sort by

75 publications mentioning hsa-mir-326

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-326. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 344
As shown in Figure 6A, over-expressed miR-326 inhibited FGF1 expression both in mRNA and protein levels, and FGF1-ORF recued the inhibitory effect induced by miR-326 over -expression. [score:11]
Over -expression of miR-326 inhibited FGF1 expression by targeting its 3′-UTR and further blocked the activity of PI3K/AKT and MEK1/2 pathways, leading to the inhibition of malignant behaviors of glioma cells. [score:11]
Results showed that miR-326 mimics down-regulated the FGF1 expression, while miR-326 inhibitors up-regulated it (Figure 5E, 5F). [score:11]
In brief, the miR-326 over -expression induced by the knockdown of HOTAIR could down-regulate the FGF1 expression that acted as an oncogenic factor in human glioma. [score:9]
These results indicated that the knockdown of HOTAIR inhibited the FGF1 expression by up -regulating miR-326, and the luciferase reporter assay confirmed that FGF1 was the direct target of miR-326. [score:9]
In order to clarify the molecular mechanisms responsible for the inhibition of FGF1 expression, U87 and U251 cell lines were transfected with miR-326 mimics or inhibitors and the expression levels of FGF1 were detected. [score:9]
The mechanism underlying tumor suppressive function of human glioma cells by HOTAIR knockdown is schematically presented in Figure 9. Figure 9 In conclusion, our study revealed that knockdown of HOTAIR inhibited the proliferation, cell migration and invasion, and promoted apoptosis and cell cycle arrest by up -regulating miR-326 in human glioma cells. [score:8]
Moreover, miR-326 over -expression enhanced the effects of low FGF1 expression induced by HOTAIR knockdown and miR-326 inhibition reversed the above effects. [score:8]
In addition, the HOTAIR knockdown could up-regulate miR-326 that were lowly expressed in the glioma tissues and cell lines. [score:7]
Furthermore, knockdown of HOTAIR combined with miR-326 over -expression enhanced the tumor-suppressive effects of HOTAIR knockdown on glioma cell lines. [score:7]
In addition, miR-326 inhibitors rescued the inhibitory effect of sh-HOTAIR on cell proliferation, migration and invasion, and miR-326 inhibitors rescued the increased apoptosis and cell cycle arrest in G0/G1 phase induced by sh-HOTAIR (Figure 3A, 3B, 3C and 3D). [score:7]
These results suggested that HOTAIR knockdown inhibited the FGF1 expression by up -regulating miR-326. [score:7]
These results suggested that miR-326 inhibited the FGF1 expression by targeting its 3′-UTR in U87 and U251 glioma cells. [score:7]
Knockdown of HOTAIR inhibited the FGF1 expression by up -regulating miR-326. [score:7]
These results suggested that knockdown of HOTAIR combined with miR-326 over -expression could suppress the tumor growth and prolonged the survival in nude mice. [score:6]
To determine whether the tumor-suppressive effects of HOTAIR knockdown were mediated by miR-326, we transfected miR-326 mimics or miR-326 inhibitors into the stable sh-HOTAIR cells prior to the assessment of cell proliferation, apoptosis, migration, invasion and cell cycle. [score:6]
The miR-326 expression in stable sh-HOTAIR cell lines was evaluated, and results showed that the miR-326 expression was significantly up-regulated (Figure 2B). [score:6]
However, miR-326 inhibitors restored the low expression levels of FGF1 inducing by HOTAIR knockdown (Figure 5C, 5D). [score:6]
HOTAIR knockdown combined with miR-326 over -expression suppressed the tumor growth and had high survival rates in nude mice. [score:6]
Knockdown of HOTAIR combined with miR-326 over -expression suppressed tumor growth and prolonged the survival of nude mice. [score:6]
As shown in Figure 8G and 8H, the expression levels of FGF1, p-PI3K/PI3K, p-AKT/AKT and p-MEK1/2/MEK1/2 were the lowest in the combined group and were lower in the HOTAIR knockdown or miR-326 over -expression group than those in the control group, whereas they were higher than those in the combined group. [score:6]
Furthermore, HOTAIR was identified as the target of miR-326, and miR-326 mediated the tumor-suppressive effects of HOTAIR knockdown on glioma cell lines. [score:6]
To determine whether the tumor-suppressive effects of miR-326 were mediated by FGF1, down-regulated FGF1 by miR-326 mimics was rescued using FGF1 prior to the assessment of the cell proliferation, apoptosis, migration, invasion and cell cycle. [score:6]
Based on the above results, HOTAIR knockdown combined with miR-326 over -expression exerted the tumor-suppressive function in vivo and in vitro, and there was a negative interaction between these two factors. [score:6]
These results indicated that miR-326 played a tumor-suppressive role in glioma by targeting the 3′-UTR of FGF1. [score:5]
FGF1 mediated the tumor-suppressive effects of miR-326 over -expression on glioma cell lines. [score:5]
The fragment from HOTAIR containing the predicted miR-326 binding site was amplified by PCR and then cloned into a pmirGlO Dual-luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) to form the reporter vector HOTAIR-wild-type (HOTAIR-Wt). [score:5]
Additionally, miR-326 inhibited the biological behaviors and stemness of glioma cells by targeting smoothened (SMO) [30]. [score:5]
Therefore, the reduced FGF1 induced by miR-326 over -expression could attenuate the activity of PI3K/AKT and MEK 1/2 pathways to inhibit the malignant behaviors of glioma cells. [score:5]
As shown in Figure 2A, miR-326 expression was significantly down-regulated in GT and two glioma cell lines compared with that in ST and NBTs, respectively. [score:5]
The following experiments showed that miR-326 inhibited the proliferation, migration and invasion, induced the apoptosis and cell cycle arrest in G0/G1 phase by targeting the 3′-UTR of FGF1 (Figure 6B, 6C, 6D and 6E). [score:5]
Our results further demonstrated that miR-326 inhibited the proliferation, migration and invasion, induced the apoptosis and cell cycle arrest in G0/G1 phase by targeting the 3′-UTR of FGF1 in human glioma cells. [score:5]
In the HOTAIR knockdown group or the miR-326 over -expression group, the tumor volume was smaller than that in the control group, whereas the tumor volume was larger than that in the combined group. [score:4]
The further study showed that miR-326 played a tumor-suppressive role by down -regulating FGF1 in glioma cell. [score:4]
The number of actively proliferative Ki-67 positive cells in the HOTAIR knockdown group or the miR-326 over -expression group was less than the control group but more than the combined group. [score:4]
As shown in Figure 8A, 8B, 8C and 8E, the tumor volume was smallest in the group of HOTAIR knockdown combined with miR-326 over -expression. [score:4]
As shown in Figure 8I, the number of proliferative Ki-67 positive cells was least in the HOTAIR knockdown combined with miR-326 over -expression group. [score:4]
Thus, miR-326 might have a downstream target that could be regulated by miR-326. [score:4]
The in vivo study also demonstrated that knockdown of HOTAIR combined with miR-326 over -expression produced the smallest tumor and the longest survival in nude mice. [score:4]
The HOTAIR knockdown group or the miR-326 over -expression group had higher survival rates than the control group, whereas the survival rates in these two groups were lower than those in the combined group. [score:4]
Previous study showed that miR-326 acted as a tumor-suppressive factor by down -regulating pyruvate kinase type M2 (PKM2) [26] and Nin one binding protein (NOB1) in human glioma [29]. [score:4]
The apoptosis rate in the HOTAIR knockdown or miR-326 over -expression group was higher than that in the control group, whereas the apoptosis rate was lower than that in the combined group (Figure 8J). [score:4]
Based on the above results, we confirmed that miR-326 mediated the tumor-suppressive effects of HOTAIR knockdown on glioma cell lines. [score:4]
Meanwhile, our present study showed that knockdown of HOTAIR increased miR-326 expression. [score:4]
These results suggested that FGF1 was a direct target of miR-326. [score:4]
Effects of HOTAIR and miR-326 on the expression of FGF1 in the mRNA C. and protein levels D. Data are presented as the mean ± SD (n = 5, each group). [score:3]
A. The effects of miR-326 and FGF1-ORF (or FGF1-ORF-3′UTR) on the expression of FGF1 in the mRNA and protein levels in U87 and U251 cells. [score:3]
Previous studies have also shown the low expression levels of miR-326 in several cancers including colorectal cancer [24], multiple sclerosis [25] and glioblastoma [26]. [score:3]
The expression of miR-326 in the human glioma tissues and cell lines were analyzed by real-time PCR. [score:3]
In addition, in the sh-HOTAIR combined with miR-326 mimics group, the FGF1 expression was reduced in both mRNA and protein levels (Figure 5C, 5D). [score:3]
The stable sh-HOTAIR cells co -transfected with miR-326 mimics had the strongest inhibitory effect on cell proliferation, migration and invasion, and the highest apoptotic rate and the cell cycle arrest in G0/G1 phase. [score:3]
HOTAIR was the target of miR-326. [score:3]
MiR-326 mediated the tumor-suppressive effects of HOTAIR knockdown on glioma cell lines. [score:3]
Effects of miR-326 on the expression of FGF1 in the mRNA E. and protein levels F. Data are presented as the mean ± SD (n = 5, each group). [score:3]
