sort by

31 publications mentioning hsa-mir-383

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-383. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 336
Forced expression of miR-383 decreased the expression of Gadd45g through binding to the 3′ untranslated region (3′-UTR), whereas inhibition of miR-383 increased Gadd45g expression. [score:11]
We found that ectopic expression of miR-383 in R1 ES cells also results in the down-regulation of Gadd45g both at the mRNA and protein levels, while anti-miR-383 up-regulates Gadd45g (Fig. 4A and B), suggesting a consistent role of miR-383 in regulation Gadd45g. [score:10]
In RA -induced ES cells, when Gadd45g was knocked down, the increase of Isl1 expression and the decrease of Dppa4 and Gdf3 expression in response to ES cell differentiation were inhibited, which was comparable to the effect of miR-383 overexpression (Fig. 5D). [score:10]
Since Nanog, Sox2 and Nestin are not potential targets predicted by the computer-aided algorithms (TargetScan, miRBase and Picta), miR-383 may indirectly regulate these genes through targets other than Gadd45g. [score:9]
Both miR-383 overexpression (Fig. 5E) and Gadd45g depletion (Fig. 5F) down-regulated Isl1 protein levels and up-regulated Gdf3 and Dppa4 protein levels. [score:9]
We further observed that, in RA -induced differentiating ES cells, an overexpression of miR-383 or depletion of Gadd45g suppressed the expression of Isl1 and increased the expression of Dppa4 and Gdf3. [score:9]
We demonstrate for the first time that miR-383 can specifically regulates the expression of Gadd45g by directly targeting to the 3-UTR region of Gadd45g mRNA, a regulatory process conserved in human tumor cells and mouse embryonic stem cells. [score:8]
However, the RA -induced up-regulation of Gadd45g was inhibited by miR-383 in miR-383 overexpressed R1 cells (Fig. 5A). [score:8]
Moreover, following RA treatment, up-regulation of Nestin and Isl1, and down-regulation of Sox2, Nanog, Dppa4 and Gdf3 were blocked by overexpression of miR-383 compared with those in control cells (Fig. 5A and B). [score:8]
Moreover, miR-383 is suggested to function as a negative regulator of embryonic stem cell differentiation via down-regulation of Gadd45g expression. [score:7]
miR-383 down-regulates Gadd45g by directly targeting the 3′-UTR of Gadd45g. [score:7]
Consistent with these data, in our experiments, miR-383 is down-regulated during RA -induced ES cell differentiation or ES spontaneous differentiation, coupled with an up-regulation of Gadd45g. [score:7]
Fig. 3C shows that Gadd45g expression plasmid rescues the down-regulation of Gadd45g induced by miR-383 (Fig. 3C, upper panel). [score:6]
miR-383 represses Gadd45g expression by directly targeting Gadd45g 3′-UTR. [score:6]
A previous report has shown that in testicular embryonic carcinoma cells miR-383 induces a decreased proliferation rate by targeting interferon regulatory factor-1 (IRF1) [46], implying that miR-383 exerts effects through various targets. [score:6]
The mouse ES cell line R1 was treated with with Rotinoid Acid (RA) for differentiation, and we found that miR-383 expression was down-regulated in during ES cell differentiation (Fig. 4F). [score:6]
Further, when Gadd45g cDNA lacking the 3′-UTR was overexpressed in breast cancer cells, the enhancement of cytotoxic agents -induced apoptosis by miR-383 was rescued indicating that the key target of miR-383 in regulating the sensitivity to genotoxic stress is Gadd45g. [score:6]
In our experiments, we demonstrated that miR-383 binds to the 3′-UTR of Gadd45g so as to down-regulate its expression. [score:6]
These results therefore support a role for miR-383 in controlling Gadd45g expression during the cellular response to UV irradiation, and the down-regulation of miR-383 may be involved in UV -induced apoptosis. [score:6]
Taken together, these data demonstrate that inhibition of Gadd45g expression is at least partially responsible for the miR-383 enhanced apoptotic sensitivity to genotoxic stress. [score:5]
