressed candidates based on its low overall expression level reflected by a base mean of 18 and RPKM value below 1. Among the identified candidates miRNA511 and Cyp2s1 were previously described to be associated with inflammatory functions.

5

By comparing the downregulated miRNAs in metastatic sarcomas from human and mouse, we found six miRNAs common to both: miR-16, miR-103, miR-146a, miR-223, miR-342 and miR-511 (Fig.  1D,E).

Similar analysis in mouse metastatic sarcomas revealed overlap for several downregulated miRNAs including miR-16, miR-103, miR-146a, miR-223, miR-342 and miR-511.

6

A few miRNAs were detected by TLDA that were expressed at extremely low levels by deep sequencing and not contained in our filtered dataset (e. g. mir-508-3p, mir-511).

7

Similarly, inhibition of miR-511 and miR-99b resulted in reduced DC-SIGN levels (Tserel et al., 2011).

8

We observed that the majority of IL-4-regulated miRNAs were strictly STAT6 -dependent in mouse macrophages, including miR-342-3p, miR-125a-5p, and miR-99b-5p, as well as the previously studied miR-511-5p and miR-324-5p.

9

Type of site Context+ Context Structure Energy Is experimental validated rno-miR-326-5p MIMAT0017028 3 8mer 7mer-m8 imperfect −0.442 −0.242 431 −65.97 TRUE rno-miR-485-5p MIMAT0003203 2 7mer-m8 −0.343 −0.372 290 −34.96 TRUE rno-miR-300-5p MIMAT0004743 1 8mer −0.338 −0.421 156 −15.16 TRUE rno-miR-702-5p MIMAT0017884 1 8mer −0.317 −0.274 142 −13.86 TRUE rno-miR-203b-3p MIMAT0017800 2 7mer-m8 −0.298 −0.421 295 −29.93 TRUE rno-miR-33-3p MIMAT0017104 2 8mer 7mer-m8 −0.297 −0.813 305 −22.7 TRUE rno-miR-466b-3p MIMAT0017285 1 8mer −0.295 −0.47 159 −15.26 TRUE rno-miR-532-5p MIMAT0005322 1 7mer-m8 −0.268 −0.302 151 −10.71 TRUE rno-miR-511-5p MIMAT0012829 1 7mer-m8 −0.268 −0.302 152 −10.37 TRUE rno-miR-343 MIMAT0000591 1 7mer-m8 −0.262 −0.24 140 −13.75 TRUE rno-miR-203a-3p MIMAT0000876 1 8mer −0.245 −0.

10

The results showed that hsa-mir-758 can be assigned to the hsa-mir-379,380, 411 family; hsa-mir-767 can be assigned to the hsa-mir-105 family; and hsa-mir-802 can be assigned to the hsa-mir-511 family.