B. Relative expression of miR-326 after cells transfected with short-hairpin RNA plasmids of HOTAIR. [score:3]
Taken together, the HOTAIR-miR-326-FGF1 axis played an important role in human glioma and suggested a promising therapeutic target in glioma treatment. [score:3]
Furthermore, the miR-326 expression was negatively correlated with the histopathological grades of gliomas. [score:3]
Figure 6 A. The effects of miR-326 and FGF1-ORF (or FGF1-ORF-3′UTR) on the expression of FGF1 in the mRNA and protein levels in U87 and U251 cells. [score:3]
A. MiR-326 expression in normal brain tissues (NBTs), different grades of human glioma tissues (GT), the surrounding non-neoplastic tissues (ST) and human glioma cell lines. [score:2]
MiR-326 mimics, inhibitors and their respective NC were synthesized (Life Technologies Corporation, MD, USA) and transfected into cells in the in vitro study. [score:2]
And the Taqman MicroRNA Reverse Transcription Kit and Taqman Universal Master Mix II with the TaqMan MicroRNA Assay of miR-326 and U6 (Applied Biosystems, Foster City, CA, USA) were used for testing the expression levels of miR-326 in cells and tissues. [score:2]
Although the interaction between miR-326 and HOTAIR was confirmed, the biological behaviors of glioma cell regulated by miR-326 and HOTAIR need to be well confirmed. [score:2]
Figure 2 A. MiR-326 expression in normal brain tissues (NBTs), different grades of human glioma tissues (GT), the surrounding non-neoplastic tissues (ST) and human glioma cell lines. [score:2]
For analysis of the mechanism of FGF1 regulated by miR-326, the full-length FGF1 with 3′-UTR sequences (or without 3′-UTR sequences) was constructed in pEX-2 plasmids (GenePharma) and were referred as to FGF1-ORF-3′UTR (or FGF1-ORF). [score:2]
Our results showed that miR-326 had a low copy number in human glioma tissues and cell lines. [score:1]
Therefore, the HOTAIR-miR-326-FGF1 axis might represent a promising therapeutic strategy for the treatment of human glioma. [score:1]
D. The effects of miR-326 and FGF1-ORF (or FGF1- ORF-3′UTR) on cell migration and invasion of U87 and U251 cells. [score:1]
C. The predicted miR-326 binding site of HOTAIR (HOTAIR-Wt) and the designed mutant sequence (HOTAIR-Mt) are indicated. [score:1]
Taken together, we found that the HOTAIR-miR-326-FGF1 axis had an important role in human glioma. [score:1]
pre-miR-326 + FGF1-NC group, [#] P < 0.05 vs. [score:1]
However, the functional role of miR-326 in this progress was still unknown. [score:1]
Our results showed that the luciferase activity was significantly decreased by the co-transfection of pre-miR-326 and HOTAIR-Wt rather than the co-transfection of pre-NC and HOTAIR-Wt, suggesting that. [score:1]
Moreover, the interaction among HOTAIR, miR-326 and fibroblast growth factor 1 (FGF1) was also studied in order to reveal the underlying mechanisms. [score:1]
C. The effects of miR-326 and FGF1-ORF (or FGF1-ORF-3′UTR) on apoptosis of U87 and U251 cells. [score:1]
G. The predicted miR-326 binding sites in the 3′-UTR region of FGF1 (FGF1-Wt) and the designed mutant sequence (FGF1-Mt) are indicated. [score:1]
HOTAIR was predicted to harbor one miR-326 binding site. [score:1]
Furthermore, miR-326 also acts as a prognostic indicator in human glioma [27]. [score:1]
To generate HOTAIR(−) + miR-326(+) stably transfected cell lines, the pGCMV/EGFP/miR-326 plasmids was transfected in HOTAIR (−) stably transfected cells and selected by the culture medium containing 10 μg/ml Blasticidin. [score:1]
pre-miR-326 + FGF1-ORF group. [score:1]
The cartoon of the mechanism underlying the HOTAIR-miR-326-FGF1 axis in U87 and U251 cells. [score:1]
E. The effects of miR-326 and FGF1-ORF (or FGF1-ORF-3′UTR) on the cell cycle in U87 and U251 cells. [score:1]
To mutate the putative binding site of miR-326 in the HOTAIR, the sequence of putative binding site was replaced as indicated and was named as HOTAIR-mutated-type (HOTAIR-Mt). [score:1]
miR-326(+) group. [score:1]
To mutate the putative binding site of miR-326 in the 3′-UTR-containing vector, the sequence of putative binding site was replaced as indicated and was named as FGF1-mutated-type (FGF1-Mt). [score:1]
The plasmid pGCMV/EGFP/miR-326 (GenePharma) was transfected into cells and selected by the culture medium containing 10 μg/ml Blasticidin (Life Technologies Corporation, Carlsbad, CA, USA) to generate miR-326 (+) stably transfected cell lines. [score:1]
Meanwhile, co-transfection of pre-miR-326 and HOTAIR-Mt did not change the luciferase activity, suggesting that the miR-326 binding site within HOTAIR was functional (Figure 2C). [score:1]
B. The effects of miR-326 and FGF1-ORF (or FGF1-ORF-3′UTR) on cell proliferation of U87 and U251 cells. [score:1]
[1 to 20 of 87 sentences]
2
[+] score: 221
MiR-326 Inhibits Glioma Cell Proliferation by Suppressing NOB1 Based on the findings described above, we hypothesized that miR-326 might inhibit cell proliferation and arrest cell cycle progression through the down-regulation of NOB1 expression. [score:12]
NOB1 is a Novel Target of miR-326Using TargetScan software [17], NOB1 was identified as a likely target of miR-326 because it contains a putative miR-326 target site in its 3′-UTR (Figure 1A). [score:9]
Overexpression of miR-326, which suppresses the expression of NOB1, activates the MAPK patheay by increasing the phosphorylation of ERK1/2, JNK and p38 MAPK, which inhibits the cell proliferation and induced apoptosis in human glioma. [score:9]
Based on the findings described above, we hypothesized that miR-326 might inhibit cell proliferation and arrest cell cycle progression through the down-regulation of NOB1 expression. [score:8]
Overexpression of miR-326 down-regulated NOB1 mRNA and protein expression. [score:8]
Using TargetScan software [17], NOB1 was identified as a likely target of miR-326 because it contains a putative miR-326 target site in its 3′-UTR (Figure 1A). [score:7]
miR-326 significantly repressed NOB1 protein expression (B, C) The down-regulation of NOB1 mRNA following miR-326 transfection was determined by RT-PCR (*p<0.01). [score:6]
As shown in Figures 3A and B, ectopic expression of miR-326 significantly inhibited the growth of glioma cells compared to the negative control 3 d after infection (P<0.05),and there were no statistically significant differences in growth rate between miR-326 overexpressing cells and NOB1 shRNA infected cells. [score:6]
In this study, we demonstrated that miR-326 inhibits tumorigenesis both in vitro and in vivo by blocking a novel miR-326 target, NOB1, which interacts with the 19S regulatory particle and is required for the maturation of the 26S proteasome [22], [23]. [score:6]
Furthermore, we demonstrate that miR-326 inhibits the activation of the MAPK pathway, which is one of the core pathways in glioma, and miR-326 overexpression impaired cell viability and the invasiveness of glioma cells. [score:5]
Overexpression of miR-326 alters the expression of key components of the MAPK pathway. [score:5]
MiR-326 was shown to be expressed at low levels in gliomas, and forced expression of this miRNA was cytotoxic in standard glioma cell lines and in more resistant glioma stem-like cell lines. [score:5]
These results demonstrated that miR-326 overexpression significantly inhibited tumor formation in human glioma cells, and suggest that miR-326 may play a critical role in the tumorigenicity of human glioma cells in vitro and in vivo. [score:5]
miR-326, as a tumor suppressor by targeting NOB1, decreased the tumorigenesis of glioma cells in vivo and in vitro through the modulation of the MAPK pathway. [score:5]
miR-326 overexpression or NOB1 shRNA significantly inhibited tumor formation. [score:5]
These findings indicate that exogenous overexpression of miR-326 may prove to be a promising strategy for targeted therapies in malignant glioma. [score:5]
Overexpression of miR-326 Inhibits Carcinogenesis in Human Glioma Cells. [score:5]
miR-326 Regulates the Expression of Key Components of the MAPK Signaling Pathway. [score:4]
The down-regulation of miR-326 in gliomas was shown to be associated with a feedback loop involving Notch that impaired glioma cell tumorigenicity [11]. [score:4]
Taken together, these results establish miR-326 as a regulator of NOB1 expression and MAPK pathway activity in human glioma, with potential therapeutic implications. [score:4]
MiR-326 Inhibits Glioma Cell Proliferation by Suppressing NOB1. [score:4]
After 5 d, the growth of A172 cells expressing miR-326 or treated with NOB1 shRNA was decreased to approximately 50% of the control cells. [score:3]
In the present study, we focused on miR-326, which has been shown to suppress tumor growth in medulloblastoma and malignant glioma. [score:3]
MiR-326 was first identified in a study of miRNAs expressed in neurons [9]. [score:3]
0068469.g001 Figure 1Identification of miR-326 target sites within the NOB1 3′-UTR. [score:3]
miR-326 expression or NOB1 silencing causes G1 cell cycle arrest, and enhanced early apoptosis. [score:3]
U87 cells were co -transfected with luciferase reporter plasmids containing either WT or MT miR-326 target sites and miR-326 or miR-NC precursors. [score:3]
To test this hypothesis, A172 and U373 cells were transiently transfected with miR-326 or miR-NC precursors, which miR-326 significantly repressed NOB1 expression, the intervention effects of which was similar to NOB1 RNA interference (RNAi) (Figure 2). [score:3]
The sequence of wild-type (WT) and mutant (MT) miR-326 target sites in the NOB1 3′UTR are shown. [score:3]