In our studies, we determined that the expression of Gadd45g was elevated post UV irradiation, which result is inversely correlated with miR-383 expression. [score:5]
Additionally, miR-383 has been shown to be down-regulated in mouse testis after birth until 14 days postpartum [46], suggesting that miR-383 may be involved in mouse embryonic development. [score:5]
We also compared the expression of other differentiation associated genes, such as Sox17 and Gata5, but miR-383 had no effect on the expression of these genes (Fig. 5A). [score:4]
The expression of Nanog, Sox2 and Nestin, which were also observed to be regulated by miR-383, was unchanged by Gadd45g depletion. [score:4]
Thus, miR-383 has the potential to inhibit ES cell differentiation by regulating these genes. [score:4]
Here, we report that overexpression of miR-383 in breast cancer cells increased the apoptotic sensitivity to UV or cisplatin, indicating that miR-383 regulates cell apoptosis induced by genotoxic stress. [score:4]
Notably, miR-383 regulates the expression of Gadd45g in ES cells, but not their apoptosis. [score:4]
To ascertain the roles of Gadd45g in miR-383 regulated apoptotic sensitivity induced by genotoxic stress, MCF-7 cells were co -transfected with miR-383 construct and a miR-383-insensitive Gadd45g expression plasmid without the 3′-UTR. [score:4]
In this study, we found that Gadd45g is a direct target of miR-383, and miR-383 is able to increase the sensitivity of breast cancer cells to both UV irradiation and cisplatin treatment. [score:4]
The activity of the Firefly luciferase construct containing wild-type 3′-UTR of Gadd45g was suppressed by ectopic expression of miR-383 as compared with control (Fig. 1C). [score:4]
We propose that miR-383 functions through multiple targets that synergize so as to regulate ES cell differentiation. [score:4]
miR-383 also regulates the expression of Gadd45g in embryonic stem (ES) cells, but not their apoptosis under genotoxic stress. [score:4]
miR-383 regulates cellular apoptotic sensitivity to genotoxic stress through targeting Gadd45g. [score:4]
These results support that miR-383 functions as a negative regulator of ES cell differentiation by targeting Gadd45g. [score:4]
In order to determine the regulatory relationship between miR-383 and Gadd45g, we examined the expression levels of Gadd45g and miR-383 post UV irradiation. [score:4]
Thus, we assume that miR-383 participates in regulating ES cell differentiation through targeting Gadd45g. [score:4]
miR-383 was further showed to negatively regulate ES cell differentiation via targeting Gadd45g, which subsequently modulates the pluripotency -associated genes. [score:4]
We further observed that endogenous Gadd45g mRNA was also down-regulated by miR-383 mimic in both MCF-7 and MDA-MB-231 cells (Fig. 1F). [score:4]
Taken together, these data indicate that Gadd45g is a direct target of miR-383. [score:4]
Moreover, we showed that Gadd45g is also a target of miR-383 in mouse ES cells. [score:3]
The mature miR-383 and U6 expression levels were detected using a modified stem-loop RT-PCR method [50]. [score:3]
In our studies, we found that the expression of miR-383 is involved in cellular response to genotoxic stress. [score:3]
One miRNA, miR-383, was found to target Gadd45g using the three algorithms, and the putative binding site of miR-383 in the 3′-UTR of Gadd45g is highly conserved in different species (human, mouse, rat, rhesus monkey and horse) (Fig. 1A). [score:3]
The expression of miR-383 and Gadd45g is negatively correlated post UV irradiation. [score:3]
The protein levels of Isl1, Dppa4 and Gdf3 were also examined after Gadd45g depletion or miR-383 overexpression. [score:3]
Exctopic expression of miR-383 does not affect apoptosis in ES cells. [score:3]
Gadd45g levels were reduced by miR-383 mimic, and rescued by the Gadd45g expression plasmid (top). [score:3]
As shown in Fig. 1E, the endogenous protein levels of Gadd45g were reduced by ectopic expression of miR-383 in MCF-7 and MDA-MB-231 cells. [score:3]
Figure S2 Analysis by light microscopy revealed that overexpression of miR-383 increased the sensitivity to UV irradiation or cisplatin in MCF-7 (A) and MDA-MB-231 cells (B). [score:3]
