sort by

9 publications mentioning ptc-MIR169j

Open access articles that are associated with the species Populus trichocarpa and mention the gene name MIR169j. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 9
In addition, drought-responsive lincRNA2752 is a target mimic of ptc-miR169, and could reduce the expression of ptc-miR169. [score:5]
MiR169 is known to regulate the NF-YA transcription factor in plants, which is important in drought stress regulation (Ni et al., 2013). [score:2]
This network may be involved in the lincRNA2752-regulation of drought tolerance through miR169 and NF-YA. [score:2]
[1 to 20 of 3 sentences]
[+] score: 8
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, hsa-mir-519b, ppt-MIR319a, ppt-MIR319b, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR159a, mtr-MIR169k, mtr-MIR169j, mtr-MIR159b, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
Figures 1, 2, 3, and 4 show this type of phasing pattern on the precursors of miR159a, miR169 m, miR319a/b, miR447, miR822 and miR839. [score:1]
1 TAGCCAAGGATGACTTGCCTG 44,458 miR169j. [score:1]
2-3p, miR169j. [score:1]
1* AATCTTGCGGGTTAGGTTTCA 9 miR169j. [score:1]
2)-QRTF, AATGGGAGCTGATTATTACGAGACTGC; At5g48300(miR169j. [score:1]
2-3p TTATATGTTCTTCTCTTTCATC 9 At5g02710 miR169j - miR169j. [score:1]
2-3p (At5g02710), miR169j. [score:1]
2-3p)-QRTR, CCTTGTTGAATTTCTTTTCTTCAATCC; At5g48300(miR169j. [score:1]
[1 to 20 of 8 sentences]
[+] score: 5
Also, in Larix leptolepis, four miRNA families (miR159, miRNA169, miRNA171, and miRNA172) are all induced by abiotic stress and their targets regulate genes crucial to cell development, including MYB transcription factors (miR159), an NF-YA transcription factor (miR169), a scarecrow-like transcription factor (miR171) and apetala2 (miR172; Zhang et al., 2010). [score:5]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR164a, ptc-MIR164b, ptc-MIR164c, ptc-MIR164d, ptc-MIR164e, ptc-MIR164f, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR167a, ptc-MIR167b, ptc-MIR167c, ptc-MIR167d, ptc-MIR167e, ptc-MIR167f, ptc-MIR167g, ptc-MIR167h, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR472a, ptc-MIR472b, ptc-MIR1447, ptc-MIR6459a, ptc-MIR6462a, ptc-MIR6462b, ptc-MIR6462c, ptc-MIR6462d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR6462e, ptc-MIR6462f, ptc-MIR6459b
Several miRNA families, such as miR156, miR159, miR169, miR319, miR396, and miR1447, had moderate expression levels (Table 2). [score:3]
[1 to 20 of 1 sentences]
[+] score: 2
Other miRNAs from this paper: ath-MIR159a, ath-MIR162a, ath-MIR162b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR390a, ath-MIR390b, ath-MIR396a, ath-MIR396b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR159c, ath-MIR319c, osa-MIR156k, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR390, osa-MIR396e, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR162a, ptc-MIR162b, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR408, ptc-MIR482a, ptc-MIR171k, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1448, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR482c, pde-MIR159, pde-MIR162, pde-MIR166a, pde-MIR166b, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR482a, pde-MIR482b, pde-MIR482c, pde-MIR482d, pde-MIR946, pde-MIR947, pde-MIR949a, pde-MIR950, pde-MIR951, pde-MIR952a, pde-MIR952b, pde-MIR952c, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR3701, pde-MIR3704a, pde-MIR3704b, pde-MIR3712
For example, the pde-MIR482 family has 4 members, whereas only one exists in 19 miRNA families (pde-MIR159, pde-MIR162, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR783, pde-MIR946, pde-MIR947, pde-MIR950, pde-MIR951, pde-MIR1310, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR1448, pde-MIR3701 and pde-MIR3712). [score:1]