Overexpression of miR-326 decreased the tumorigenesis of glioma cells in vivo and in vitro through the modulation of the MAPK pathway. [score:3]
Importantly, rescue experiments demonstrated that the phenotypic effects of Notch and miR-326 were each partially mediated by suppression of the other [11]. [score:3]
NOB1 is a Novel Target of miR-326. [score:3]
In conclusion, NOB1 was identified as a novel target of miR-326. [score:3]
Identification of miR-326 target sites within the NOB1 3′-UTR. [score:3]
In this study, we show for the first time that miR-326 potently and directly regulates NOB1. [score:3]
The miR-326 target sequences and full-length wild-type NOB1 3′-UTRs reduced the relative luciferase activity only when miR-326 was present, but not when the corresponding mutant was introduced with miR-326 (Figure 1B). [score:3]
miR-326 overexpression or NOB1 silencing decreased colony formation. [score:3]
The interplay among miR-326, NOB1 and the MAPK pathway was shown in Fig. 9. Moreover, NOB1 expression might be associated with tumor grade as well as the prognosis of glioma patients. [score:3]
Analysis of cell cycle distribution in human glioma cells overexpressing miR-326 showed a substantial decrease in S-phase and an increase in G1 phase populations, leading to a significant delay of proliferation in U373 and A172 glioma cells. [score:3]
These results indicate that NOB1 mRNA is a specific target of miR-326. [score:3]
The dysregulation of miR-326 and its possible involvement in different cancers such as medulloblastoma, cholangiocarcinoma, and chronic lymphocytic leukemia have been suggested in previous studies [12], [13]. [score:2]
In A172 (B) and U373 (C) cells, the phosphorylation of all three components of MAPK pathway were significantly increased after miR-326 overexpression or NOB1-shRNA compared to the controls. [score:2]
Compared with miR-control cells, miR-326 overexpressing cells and NOB1 silencing cells showed a substantial decrease in the proportion of cells in S-phase and an increase in the number of cells in G1 phase in both two glioma cell lines (Figures 4A and B). [score:2]
This growth inhibitory effect was also observed by colony formation in soft agar and nude mouse xenograft assays, suggesting that miR-326 and NOB1 are critical for human glioma tumorigenesis in vitro and in vivo. [score:2]
Similar to NOB1 silencing, overexpression of miR-326 caused a substantial reduction in colony formation in soft agar compared with the control cells (P<0.05; Figures 5A–D). [score:2]
A point mutation (underlined) was made in the seed region to block the binding between miR-326 and mRNA. [score:2]
No significant difference in BrdU incorporation was observed between cells with different treatment at 24 h. However, BrdU incorporation was decreased in A172 cells expressing miR-326 or through NOB1 shRNA treatment compared to the controls at 72 h, similar results were observed in U373 cells (Figures 3C and D). [score:2]
Therefore, the wild type plasmid was created containing the 3′-UTR of NOB1 with complementary sequence of miR-326 (pGL3-NOB1 3′-UTR wild), and a mutant plasmid was generated containing the mutation sequence without complementary sequence of miR-326 (pGL3-NOB1 3′-UTR mut). [score:2]
Mean tumor volume in the miR-326 group or the NOB1shRNA group was 697.02 mm [3] or 745.91 mm [3], whereas tumor volumes in mice treated with saline or negative control plasmid were 919.56 mm [3] or 1077.27 mm [3], respectively (P<0.01) after 21 d (Figure 5E). [score:1]
However, the physiological and pathological functions of NOB1 remain unclear, and its relationship with miR-326 has not been examined to date. [score:1]
Cell viability and proliferation were examined in human glioma cells treated with miR-326 precursor. [score:1]
To assess the effect of miR-326 on apoptosis, human glioma U373 cells were stained with Annexin V-FITC and propidium iodide (PI) after transfection of cells with miR-326, miR-NC or NOB1 shRNA for 72 h. As shown in Figure 4C, more than 81% of the untreated controls or miR-NC cells were viable, whereas only about 66% of the miR-326 cells or NOB1 silencing cells were viable. [score:1]
miR-326 and full-length wild-type NOB1 3′UTR decreased luciferase activity. [score:1]
A172 cells that had been infected with miR-326 precursor, control precursor, NOB1 shRNA or nothing were plated in wells coated with agar. [score:1]
To determine the role of miR-326 in the tumorigenesis of human glioma cells in vitro, colony formation in soft agar was assessed in A172 and U373 cells. [score:1]
A172, U373 and HEK293T cells were seeded in 24-well plates overnight and then transiently transfected with miR-326 precursor, control miR-326 antisense oligonucleotide or siRNA oligos using Lipofectamine 2000 (Invitrogen, CA, USA) following the instructions of the manufacturer. [score:1]
The Annexin V-FITC Apoptosis Detection kit (Calbiochem) and PI (Sigma) was used to assess the apoptotic effect of miR-326. [score:1]
Schematic diagram illustrating the interplay among miR-326, NOB1 and the MAPK pathway in glioma. [score:1]
Early apoptosis rates averaged from four experiments were 12.1% in the miR-NC group, 11.7% in the untreated control group 26.3% in the miR-326 group, and 27.1% in the NOB1-shRNA group (P<0.01). [score:1]
0068469.g005 Figure 5 In vitro and in vivo tumorigenesis of A172 and U373 cells treated with miR-326 precursor. [score:1]
One miR-326 binding site was detected in the NOB1 3′-UTR. [score:1]
In vitro and in vivo tumorigenesis of A172 and U373 cells treated with miR-326 precursor. [score:1]
Pre-hsa-miR-326 RNAs or non-functional control miR-NC RNAs were co -transfected with the above-mentioned reporter vectors into the human glioma cell line U87. [score:1]
These findings suggest that miR-326 induced early apoptosis in glioma cells. [score:1]
In brief, human A172 and U373 glioma cells were grown, and then infected with miR-326 precursor, control precursor or NOB1-shRNA. [score:1]
0068469.g002 Figure 2(A) HEK293T cells were transfected with previously generated miR-326, miR-NC, NOB1 shRNA or untreated control vectors. [score:1]
When the female BALB/c-nu mice were 7–8 weeks of age, each mouse was inoculated with 1.5×10 [7] U373 cells transfected with miR-326 or miR-control or NOB1 shRNA in 0.2 mL of medium subcutaneously in the forelimb, the mouse injected mock-infected cells as control. [score:1]
To further confirm the effect of increased miR-326 levels on the tumorigenesis of glioma cells in vivo, U373 cells transfected with miR-326, miR-control or NOB1 shRNA were inoculated into the flank of nude mice. [score:1]
Transfection with miR-326 markedly reduced in vivo tumorigenicity of glioma cells in an orthotopic mouse mo del. [score:1]
[1 to 20 of 69 sentences]
3
[+] score: 192
The effect on miR-326 expression for both the mimic and the inhibitor peaked at a concentration of 100 nM (26-fold increase by miR-326 mimic and 0.33-fold decrease by miR-326 inhibitor, P<0.01), and 50 nM, 100nM miR-326 mimic and 100 nM miR-326 inhibitor regulated Bcl-xL levels significantly (P<0.05, relative to NC). [score:10]
Data collected here indicate that miR-326 contributes to platelet apoptosis by inhibiting the expression of anti-apoptotic Bcl-xL, thus providing new insights into the molecular mechanisms affecting differential platelet gene regulation and improving understanding of the roles of platelets in multiple diseases. [score:8]
To directly determine whether miR-326 modulates Bcl-xL expression, miR-326 mimic, miR-326 inhibitor, and the corresponding negative controls (miR-NC or inhibitor-NC) were transfected into LDPs at final concentrations of 50, 100, and 200 nM. [score:8]
Inhibition of miR-326 expression was found to increase the expression of Bcl-xL mRNA and protein. [score:7]
As expected, miR-326 mimic specifically increased the expression of miR-326 24 h after transfection, and the miR-326 inhibitor specifically decreased miR-326 expression (Fig 2A and 2B). [score:7]
In a previous study, results showed that miR-326 was upregulated in platelets during storage, suggesting an association between miR-326 expression and apoptosis [20]. [score:6]
To determine whether miR-326 mimic and miR-326 inhibitor also modulate Bcl-xL expression, platelets were collected 24h or 48 h after transfection and the Bcl-xL mRNA and protein levels were assessed by qRT-PCR and western analyses. [score:5]
demonstrate that miR-326 inhibits the expression of Bcl-xL and induces the apoptosis of platelets. [score:5]
, Guangzhou, China) were structurally similar to the miR-326 mimic and inhibitor but were not predicted to target the 3′-UTR of Bcl-xL. [score:5]
These results suggest that miR-326 can directly regulate the expression of Bcl-xL mRNA and protein in platelets in vitro. [score:5]
The ability of miR-326 to regulate Bcl-xL expression is likely to take place through direct binding to the 3′-UTR region of Bcl-xL mRNA with complete complementarity to its seed region as shown by luciferase assay, but effects on other members of the Bcl-2 family are likely to be indirect. [score:5]
These results suggest that miR-326 directly targets the 3′-UTR of Bcl-xL, but not the 3′-UTR of Bak. [score:4]
Mimics and inhibitors were used to further examine the potential relevance and mechanism of miR-326 in regulating platelet apoptosis. [score:4]
However, after transfection, 100nM miR-326 inhibitor increased the Bcl-xL mRNA levels significantly (P<0.05, compared with inhibitor-NC) (Fig 2C). [score:4]