However, miR-383 overexpression has almost no effect on cell apoptosis after UV irradiation or cisplatin treatment in ES cells (Fig. 4C), suggesting distinct function of miR-383 in the response to DNA damage between ES cells and tumor cells [34]. [score:3]
The expression pattern of miR383 and Gadd45g was further studied during ES cell differentiation. [score:3]
We next examined the expression levels of miR-383 in MCF-7 cells before and after UV irradiation by qRT-PCR. [score:3]
Fig. 4G, H and I showed that miR-383 was decreased in parallel with the increase of Gadd45g expression. [score:3]
Our results suggest that miR-383 regulates these ES cell pluripotency or differentiation -associated genes by down -regulating Gadd45g. [score:3]
Taken together, our study demonstrates that miR-383 is a negative regulator of Gadd45g in both tumor cells and ES cells, however, has distinct function in regulating cell apoptosis. [score:3]
The effect of miR-383 on the response to cisplatin in MCF-7 cells was also examined, and we found that miR-383 overexpressing cells exhibited a more severe cell death than control cells upon cisplatin treatment (Fig. S2A). [score:3]
The presence of miR-383 increased the cellular sensitivity to DNA damage in breast cancer cells, which was rescued by ectopic expression of Gadd45g without the 3′-UTR. [score:3]
As shown in Fig. 2E and F, statistical analysis showed that Gadd45g mRNA expression levels are inversely correlated with miR-383 (r = −0.7583, r = −0.65197, P<0.05). [score:3]
miR-383 regulates Gadd45g in mouse ES cells. [score:2]
In conclusion, we demonstrated that miR-383 negatively regulates Gadd45g in the process of genotoxic stress -induced apoptotic events and ES cell differentiation. [score:2]
To investigate the regulation of Gadd45g by miR-383 in vivo, we examined the protein level of Gadd45g under a condition of overexpression of miR-383 mimic or anti-miR-383. [score:2]
This suggests that miR-383 is a possible regulator of Gadd45g. [score:2]
These results raise a possibility that miR-383 regulates Gadd45g in the process of ES cell differentiation. [score:2]
Both the mRNA and protein levels of Gadd45g were regulated by miR-383. [score:2]
The above results suggest that these genes are likely to be regulated by miR-383-Gadd45g axis. [score:2]
Apoptosis assay shows that the effect of miR-383 on cell apoptosis induced by UV irradiation was fully rescued by overexpressing Gadd45g lacking the 3′-UTR in MCF-7 cells (Fig. 3C, lower panel). [score:2]
miR-383 regulates the cellular apoptotic sensitivity to UV or cisplatin. [score:2]
In this work, we found that miR-383 is a negative regulator of Gadd45g. [score:2]
At 12 hours after UV irradiation, morphologic examination performed under light microscopy indicated that there were more cells displaying apoptosis in miR-383 transfected cells than control cells (Fig. S2A). [score:1]
Sixteen hours before transfection, MCF-7 or MDA-MB-231 cells were seeded onto culture plates and transfected with 200 nM of miR-383 mimic or 100 nM of anti-miR-383 using lipofectamine 2000 (Invitrogen) according to manufacturers' instructions. [score:1]
miR-383 negatively modulates ES cell differentiation through Gadd45g. [score:1]
0110472.g004 Figure 4(A) Relative mRNA expression of Gadd45g was measured by qRT-PCR in mouse ES cells (R1) transfected with miR-383 mimic or anti-miR-383. [score:1]
This suggests that miR-383 is likely the upstream modulator of Gadd45g in response to environmental stress. [score:1]
For R1 cell transfection, cells were cultured on gelatin-coated 6-well plates without feeder cells, then 200 nM of miR-383 mimic or 100 nM of Gadd45g siRNA were introduced using lipofectamine 2000. [score:1]
Anti-miR-383 and anti-control were purchased from Ambion. [score:1]
Figure S3 (A) MDA-MB-231 cells were transfected with miR-383 mimic or control, and treated with UV irradiation (60 J/m2, post 12 h) or cisplatin (25 µM, post 24 h). [score:1]