It includes pde-MIR159, pde-MIR162, pde-MIR166, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396 and pde-MIR399. [score:1]
[1 to 20 of 2 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR435, osa-MIR390, osa-MIR396e, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR162a, ptc-MIR162b, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR403a, ptc-MIR403b, ptc-MIR408, ptc-MIR477e, ptc-MIR477f, ptc-MIR474a, ptc-MIR474b, ptc-MIR474c, ptc-MIR475a, ptc-MIR475b, ptc-MIR475c, ptc-MIR475d, ptc-MIR476a, ptc-MIR476b, ptc-MIR477a, ptc-MIR477b, ptc-MIR478a, ptc-MIR478b, ptc-MIR478c, ptc-MIR478d, ptc-MIR478e, ptc-MIR478f, ptc-MIR478h, ptc-MIR478i, ptc-MIR478j, ptc-MIR478k, ptc-MIR478l, ptc-MIR478m, ptc-MIR478o, ptc-MIR478p, ptc-MIR478q, ptc-MIR478r, ptc-MIR478s, ptc-MIR478n, ptc-MIR481a, ptc-MIR481b, ptc-MIR481c, ptc-MIR481d, ptc-MIR482a, ptc-MIR171k, ptc-MIR403c, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR477c, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR477d, ptc-MIR482c, ptc-MIR828a, ptc-MIR828b, ptc-MIR403d
miR156/157, miR159 and miR319 are represented by 22 and 38 members respectively and three other families (miR169, miR170/171, miR165/166) are represented by more than 20 members. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
Testing the Arabidopsis ath-MIR169 family (14 members), approximately two-thirds could be grouped as homologs: this is as expected, as precursors originating from recent duplications have highly similar loop regions [33]. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR164a, ptc-MIR164b, ptc-MIR164c, ptc-MIR164d, ptc-MIR164e, ptc-MIR164f, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR167a, ptc-MIR167b, ptc-MIR167c, ptc-MIR167d, ptc-MIR167e, ptc-MIR167f, ptc-MIR167g, ptc-MIR167h, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR171k, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1446a, ptc-MIR1446b, ptc-MIR1446c, ptc-MIR1446d, ptc-MIR1446e, ppe-MIR171f, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR169e, ppe-MIR398a, ppe-MIR319a, ppe-MIR319b, ppe-MIR171g, ppe-MIR171b, ppe-MIR171c, ppe-MIR398b, ptc-MIR3627a, ptc-MIR156l, ptc-MIR169ag, ptc-MIR395k, ptc-MIR3627b, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR159, ppe-MIR160a, ppe-MIR160b, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR166a, ppe-MIR166b, ppe-MIR166c, ppe-MIR166d, ppe-MIR166e, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR169a, ppe-MIR169b, ppe-MIR169c, ppe-MIR169d, ppe-MIR169f, ppe-MIR169g, ppe-MIR169h, ppe-MIR169i, ppe-MIR169j, ppe-MIR169k, ppe-MIR169l, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR390, ppe-MIR393a, ppe-MIR393b, ppe-MIR395a, ppe-MIR395b, ppe-MIR395c, ppe-MIR395d, ppe-MIR395e, ppe-MIR395f, ppe-MIR395g, ppe-MIR395h, ppe-MIR395i, ppe-MIR395j, ppe-MIR395k, ppe-MIR395l, ppe-MIR395m, ppe-MIR395n, ppe-MIR395o, ppe-MIR396a, ppe-MIR396b, ppe-MIR3627
miRNA families such as miR156, miR169, miR172, miR395, and miR5021 have the largest number of members with the latter having 18 members. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR164a, ptc-MIR164b, ptc-MIR164c, ptc-MIR164d, ptc-MIR164e, ptc-MIR164f, ptc-MIR167a, ptc-MIR167b, ptc-MIR167c, ptc-MIR167d, ptc-MIR167e, ptc-MIR167f, ptc-MIR167g, ptc-MIR167h, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR394a, ptc-MIR394b, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR403a, ptc-MIR408, ptc-MIR472a, ptc-MIR472b, ptc-MIR482a, ptc-MIR171k, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1444a, ptc-MIR1444b, ptc-MIR1444c, ptc-MIR1446a, ptc-MIR482d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c, ptc-MIR1444d, ptc-MIR1444e
In tobacco, nine miRNAs strongly induced by drought stress have been experimentally identified, among which miR395 and miR169 are the two miRNAs most sensitive to drought stress [14]. [score:1]
[1 to 20 of 1 sentences]