For this reason, it is here speculated that the decreased expression is more likely an indication of an indirect response by which miR-326 triggers mitochondrial pathway -dependent platelet apoptosis. [score:4]
MiR-326 targets the 3′-untranslated region (UTR) of Bcl-xL but not that of Bak. [score:4]
However, there was no inhibition of a reporter vector with mutations in the miR-326 -binding site (Bcl-xL-mut) (P>0.05). [score:4]
In this way, miR-326 is likely to promote apoptosis in platelets by attenuating Bcl-xL expression. [score:3]
Platelets are not activated by miR-326 expression. [score:3]
MiR-326 regulates the expression of endogenous Bcl-xL. [score:3]
0122784.g004 Fig 4Leukocyte -depleted apheresis platelets (LDPs) were untransfected (control) or transfected with 50 nM of miR-326 mimic or a non -targeting negative control miRNA (miR-NC). [score:3]
A fragment corresponding to the putative target site of miR-326 was ligated to the luciferase gene within psiCHECK-2 vector (Promega, Madison, WI, U. S. ). [score:3]
An increase in the expression of P-selectin, lysosomal granule membrane protein, and the activation of integrin ɑIIbβ3 in platelets was observed over time, but there was no significant difference for platelets transfected with miR-326 mimic versus miR-NC. [score:3]
These results show that storage of LPDs causes increased in membrane disruption and also indicate that the overexpression of miR-326 disrupts the mitochondrial membrane potential, which is an indicator of apoptosis. [score:3]
To confirm whether miR-326 can modulate the expression of Mcl-1, Bcl-2 or Bak, these mRNA were analyzed simultaneously. [score:3]
To identify potential targets of miR-326 that could be associated with apoptosis in platelets, we analyzed the 3′-UTR of mitochondrial Bcl-2 family genes. [score:3]
0122784.g006 Fig 6Leukocyte -depleted apheresis platelets (LDPs) were untransfected (control) or treated with 50 nM miR-326 mimic or non -targeting negative control (miR-NC). [score:3]
indicated a putative miR-326 target site within the 3′-UTR of Bcl-xL (gene: BCL2L1) and Bak (gene: BAK1). [score:3]
However, miR-326 did not inhibit the activity of the reporter vector containing the mutated 3′-UTR sequence, demonstrating that its effects were specific (Fig 1B). [score:3]
Modulation of miR-326 expression. [score:3]
have shown that overexpression of miR-326 reduces both mRNA and protein levels of Bcl-xL. [score:3]
Bioinformatic analysis and luciferase assays suggested that miR-326 does not directly target the Bcl-2 or Bak promoters (data not shown). [score:3]
These modulated the expression of miR-326 in stored apheresis platelets. [score:3]
0122784.g002 Fig 2(a, b) Transfection efficiency of miR-326 mimic and miR-326 inhibitor in leukocyte -depleted apheresis platelets (LDPs) were determined by qRT-PCR. [score:3]
Leukocyte -depleted apheresis platelets (LDPs) were untransfected (control) or treated with 50 nM miR-326 mimic or non -targeting negative control (miR-NC). [score:3]
To assess the influence of miR-326 on platelet apoptosis, LDPs were harvested 24 h or 72 h after transfection with mimic or inhibitor. [score:3]
In contrast, 22.3 ± 2.1 of miR-326 inhibitor -transfected platelets exhibited mitochondrial depolarization. [score:3]
MiR-326 negatively regulates the expression of Bcl-xL. [score:3]
To investigate the role of miR-326 in the expression of the Bcl-xL mRNA and platelet apoptosis, LDPs were transfected with miR-326 miRNA agomir (mimic) or miRNA antagomir (inhibitor) (RiboBio Co. [score:3]
indicated that miR-326 had no significant effect on Bcl-2 and Bak mRNA expression, Mcl-1 mRNA was not detected (Fig 5B and 5C). [score:3]
A preliminary study demonstrated that the expression of miR-326 increased visibly when the apheresis platelets were stored in vitro [20]. [score:3]
MiR-326 was found to be significantly more effective than miR-NC at inhibiting the activity of the reporter vector containing the 3′-UTR of Bcl-xL (P<0.01). [score:3]
Bioinformatic analysis was used to explore target genes and the main functions of miR-326. [score:3]
Leukocyte -depleted apheresis platelets (LDPs) were untransfected (control) or transfected with 50 nM of miR-326 mimic or a non -targeting negative control miRNA (miR-NC). [score:3]
In contrast, miR-326 did not significantly inhibit the luciferase activity of the reporter vector containing either the wild type or mutated Bak 3′-UTR sequence (P>0.05) (Fig 1C). [score:3]
miR-326 interacts directly with the 3′-UTR of Bcl-xL. [score:2]
At 72 h, only 12.3±2.1% of control non -transfected platelets and 36.83±2.36% of miR-NC -transfected platelets exhibited mitochondrial depolarization, whereas 55.17±12.5% of miR-326 mimic -transfected platelets exhibited mitochondrial depolarization. [score:1]
However, there was no significant difference between miR-326 mimic- and miR-NC -transfected platelets. [score:1]
To determine whether miR-326 modulates the levels of other Bcl-2 family members, the concentrations of Bcl-2 family members were examined in platelets over time and after transfection with miR-326 mimic or miR-NC. [score:1]
A significant increase in apoptosis activity was observed in platelets after miR-326 transfection. [score:1]
These results confirm the role of miR-326 in promoting apoptosis in platelets. [score:1]
Platelets activation by miR-326. [score:1]
As shown in Fig 2C, transfection of platelets with 50 nM miR-326 mimic decreased Bcl-xL mRNA levels (P<0.05, relative to miR-NC). [score:1]
Consistent with the mRNA results, 48 h after transfection, the levels of Bcl-xL protein but not of Bak were lower in the presence of miR-326 mimic than in the presence of miR-NC (Fig 2E– 2G). [score:1]
Putative miR-326 binding sites were identified at positions 791–797 (CCCAGAG) in the 3′-UTR of Bcl-xL and 961–967 (CCCAGAG) in the 3′-UTR of Bak (Fig 1A). [score:1]
0122784.g001 Fig 1(a) Putative miR-326 binding sequences in the 3′-UTR of the Bcl-xL and Bak genes and the mut sequences. [score:1]
These results suggest that platelets are not activated by miR-326. [score:1]
[1 to 20 of 57 sentences]
4
[+] score: 141
Other miRNAs from this paper: hsa-mir-330
Next, we used luciferase reporter assays to verify whether cyclin D1 expression are really regulated by miR-326/330-5p, and results demonstrate that miR-326/330-5p inhibits luciferase activity in CNE-1 cells and SUNE-1 cells at the reporter plasmid with a WT cyclin D1 3′-UTR, but no significant inhibition was observed at the reporter plasmid with a mutant cyclin D1 3′-UTR (Fig. 4C). [score:7]
Results revealed that both miR-326/330-5p and si-CCND1 treatment inhibited protein expression of cyclin D1, while EWSAT1 treatment significantly increased protein expression of cyclin D1 in CNE-1 and SUNE-1 cells (Fig. 4E-F), respectively. [score:7]
In miRDB, miRNAs with target score≥50 were selected, and in PITA, miRNAs with target score target score ΔΔG≤-10 kcal/mol were selected, then intersection was conducted in the selected miRNAs in miRDB and PITA, and miR-326 and miR-330-5p were got as the candidate miRNAs (Table S1– 2). [score:7]
EWSAT1 was revealed as a direct target of miR-326/330-5p clusters, and there was an interactive suppression between them. [score:6]
Moreover, up-regulated miR-326/330-5p in CNE-1 and SUNE-1 cells, which stably over-expressed EWSAT1, significantly reversed the favorable roles of EWSAT1 on cell growth in NPC cells (Fig. 4A-B). [score:6]
Results of demonstrated both miR-326/330-5p and si-CCND1 treatment decreased cell growth of CNE-1 and SUNE-1 cells in comparison to that of in their blank counterparts (Fig. 4D), However, when treated CNE-1 and SUNE-1 cells with EWSAT1 plus si-CCND1, the favorable role of EWSAT1 on cell growth was inhibited by cyclin D1 knockdown, and the negative effect of si-CCND1 was alleviated by EWSAT1 over -expression (Fig. 4D). [score:6]
Figure 4(A) Up-regulated EWSAT1 in miR-326/330-5p treated CNE-1 and SUNE-1 cells, significantly reversed the growth -inhibitory role of miR-326/330-5p in NPC cells. [score:6]
MiR-326 reverses chemoresistance in human lung adeno-carcinoma cells by targeting specificity protein 1 [53], and regulates cell proliferation and migration in lung cancer by targeting phox2a and is regulated by HOTAIR [54]. [score:6]
To explore the function of miR-326/330-5p on NPC, we screen Targetscan, miRanda, PicTar to select potential predicted targets of miR-326/330-5p. [score:5]
Using bio-informatics, we verified cyclin D1 as a direct target of miR-326/330-5p, and luciferase reporter assays confirmed that miR-326/330-5p targeted cyclin D1 mRNA at its 3′-UTR. [score:5]
Both miR-326 and miR-330-5p repressed cell growth in NPC cell lines, while over-expressed EWSAT1 in miR-326 or miR-330-5p treated cells, significantly reversed the growth -inhibitory role of miR-326/330-5p in CNE-1 and SUNE-1 cells (Fig. 4A-B). [score:5]
org, TargetScan, and PicTar for underlying targets of miR-326/330-5p that owned oncogenic characteristics, and found cyclin D1, a known oncogene, was an underlying target of miR-326/330-5p clusters. [score:5]
Moreover, our results also demonstrated miR-326/330-5p clusters exerted its tumor suppressive role on NPC through targeting cyclin D1. [score:5]
Our results reveal that miR-326/330-5p targets human cyclin D1 by directly binding to the predicted sites in 3′-UTR of cyclin D1 mRNA, and demonstrate that EWSAT1's oncogenic functions are partially through negative regulation of miR-326 /330-5p clusters, and then activation of cyclin D1. [score:5]