The levels of endogenous miR-383 were reduced in a time and dose dependent manner in response to UV irradiation (Fig. 2C and D). [score:1]
As shown in Fig. 3B, nearly two folds of MCF-7 cells show positive staining with Annexin V in miR-383 transfected cells than in control cells. [score:1]
Therefore, miRNAs, including miR-383, are candidate antineoplastic agents based on their capacity to alter the responsiveness to cytotoxic agents [45]. [score:1]
miR-383 may be used as antineoplastic agents in cancer chemotherapy. [score:1]
To further evaluate the role of miR-383 in ES cell differentiation, we overexpressed miR-383 mimic in ES cells followed by RA treatment for 3 days. [score:1]
The miRNA profiling was carried out in primary human fibroblasts at a low dose of UV irradiation, but miR-383 was found to be unchanged [43]. [score:1]
MCF-7 cells were seeded in a 24-well plate and transfected with either 100 nM of miR-383 mimic or control, 100 ng of pMIR-Gadd45g 3′-UTR or pMIR-Gadd45g-mut, and 10 ng of pRL vector, using lipofectamine 2000 according to manufacturer's protocol. [score:1]
0110472.g005 Figure 5 (A and B) Quantitative RT-PCR analysis for differentiation (A) and pluripotency (B) marker genes in miR-383 mimic or control transfected ES cells cultured with LIF or with RA for 3 days. [score:1]
The effect of miR-383 on cell viability was further confirmed in MDA-MB-231 cells treated with UV irradiation or cisplatin. [score:1]
miR-383 modulates ES cell differentiation through Gadd45g. [score:1]
Intrerestingly, miR-383 was not involved in the apoptosis of ES cells under the same genotoxic stress. [score:1]
The effect of miR-383 on cell apoptosis caused by genotoxic stress is mediated by Gadd45g. [score:1]
Similarly, the apoptosis after cisplatin treatment is increased in miR-383 mimic transfected cells, but this increase is only happened in the absence of miR-383-resistent Gadd45g plasmid (Fig. 3D). [score:1]
0110472.g001 Figure 1 (A) Schematic representation of miR-383 binding site on the Gadd45g 3′-UTR. [score:1]
The wild-type or mutant pMIR-Gadd45g-3′-UTR reporter was co -transfected with a control or a miR-383 mimic plasmid, and a pRL-SV40 vector containing the Renilla luciferase gene was also co -transfected as a normalization control. [score:1]
The inversed correlation between Gadd45g and miR-383 was also observed in spontaneous differentiation of embryonic body (EB). [score:1]
These results indicate that miR-383 increases the sensitivity of breast cancer cells in response to UV irradiation and cisplatin treatment, and thus enhances stress -induced apoptosis. [score:1]
Gadd45g and miR-383 are negatively correlated in response to UV irradiation. [score:1]
miR-383 enhanced the cytotoxicity caused by both types of genotoxic stress in MDA-MB-231 cells (Fig. S3A). [score:1]
Alternatively, 100 nM of anti-miR-383 or negative control were cotransfected with 100 ng of pMIR-Gadd45g 3′-UTR supplemented with 10 ng of pRL vector. [score:1]
To determine whether the relationship between miR-383 and Gadd45g are conserved in physiological conditions, we employed mouse ES cell as mo del system. [score:1]
After transfection with miR-383 mimic or control, MCF-7 cells were irradiated with UV (60 J/m [2]). [score:1]
Additionally, transfection of MCF-7 or MDA-MB-231 cells with anti-miR-383 increased the Gadd45g protein levels (Fig. 1E). [score:1]
[1 to 20 of 99 sentences]
2
[+] score: 158
54, 55 As shown in Figure 4o, knockdown of Nucleolin decreased the expression of NLC1-C. Since NLC1-C was a direct target of miR-320a and miR-383 and Nucleolin promoted NLC1-C expression, we investigated whether miR-320a and miR-383 mediated the increase induced by Nucleolin on NLC1-C expression. [score:9]
We used lentivirus -mediated RNA interference (RNAi) to knockdown NLC1-C. As shown in Figure 4a and b, silencing NLC1-C increased primary and mature miR-320a and miR-383 expression, whereas overexpression of NLC1-C decreased their expression. [score:8]