Having verified EWSAT1 was a target of miR-326/330-5p, the mechanism of miR-326/330-5p in EWSAT1 -induced inhibition on NPC cells was still unknown. [score:5]
These revealed that cyclin D1 could be a direct target of miR-326/330-5p in NPC. [score:4]
EWSAT1 is a direct target of miR-326/330-5p. [score:4]
Oligonucleotides containing the wild-type (WT) or mutant (MT) puptative miR-330-5p or miR-326 binding sites of the 3′-untranslated regions (3′-UTR) of the CCND1 mRNA were ligated into the pMIR-REPORT luciferase reporter plasmid vector (see in http://www. [score:3]
In addition, our study also revealed that miR-326/330-5p could reverse the favorable roles of EWSAT1 on cell growth in NPC cell lines, which demonstrated EWSAT1 played its favorable role on NPC progression, at least in part, through inhibiting miR-326/330-5p clusters. [score:3]
In our present study, miR-326/330-5p inhibited growth in NPC cell lines. [score:3]
MiR-326/330-5p can regulate numerous of target genes. [score:3]
Having shown the critical role of miR-326/330-5p on suppressing NPC progression, we searched for the potential gene effectors involved in its function. [score:3]
These results confirmed that miR-326/330-5p made sense in EWSAT1 -induced inhibitory roles on NPC cells. [score:3]
But among all of the predicted target genes for miR-326/330-5p clusters, we found that cyclin D1 acted as a crucial effector of miR-326/330-5p. [score:3]
In conclusion, our data reveal that high-expressed EWSAT1 is an oncogenic lncRNA that facilitates the oncogenisis and progression of NPC through miR-326/330-5p-cyclin D1 axis. [score:3]
Collectively, we identified EWSAT1 might be a crucial oncogenic regulator involved in NPC progression via functioning as a ceRNA for miR-326/330-5p clusters, and in return initiating cyclin D1 pathway. [score:2]
These results reveal that miR-326/330-5p directly bind to EWSAT1 at the recognitive sites. [score:2]
EWSAT1's oncogenic activity is in part through negative regulation of miR-326/330-5p, and then activation of cyclin D1 in NPC cells. [score:2]
Having verified EWSAT1 could reversely regulate miR-326/330-5p expression, we then investigate its functional roles. [score:2]
EWSAT1 functions as a ceRNA of miR-326/330-5p clusters in NPC. [score:1]
More-over, biotin-avidin pull-down system demonstrated EWSAT1 could pull down miR-326/330-5p. [score:1]
EWSAT1's oncogenic roles are partially via spongeing miR-326/330-5p, and then activating cyclin D1. [score:1]
Recent studies indicated miR-326/330-5p showed tumor suppressive role on lung cancer [43– 46], breast cancer [47], malignant melanoma [48], colorectal cancer [49], and glioblastoma [50, 51], while their role on NPC had not been investigated. [score:1]
EWSAT1's function as an oncogene to facilitate tumor progression was partially attributed to its ability to acting as a ceRNA for miR-326/330-5p clusters, and subsequent to activating of the cyclin D1 signaling pathway in NPC. [score:1]
In our study, we investigated the effect of EWSAT1 in NPC cell lines and discovered that EWSAT1 involved in the ceRNA regulatory network and functioned as endogenous miRNA sponges to bind to miR-326/330-5p and regulated its function. [score:1]
html), and then we made an assumption that EWSAT1 might function as a competing endogenous RNA (ceRNA) for miR-326/330-5p clusters. [score:1]
pcDNA3.1-CT-GFP-EWSAT1 (NR_026949), si-EWSAT1, miR-326 (MIMAT0000756), miR-330-5p (MIMAT0000751), or si-CCND1 (NM_053056), were purchased from GenePharma Co. [score:1]
The CNE-1 and SUNE-1 cells were seeded in 24-well culture plates at a density of 3 × 10 [5] cells per well, and the cells were then transfected with Vector, miR-326, miR-330-5p, pcDNA3.1-CT-GFP-EWSAT1, miR-326 plus pcDNA3.1-CT-GFP-EWSAT1, or miR-330-5p plus pcDNA3.1-CT-GFP-EWSAT1. [score:1]
Additionally, we next investigated the effect of EWSAT1 and miR-326/330-5p on the protein expression of cyclin D1. [score:1]
These data indicated that EWSAT1 facilitated cell growth through binding miR-326/330-5p on NPC cells. [score:1]
The cells were washed with 1× PBS (pH7.4) and then transiently transfected with 100 nM NC or pcDNA3.1-CT-GFP-EWSAT1, si-EWSAT1, miR-326, miR-330-5p, or si-CCND1, using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. [score:1]
We identified EWSAT1 harbors two conserved miR-326/330-5p clusters's cognate sites as the results of overlap for miRDB (http://mirdb. [score:1]
Results revealed that miR-326/330-5p were much richer in precipitate of EWSAT1 probe than that of in NC probe (Fig. 3C-D). [score:1]
Those effects could be partially attributed to EWSAT1 functioning as a ceRNA for miR-326/330-3p. [score:1]
[1 to 20 of 44 sentences]
5
[+] score: 40
Other studies supported the tumor suppressive activity of miRNA-326 through targeting of the Notch pathway in glioma and glioma stem cells [58], as well as its role as suppressor of the pathway activator Smoothened in the regulatory circuitry of the Hedgehog (Hh) signaling, suggesting that alterations of this specific miRNA might sustain cancer development [59]. [score:9]
In particular, since the colors in the heatmap showed the relative expression of the miRNA across all samples, we observed two types of expression profiles, one in which the expression was lower in the patients with a short-OS (for miR-211, miR-1207-3p, miR-326) and one in which the pattern was opposite (for miR-4321). [score:7]
Although the impact of ABC transporter family on pharmacokinetics and pharmacodynamics for gemcitabine still remains to be defined, a recent study showed that MRP-1/ABCC1 expression correlated with PDAC tumorigenesis and gemcitabine resistance [57], potentially explaining why our long-survivors patients had a significantly higher expression of its negative regulator miR-326 compared to the patients with short-OS. [score:5]
Conversely, patients with long-OS had higher expression values for miR-211, miR-1207-3p, miR-326, and lower expression values for miR-4321. [score:5]
With the exception of the patient S2, two groups of miRNAs can be observed, one group in which the expression is lower in the patients with short-OS (miR-211, miR-1207-3p, miR-326, miR-197, let-7b*, miR-1296, miR-4290) and one group that has an opposite expression profile (miR-4321, miR-3610, miR-1914*). [score:5]
Therefore, regulation of miR-326 might represent an innovative appealing target to deplete tumor -associated stromal tissue acting on the paracrine signalling axis from neoplastic to stromal cells. [score:4]
Furthermore, elevated levels of miR-326 in the mimics -transfected MCF VP-16-resistant cells reduced MRP-1 expression and sensitized these cells to VP-16 and doxorubicin [56]. [score:3]
Highly stringent statistics identified the top 4 discriminating miRNAs (miR-211, miR-1207-3p, miR-326 and miR-4321) between patients with short vs. [score:1]
However, to our knowledge, this is the first study unraveling the possible prognostic role of miR-211, miR-1207-3p, miR-326 and miR-4321 in PDAC. [score:1]
[1 to 20 of 9 sentences]
6
[+] score: 24
It is interesting that the Tax D1 mutant increased the efficiency of processing of Drosha 100%, however, only increased the relative miR326 expression 1.5 fold. [score:3]
This data indicates that the Tax D1 mutant and the TaxD55 mutant increase miR326 expression 1.5 and 4 fold, respectively, above basal levels. [score:3]
Interestingly, the Tax mutants spanning from residue 99 to 353 have no functional implications for miR326 expression. [score:3]
The expression of miR326 was determined by the quantiMiR PCR kit and is shown as a fold change in Figure 4A normalized to U6 and relative to mock transfected control. [score:3]
In order to compare the increase in expression of miR326 to the overall transcript levels in the cell, therefore ruling out non-specificity, we detected primary transcripts encoding miR326 against a region upstream of the miRNA hairpin. [score:3]
These two values are not necessarily proportional as the extrapolation of an active, functional Drosha in the presence of this mutant, does not necessarily have to result in a direct effect on miR326. [score:2]
A) Forty-eight hours post transfection, total RNA was isolated by TRIzol extraction and expression of miR326 was determined by quantiMiR PCR kit using primers specific to miR326. [score:2]
Expression of miR326 was determined by the quantiMiR PCR kit (SBI, Mountainview, CA) using the miR326 detection (sense) primer: CCTCTGGGCCCTTCCTCCAG. [score:2]
Primary transcripts encoding miR326 were detected by RT-qPCR (CACCAACATCCTAGCCCAAACG, AAGTGAGAACCGGGAAGCAAG). [score:1]
We utilized a system where we quantify levels of cellular miR326 in Tax transfected cells normalized to a U6 control. [score:1]
B) Primary transcripts encoding miR326 were detected by RT-qPCR against a region upstream of the miRNA hairpin. [score:1]
[1 to 20 of 11 sentences]
7
[+] score: 19
Downregulation of several miRNAs became apparent on day 7; miR-155, miR-326, miR-329 and miR-491 exhibited clearly (≤0.67-fold changes) and significantly decreased expression (P<0.05) compared with mock controls (Figure 1c and Supplementary Figures 1c and d). [score:5]
We concentrated on miR-155, miR-326, miR-329 and miR-491-5p showing stable downregulation after prolonged incubation. [score:4]
After transfection with miR-326 mimic, we recorded a trend in PRINS downregulation. [score:4]
The collection included three well-known miRNAs (miR-16, miR-21 and miR-155) that have been commonly related to apoptotic signalling and cancer, [28–30] as well as three underexplored miRNAs (miR-326, miR-329 and miR-491) with accumulated targets in cancer and apoptotic pathways (Supplementary Table 3). [score:3]
Nevertheless, regulation of PRINS by miR-326 may be anticipated. [score:2]
[31] As shown in Figure 1e, three miR-491-5p binding sites together with two miR-329 sites and one miR-326 site were predicted (Supplementary Figure 2). [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 18
It has been reported that miR-326 and miR-133a reduce adriamycin resistance of human hepatoma HepG2 cells through downregulating ABCC1 expression [18]; miR-1291 could modulate cellular drug disposition through direct targeting ABCC1 in PANC-1 cells [19]. [score:9]
miR-133a and miR-326 have also been reported to induce drug accumulation by suppressing MRP1 expression in HepG2 cells [18]. [score:5]
We analyzed breast cancer dataset from TCGA and found that the levels of miR-326, miR-133a and miR-1291 were all very low, previously reported miRNAs targeting MRP1 in other cancers [18, 19] and their expression levels showed no markedly significant difference in tumors compared to their normal adjacent tissues in breast cancer (Supplementary Figure S1). [score:4]
[1 to 20 of 3 sentences]
9
[+] score: 18
In addition, both miRNA-324-5p targeting gli1 and miRNA-326 regulating the expression of Smo and Gli1 by cooperating with miRNA-324-5p 33 were highly expressed in LX2, but not in CP-MSC (Fig. 5A). [score:8]
It was previously reported that miRNA-125b, miRNA-324-5p and miRNA-326 targeted Hh target genes in human medulloblastoma cell lines 33. [score:5]
The expression of both miRNA-324-5p and miRNA-326 inhibiting gli1 was lower in CP-MSCs than in healthy human liver or LX2 (Fig. 5A). [score:5]
[1 to 20 of 3 sentences]
10
[+] score: 17
Additionally, miR-326 displayed a high NBC Score (0.99) and is highly expressed in whole blood and plasma (miRmine database; Panwar et al., 2017, accessed July 2017), in agreement with the possible effect of this miRNA on IKZF3 expression levels, which is also expressed in these tissues. [score:7]
We hypothesize that knockdown of miR-326 in blood cells would counteract the deregulation of IKZF3. [score:3]
This miRSNP is predicted to create a binding site for miR-326 with a high NBC Score (NBC Score = 0.99), which fits the negative correlation observed between expression of miR-326 and the IKZF3 mRNA. [score:3]
In the sample of individuals homozygous for the minor allele (T) of miRSNP rs907091 located in the 3′ UTR of IKZF3, expression of miR-326, and IKZF3 were negatively correlated (P = 0.006479, r [2] = −0.35) (Figure 4). [score:3]
By integrating genotype and RNA-seq (mRNA and microRNA) data, we found miR-326 levels negatively correlated with IKZF3 mRNA levels, in homozygous (T/T) individuals. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 16
Eighteen miRNAs, including miR-34b, miR-326, miR-432, miR-548c-3p, miR-570, and miR-603, were drastically and constantly downregulated in GH adenomas, whereas only miR-320 was significantly upregulated. [score:7]
miR-34b and miR-548c-3p were demonstrated to regulate both HMGA1 and HMGA2 expression, whereas miR-326, miR-432, and miR-570 target HMGA2 only. [score:6]
miR-326 and miR-603 could decrease the expression of the E2 transcription factor 1, E2F1. [score:3]
[1 to 20 of 3 sentences]
12
[+] score: 15
HOTAIR, one target of miR-326, has been confirmed to down-regulatemiR-326; then, it exerts its tumor-suppressive activities by reducing the expression of FGF1 (Ke et al., 2015). [score:10]
Knockdown of long non-coding RNA HOTAIR inhibits malignant biological behaviors of human glioma cells via modulation of miR-326. [score:4]
In this regard, recent studies have demonstrated that lncRNAs in gliomas can serve as molecular decoys, which move proteins or RNAs away from a specific location, like a “sponge” to miRNAs (e. g., HOTAIR/miR-326, CASC2/miR-21, XIST/miR-152, and Gas5/miR-222). [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 13
Further studies showed that overexpression of miR-34b and miR-548c-3p can reduce the expression level of HMGA1 and HMGA2 proteins, and overexpression of miR-23b, miR-326, miR-432, and miR-570 could decrease the expression of HMGA2 as well [23]. [score:9]
MiR-23b [26], miR-326, miR-432, and miR-570 are predicted to target HMGA2, whereas miR-34b and miR-548c-3p can bind to HMGA1 and HMGA2 directly. [score:4]
[1 to 20 of 2 sentences]
14
[+] score: 13
Furthermore, Ets-1, a negative regulator of Th17 differentiation, has been recently reported as a target of miR-326, the amount of which seems to be associated with disease relapse in multiple sclerosis patients [12]. [score:6]
Ets1 was previously suggested to regulate Th17 cell differentiation as a direct target of miR-326 [12]. [score:5]
In this context, miRNAs have been shown to be involved in the development or function of all four main T helper subsets [9], [10], i. e. miR-155 in Th1, miR-126 in Th2, miR-155 in Treg and miR-326 in Th17. [score:2]
[1 to 20 of 3 sentences]
15
[+] score: 12
Downregulation of, miR-193b, miR-324-5p, miR-326, and miR-338-3p in human cancers de-repress Smoothened and promotes tumor proliferation and invasion through aberrant Hedgehog signaling activation. [score:4]
Smoothened is a direct target of (Ferretti et al., 2008), miR-193b (González-Gugel et al., 2013), miR-324-5p (Ferretti et al., 2008), miR-326 (Ferretti et al., 2008), and miR-338-3p (Huang et al., 2011b). [score:4]
Smoothened is a direct target of, miR-193b, miR-324-5p, miR-326, and miR-338-3p. [score:4]
[1 to 20 of 3 sentences]
16
[+] score: 12
Other miRNAs from this paper: hsa-mir-23a
Recently, miR-326 has been reported to inhibit GBM by directly targeting PKM2 [30]. [score:6]
Kefas B. Comeau L. Erdle N. Montgomery E. Amos S. Purow B. Pyruvate kinase M2 is a target of the tumor-suppressive microRNA-326 and regulates the survival of glioma cells Neuro. [score:6]
[1 to 20 of 2 sentences]
17
[+] score: 11
The target of miR-326 is the ETS1 gene encoding a transcription factor that directly controls the expression of cytokine and chemokine genes and is involved in the regulation of differentiation and proliferation of lymphoid cells. [score:7]
The subset of Th17 cells is regulated by miR-326 that binds to the target Ets1 gene and enhances differentiation of these cells and production of IL-17 [31]. [score:4]
[1 to 20 of 2 sentences]
18
[+] score: 11
Other miRNAs from this paper: hsa-mir-136, hsa-mir-146a
Meanwhile, in non-solid neoplasms such as chronic myeloid leukemia (CML), the overexpression of SMO has been associated with a loss of expression of miR-136 in marrow-derived CD34+ cells, while overexpression of miR-326 decreases the expression of SMO, diminishing cell proliferation and increasing the apoptotic activity of CD34+ CML cells. [score:9]
In this case, restoring SMO activity would be able to reverse the effect of miR-326, which has been considered as a therapeutic target in non-solid neoplasms [112]. [score:2]
[1 to 20 of 2 sentences]
19
[+] score: 10
Accordingly, the analysis of a miRNA expression profile of GH adenomas versus normal pituitary has unveiled a set of miRNAs constantly deregulated in somatotroph tumors, comprising miR-326, miR-432, and miR-570, targeting HMGA2, miR-34b, and miR-548c-3p both having HMGA1 and HMGA2 as targets, and miR-326 and miR-603 targeting E2F1. [score:10]
[1 to 20 of 1 sentences]
20
[+] score: 10
Highly expressed EWSAT1 in human nasopharyngeal carcinoma tissues and cell lines increases the expression of miR-326/330-5p clusters that target the gene cyclin D1, ultimately regulating NPC development and progression [41]. [score:9]
Furthermore, it has been shown that lncRNA EWSAT1 (Ewing sarcoma associated transcript 1) acts as a reservoir of miR-326/330-5p [41]. [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 10
Other miRNAs from this paper: hsa-mir-134, hsa-mir-206, hsa-mir-329-1, hsa-mir-329-2
Ectopic expression of miR-326, miR-134, miR-329, and miR-206 in NSCLC cell lines significantly suppressed cell proliferation through inhibition of cyclin D1 and up-regulation p21 [37– 40]. [score:10]
[1 to 20 of 1 sentences]
22
[+] score: 9
MiRNA target site/Species Human Mouse Cow Dog Chicken FrogTargeting Twist2 miR-15b-3p + − + + − − − miR-33-5p + + + + − + − miR-137-3p + + + + − + − miR-145a-5p + + + + − − + miR-151-5p + + + + − + − miR-214-5p + + + + − − − miR-326-3p + + + + − − − miR-337-3p + + + + − + − miR-361-5p + + + + − − − miR-378a-5p + + + + − − − miR-381-3p + + + + − + − miR-409-3p + + + + − − − miR-450b-5p + + + + − + − miR-508-3p + + + + − − − miR-543-3p + + + + − − − miR-576-5p + + + + − − − miR-580 + + + + − − − miR-591 + + + + − − − MicroRNAs underlined were tested in this study. [score:5]
The following miRNAs were tested for their potential to repress Twist1 translation in the human lung carcinoma cell line H1299: miR-33, miR-145a, miR-151, miR-326, miR-337, miR-361, miR-378a, miR-381, miR-409 and miR-543 (Fig. 1). [score:3]
The miRBase accession numbers for miRNAs are: mmu-miR-33 (MI0000707), mmu-miR-145a (MI0000169), mmu-miR-151 (MI0000173), mmu-miR-326 (MI0000598), mmu-miR-337 (MI0000615), mmu-miR-361 (MI0000761), mmu-miR-378a (MI0000795), mmu-miR-381 (MI0000798), mmu-miR-409 (MI0001160) and mmu-miR-543 (MI0003519). [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 9
For instance, HOTAIR, a well-known lncRNA could inhibit the expression of FGF1 by regulating miR-326 in human glioma [39], and also functioned as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in promoting gastric cancer [40]. [score:9]
[1 to 20 of 1 sentences]
24
[+] score: 9
The constructed networks from significantly up-regulated miRNAs and significantly down-regulated target genes involved 13 miRNAs from JIA (Fig. 4a) and 29 miRNAs from CF (Fig. 4b), 4 (miR-494, miR-370, miR-326, and miR-505) of them were common (p = 1.2E-03, Table S4 in Supplementary information). [score:9]
[1 to 20 of 1 sentences]
25
[+] score: 8
LncRNA SNHG1 has been found to regulate NOB1 expression by sponging miR-326 and promotes tumorigenesis in osteosarcoma [25]. [score:4]
Wang J. Cao L. Wu J. Wang Q. Long non-coding RNA SNHG1 regulates NOB1 expression by sponging miR-326 and promotes tumorigenesis in osteosarcomaInt. [score:4]
[1 to 20 of 2 sentences]
26
[+] score: 8
There is evidence for expression of miR-326 and IZKF3 in human B-lymphocytes. [score:3]
These data suggest that carriers of the T allele may have reduced levels of IZKF3, in part through miR-326. [score:1]
MRESS SNPs FST Gene miR CNM SNPs FST Gene miR rs3822506 0.8743 TCERG1 miR-590 rs7665492 0.8942 ENAM miR-3916 rs1217382 0.8469 BCL2L15 miR-17 rs1043809 0.8900 EPN2 miR-3616-3p rs3087542 0.8428 EMCN miR-197 rs2470102 0.8859 MYEF2 miR-1180 rs3742988 0.8385 CDAN1 miR-378 rs7290134 0.8695 TNFRSF13C miR-1205 rs1071738 0.8298 PALLD miR-182 rs8057598 0.8596 NOL3 miR-769-3p rs1969589 0.8545 RGMA miR-593* rs1246014 0.8476 COPS7B miR-1273d rs12449157 0.8399 GFOD2 miR-125a-3p rs16990309 0.8398 SLC23A2 miR-760 rs3742988 0.8385 CDAN1 miR-326 rs2292549 0.8361 GPBAR1 miR-936 rs1995939 0.8338 STARD9 miR-3943 rs3199486 0.8321 STARD9 miR-2278 rs873258 0.8312 TSPAN14 miR-873MRESS and CNM SNPs showing highest levels of population sub-division among HapMap phase 3 data- All SNPs falling 2 SDs from the mean F [ST ]of 3'UTR SNPs. [score:1]
Lower IKZF3 levels were observed in carriers of the G allele which is predicted to create a miR-326 MRESS. [score:1]
Interestingly, miR-326 is important for T-cell differentiation and has been implicated in the pathogenesis of autoimmune multiple sclerosis [41]. [score:1]
The rs907091 minor T allele is predicted to create a CNM for mir-326. [score:1]
[1 to 20 of 6 sentences]
27
[+] score: 7
Interestingly, preclinical support of translational effects was indicated by the demonstration of pulmonary fibrosis that is induced as a result of miR-26a inhibition (Liang et al., 2014); and that pulmonary fibrosis could be effectively attenuated following the intranasal deliver of miR-326 mimics (Das et al., 2014). [score:5]
And lastly, investigation into the role of miRNAs in pulmonary fibrosis is emerging with potential targetable miRNAs identified including miR-29 (Cushing et al., 2015), miR-155 (Pottier et al., 2009), miR-21 (Zhou et al., 2015b; Liu et al., 2016), miR-26a (Liang et al., 2014), and miR-326 (Das et al., 2014). [score:1]
MicroRNA-326 regulates profibrotic functions of transforming growth factor-beta in pulmonary fibrosis. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 7
Seven of the miRNAs that were differentially expressed in both studies, have previously been reported to play a role in tissue development, obesity, T2D and metabolic disturbances (hsa-miR-34a [23], [32], hsa-miR-28-5p [32], hsa-miR-27b [13], [15], hsa-miR-326 [21], hsa-miR-204 [22], [23], hsa-miR-195 [32], hsa-miR-519d [29]). [score:4]
Of these, nine miRNAs (hsa-miR-326 [21], hsa-miR-211 [22], [23], hsa-miR-10b [32], hsa-miR-365 [32], hsa-miR-10a [32], hsa-miR-503 [32], hsa-miR-335* [30], hsa-miR-331-3p [30] and has-miR-199a-5p [30]) were expressed at higher levels in abdominal, rather than gluteal, adipose tissue (Table S1). [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 7
While miR-146a and miR-326 were up-regulated at an early time point (6 hours pi), these were down-regulated as the infection progressed. [score:7]
[1 to 20 of 1 sentences]
30
[+] score: 7
EWSAT1 upregulated the expression of Cyclin D1 by acting as a competitive “sponge” for miR-326/330-p5 clusters. [score:6]
Thus, by sponging miR-326/330-p5, Cyclin D was detected at higher levels [176]. [score:1]
[1 to 20 of 2 sentences]
31
[+] score: 6
Wang S. Lu S. Geng S. Ma S. Liang Z. Jiao B. Expression and clinical significance of microRNA-326 in human glioma miR-326 expression in glioma Med. [score:5]
Kefas B. Comeau L. Floyd D. H. Seleverstov O. Godlewski J. Schmittgen T. Jiang J. DiPierro C. G. Li Y. Chiocca E. A. The neuronal microRNA miR-326 acts in a feedback loop with notch and has therapeutic potential against brain tumors J. Neurosci. [score:1]
[1 to 20 of 2 sentences]
32
[+] score: 6
miR-326 was shown to reduce growth, invasion, and tumorigenicity of GBM stem cells by targeting Notch-1, Notch-2, and pyruvate kinase muscle enzyme (PKM2) [73]. [score:3]
In their study, miR-125b, miR-324-5p, and miR-326 were demonstrated as the suppressors of sonic hedgehog signaling (Shh) pathway and MB cells showed increased proliferation when these microRNAs were diminished. [score:3]
[1 to 20 of 2 sentences]
33
[+] score: 5
In this previous research, we showed that miR-324-5p and miR-326 targeting gli1 mRNA were highly expressed in activated LX2 cells. [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
Many semaphorins and their receptors are predicted targets of brain-expressed miRNAs (e. g., let-7c, miR-125b, miR-153, miR-103, miR-323, miR-326, and miR-337). [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 5
Studies have showed that miRNAs such as miR-27a [3], miR-106a [4], miR-133a [5], miR-145 [6], miR-181b [7], miR-218 [8], and miR-326 [5] may be involved in the development of drug resistance by regulating relative gene expression. [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 5
Comparison analysis of plasma exosomal miRNA showed upregulation of miR-326 in diabetic patients compared to controls and this increase negatively correlated with its target, adiponectin (100). [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 4
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Among the upregulated miRNAs were miR-124a, miR-155, miR-328, miR-326, miR-302c, miR-345, miR-373*, and miR-210 [54]. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 4
Conversely, 15 miRNAs resulted downregulated in activated B cells: mir-483, mir-95, mir-326, mir-135a, mir-184, mir-185, mir-516-3p, mir-30b, mir-203, mir-216, mir-150, mir-182*, mir-141 and mir-211 (Table 3). [score:4]
[1 to 20 of 1 sentences]
39
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Five depressing-adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326) target 217 lncRNAs. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 4
MiR-451, miR-27, miR-326 and miR-331-5p have been shown to regulate the expression of the MDR1 gene [85– 88]. [score:4]
[1 to 20 of 1 sentences]
41
[+] score: 4
All seven microRNA tested could significantly discriminate between ACR and NR, with AUC of 0.78, 0,75, 0.73, 0.72, 0.71, 0.70 and 0.69 for miR-142-3p, miR-101-3p, miR-424-5p, miR-27a-3p, miR-339-3p, miR-144-3p, and miR-326, respectively (Fig 2). [score:1]
Patients with and without acute cellular rejection could be discriminated by miR-142-3p (AUC = 0.78, CI [95%] = 0.67 to 0.89), miR-101-3p (AUC = 0.75, CI [95%] = 0.62 to 0.87), miR-424-5p (AUC = 0.73, CI [95%] = 0.60 to 0.86), miR-27a-3p (AUC = 0.72, CI [95%] = 0.59 to 0.85), miR-339-3p (AUC = 0.71, CI [95%] = 0.57 to 0.84), miR-144-3p (AUC = 0.70, CI [95%] = 0.56 to 0.83) and miR-326 (AUC = 0.69, CI [95%] = 0.56 to 0.82). [score:1]
The present study validates that seven microRNAs, miR-142-3p, miR-339-3p, miR-326, miR-144-3p, miR-101-3p, miR-27a-3p and miR-424-5p are present in serum samples from heart transplant patients and adequately distinguish ACR from NR. [score:1]
0170842.g002 Fig 2 Patients with and without acute cellular rejection could be discriminated by miR-142-3p (AUC = 0.78, CI [95%] = 0.67 to 0.89), miR-101-3p (AUC = 0.75, CI [95%] = 0.62 to 0.87), miR-424-5p (AUC = 0.73, CI [95%] = 0.60 to 0.86), miR-27a-3p (AUC = 0.72, CI [95%] = 0.59 to 0.85), miR-339-3p (AUC = 0.71, CI [95%] = 0.57 to 0.84), miR-144-3p (AUC = 0.70, CI [95%] = 0.56 to 0.83) and miR-326 (AUC = 0.69, CI [95%] = 0.56 to 0.82). [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 4
Consistent with this, recent reports have demonstrated that various miRNAs, namely miR-101, miR-150, miR-155, miR181a, miR-29a, miR-146a and miR-326, are expressed in particular T cell subsets and regulate several aspects of their differentiation and function [162– 164]. [score:4]
[1 to 20 of 1 sentences]
43
[+] score: 3
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-206
The microRNA miR-326, miR-34a, miR-206 have been shown to target, Notch-2 and to decrease the Notch activity in brain tumors [56]– [57]. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
Lerman et al. observed the expression of the following miRNAs in psoriatic lesion skin: hsa-miR-149, hsa-miR-150, hsa-miR-210, hsa-miR-220, hsa-miR-326, has-miR-324-5p, hsa-miR-342, hsa-miR-326, hsa-miR-328, hsa-miR-345, hsa-miR-346, and hsamiR-197 [20]. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
In summary, the ceRNA network suggested that novel_circRNA_007362 and novel_circRNA_032232 might interact with 24 miRNAs (Fig. 6A) as well as tch-let-7a-3p, tch-miR-136-5p, tch-miR-146a-5p, tch-miR-17-5p, tch-miR-183-5p, tch-miR-188-5p, tch-miR-23b-3p, tch-miR-326, and tch-miR-93-5p (Fig. 6B) to regulate development and aging of the cerebellum and hippocampus. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
Other microRNAs regulating or regulated by TGFB1 were found to be changed in IPF lungs include miR-30, miR-199, miR-29, miR-26, miR-155, miR-326, and others (105). [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
Moreover, high expression of miR-27b, miR-148a, and miR-326 was associated with decreased progression-free survival of CRC patients [68]. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
circRNA_007585 unknown circRNA_007585-miR-326- UCP2 Hirschsprung's disease Circ-ZNF609 ↓ ZNF609- miR-150-5p - AKT3-proliferation, migrationPeng, L. [48]. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Recent studies have shown that many miRs play suppressive or oncogenic roles in gastric cancer including miR-126 [9], miR-145 [10], miR-326 [4], miR-506 [11], and miR-29 [12]. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 2
The neuronal microRNA miR-326 acts in a feedback loop with notch and has therapeutic potential against brain tumors. [score:1]
In addition to miR-128, miR-124, miR-137 (Silber et al., 2008), miR-34a (Li et al., 2009; Guessous et al., 2010), and miR-326 (Kefas et al., 2009) reportedly play roles in the maintenance of CSC properties. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 2
It has also been shown that miR-326 plays an exclusive role in Th17 differentiation [9], whereas, miR-31 appears to regulate T-cell activation [10]. [score:2]
[1 to 20 of 1 sentences]
52
[+] score: 2
Based on experiments that tested the effect of increasing the complementarity between miR-326 and HIV-1 mRNA, the authors contended that the potency of miR-326 -mediated repression of HIV-1 replication qualifies for a functionally relevant miRNA–vRNA interaction. [score:1]
This led to the narrowing down of the list to five miRNAs: miR-133b, miR-138-5p, miR-326, miR-149-5p, and miR-92a-3p, which all reduced HIV-1 replication by over 40%. [score:1]
[1 to 20 of 2 sentences]
53
[+] score: 2
To assess endothelial specificity, transcript profiles were compared across 10 mRNAs, and 10 miRNAs, pre-selected due to strong expression in either endothelial cells (miR-222, [23] miR-221, miR-126, miR-100, miR-21, PECAM1, VWF, ENG, VE-Cadherin [24] and VE-Statin) or recognition as non endothelial cell markers (miR-134 [25], miR-124-1, miR-128-1, miR-326 miR-17, Neurog2, TAGLN, SOX10, CDX2 and CUBN). [score:2]
[1 to 20 of 1 sentences]
54
[+] score: 2
Then, the regulatory feedback loops have been clarified the molecular networks one after another, such as ZEB/miR-200, Notch/miR-326, E2F1/miRNA-223, NF-κB/miR-200b, c-Myb/miR-15a and p53/ miR-200 [12– 17]. [score:2]
[1 to 20 of 1 sentences]
55
[+] score: 2
Th17 cell differentiation has also been shown to be regulated by the miR-106-363 cluster (87) and in an experimental autoimmune encephalomyelitis mo del, Th17 cell -mediated inflammation was shown to be induced by both miR-326 and miR-21 (88, 89). [score:2]
[1 to 20 of 1 sentences]
56
[+] score: 2
We and others have described several miRNAs that are involved in MB development, including miR-125b, miR-324-5p, miR-326 and miR-199b-5p [6], [7], [8]. [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 2
Changsheng Du et al. reported that miR-326 regulates Th-17 differentiation and associated with the pathogenesis of multiple sclerosis[27]. [score:2]
[1 to 20 of 1 sentences]
58
[+] score: 2
For instance, the regulatory feedback loops such as Notch/miR-326 [32], E2F1/miRNA-223 [33], NF-κB/miR-200b [34], ZEB/miR-200 [22], p53/miR-200 [35] and C/EBPα-miR-34a-E2F3 [36] have been illuminated their molecular networks one after another. [score:2]
[1 to 20 of 1 sentences]
59
[+] score: 1
Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-155, hsa-mir-26a-2, hsa-mir-18b, hsa-mir-599
We were able to identify 6 mature miRNA species, miR-326, miR-155, miR-3676, miR-18b, miR-599 and miR-26a-5p deriving from known human stem-loop sequences (miRBase 12.0). [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
Patients' overall survival (OS) and progression-free survival (PFS) associated with interested miRNAs and miRNA-interactions as performed by Kaplan-Meier survival analysis of over 400 GBM patients indicated that that low levels of miR-155 and miR-210 were significantly associated with long OS of GBM patients, and also showed that high miR-326/miR-130a and low miR-155/miR-210 were related with extended PFS [37]. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
hsa-let-7a hsa-miR-296 hsa-miR-125b hsa-miR-183 hsa-miR-19b hsa-miR-30b hsa-miR-30c hsa-miR-30a-5p hsa-miR-30d hsa-miR-27a hsa-miR-103 hsa-miR-107 hsa-miR-92 hsa-miR-10a hsa-miR-326 Table 3 shows an overview of predictions on 39,215 3'UTR sequences in human genome and on 15 other genomes. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Other miRNAs from this paper: hsa-mir-675, hsa-mir-4269
Using this approach, we found four putative extended EST sequences that show high similarity to seven additional small RNAs: hsa-mir-1259, hsa-mir-326, hsa-mir-4269, hsa-mir-675, SNORD12, SNORD12B and SNORD12C. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
Other miRNAs, including miR-328 (20), miR-326 (21), and miR-34a (22), have also been shown to modulate chemosensitivity. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
48), miR-326 and let-7a/f (ref. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Interestingly, systemic administration of a lentiviral sponge for miR-326 was shown to reduce the number of IL-17 secreting Th-17 cells and ameliorate experimental autoimmune encephalomyelitis (EAE) in mice [47]. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
For those miRNAs that did not show significant alterations in cells following C. parvum infection as revealed by the microarray analysis, we selected miR-326 for bead -based multiplexed analysis and no change was detected in C. parvum infected cells (Figure 2D), further confirming the accuracy of the array data. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
Human miR-326 is physiologically functional in moderating HIV-1 replication in human cells [14]. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
Of these 7 miRNAs, 2 (hsa-mir-139, hsa-mir-326) were negatively correlated with survival, while the other 5 (miR-101-2, miR-182, miR-183, miR-190, hsa-miR-944) were protective. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Finally, several human endoglin mRNA algorithm computed interacting miRNAs that might be interesting to investigate include miR-26a/b-5p, miR-93-5p, miR-150-5p, miR-326, miR-370 given that these miRNAs have been shown to have tumor suppressor/promoter and cardiovascular roles (Chen et al., 2014[30]; Fang et al., 2011[50]; Icli et al., 2014[74]; Ito et al., 2014[77]; Kim et al., 2014[84]; Lo et al., 2012[100]; Lyu et al., 2014[104]; Zeitels et al., 2014[178]). [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
In this condition, the TEs were inserted in the proximity of appropriate sequences that are similar to the complementary sequences of the TE head or tail to form the hairpin structure of pre-miRNAs, such as hsa-mir-326, hsa-mir-421 and hsa-mir-619 (S2 Table). [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
Four miRNAs (miR-138-5p, miR-149-5p, miR-326, and miR-382-5p) show non-significant changes. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Sharbati-Tehrani et al., [67] have reported 4 new miRNAs (miR-326, miR-423-3p, miR-484 and miR-451,) that could not be identified in our study, which could be attributed to the use of very specialized tissues (Jejunium, spleen, ileum and kidney) for their study. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
These include miR-10, miR-101, miR-106a, miR-126, miR-142-3p, miR-146, miR-150, miR-155, miR-17-92 cluster (seven members: miR-17-5p, -17-3p, -18a, -19a, -20a, -19b and -92a), miR-181a, miR-196b, miR-21, miR-221, miR-223, miR-326, miR-34,miR-424, miR-9, miR-98, the let-7 family (nine members: let-7, mir-48, -84, -241, -265, -793, -794, -795 and -1821), and so on [47, 48, 49]. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
Several recent reports have highlighted the post-transcriptional repression of HMGA proteins by non-coding RNAs and, in particular, numerous miRNAs with this activity have been identified (let-7a, miR-15, miR-16, miR-26a, miR-34b, miR-196a2, miR-326, miR-432, miR-548c-3p, miR-570, miR-603) (53, 54). [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-485, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, hsa-mir-300, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
Type of site Context+ Context Structure Energy Is experimental validated rno-miR-326-5p MIMAT0017028 3 8mer 7mer-m8 imperfect −0.442 −0.242 431 −65.97 TRUE rno-miR-485-5p MIMAT0003203 2 7mer-m8 −0.343 −0.372 290 −34.96 TRUE rno-miR-300-5p MIMAT0004743 1 8mer −0.338 −0.421 156 −15.16 TRUE rno-miR-702-5p MIMAT0017884 1 8mer −0.317 −0.274 142 −13.86 TRUE rno-miR-203b-3p MIMAT0017800 2 7mer-m8 −0.298 −0.421 295 −29.93 TRUE rno-miR-33-3p MIMAT0017104 2 8mer 7mer-m8 −0.297 −0.813 305 −22.7 TRUE rno-miR-466b-3p MIMAT0017285 1 8mer −0.295 −0.47 159 −15.26 TRUE rno-miR-532-5p MIMAT0005322 1 7mer-m8 −0.268 −0.302 151 −10.71 TRUE rno-miR-511-5p MIMAT0012829 1 7mer-m8 −0.268 −0.302 152 −10.37 TRUE rno-miR-343 MIMAT0000591 1 7mer-m8 −0.262 −0.24 140 −13.75 TRUE rno-miR-203a-3p MIMAT0000876 1 8mer −0.245 −0. [score:1]
[1 to 20 of 1 sentences]