Combined with the observation that the expression of primary and mature miR-320a and miR-383 was down-regulated in MA patients and the hyperactive proliferation of germ cells in patients with mixed patterns of MA, [8] NLC1-C could contribute to spermatogenic arrest caused by the dysregulation of germ cell proliferation by accumulating in the nucleus of spermatogonia and primary spermatocytes, repressing miR-320a and miR-383 transcripts, resulting in hyperactive proliferation of germ cells. [score:7]
The expression of miR-383 targets IRF1 and Cyclin D1 8, 56 (Figure 5j) and miR-320a targets ARPP-19 and ERR γ [57] (Figure 5k) was promoted by pZW1-sno-NLC1-C. These observations and our previous results 8, 56 confirmed that the accumulation of NLC1-C in the nucleus of spermatogonia and primary spermatocytes represses miR-320a and miR-383 transcripts resulting in hyperactive proliferation of germ cells leading to male infertility. [score:7]
Real-time PCR analysis and northern blotting (NB) assay showed that the expression of NLC1-C was significantly inhibited by miR-320a/miR-383 mimics and was promoted by miR-320a/miR-383 inhibitors (Figure 3f and h). [score:6]
We subsequently analysed the expression of NLC1-C in NT2 cells co -transfected with Nucleolin siRNA and miR-320a or miR-383 inhibitors. [score:5]
After 48 h of Nucleolin knockdown (Figure 4c), the expression of primary and mature miR-320a/miR-383 was increased (Figure 4d–f), similar to NLC1-C knockdown. [score:5]
As shown in Figure 4p, the inhibitors of miR-320a or miR-383 were sufficient to rescue the decrease induced by Nucleolin depletion on NLC1-C expression. [score:5]
To confirm that NLC1-C was the direct target of miR-320a and miR-383, 293 T cells were co -transfected with 200 ng pMIR-REPORT/Mutation plasmids, 20 ng of the transfection control Renilla vector and 80 pmol miR-320a/383 mimics/negative control for 30 h. In the promoter activity assay, 293 T cells were co -transfected with 20 pmol Nucleolin siRNA/NLC1-C siRNA and 400 ng pGL3-miR-320a/miR-383 promoter or 400 ng pGL3-miR-320a/miR-383 promoter mutation plasmids in 24-well plates with three replicate wells for each condition. [score:5]
To confirm that NLC1-C was the direct target of miR-320a and miR-383, 293 T cells were co -transfected with 200 ng pMIR-REPORT/Mutation plasmids, 20 ng of the transfection control Renilla vector and 80 pmol miR-320a/383 mimics/negative control for 30 h. In the promoter activity assay, 293 T cells were co -transfected with 20 pmol Nucleolin siRNA/NLC1-C siRNA and 400 ng pGL3-miR-320a/miR-383 promoter or 400 ng pGL3-miR-320a/miR-383 promoter mutation plasmids in 24-well plates with three replicate wells for each condition. [score:5]
while, as shown in Supplementary Figure S5a and b, the expression of Nucleolin mRNA and protein level was not affected by miR-320a/miR-383 mimics and inhibitors. [score:5]
In addition, NLC1-C inhibited miR-320a and miR-383 transcripts in vitro and the expression of NLC1-C was accumulated in the nucleus of spermatogonia and primary spermatocytes in the testes of infertile men with mixed patterns of MA. [score:5]
As Figure 4g shown, Knockdown of NLC1-C (marked with sh-NLC1-C-1 and sh-NLC1-C-2) or Nucleolin (si-Nucleolin), respectively, increased the expression of miR-320a and miR-383. [score:4]
Our previous results found that hyperactive proliferation of germ cells in patients with mixed patterns of MA and down-regulation of primary and mature miR-383 was associated with enhanced proliferative activity of germ cells in MA patients. [score:4]
NLC1-C is a direct target of miR-320a and miR-383. [score:4]
Since, we wanted to determine whether NLC1-C can regulate the expression of miR-320a and miR-383. [score:4]
To validate whether the NLC1-C gene is a direct target of miR-320a and miR-383, we constructed luciferase reporter constructs containing either the wild-type (WT) full-length NLC1-C RNA or the mutant forms of the seed sites into the pMIR-Report vector (Figure 3j). [score:4]
However, when NLC1-C was down-regulated in the cytoplasm, it accumulated in the nucleus of spermatogonia and primary spermatocytes, repressing miR-320a and miR-383 transcripts and leading to hyperactive proliferation of spermatogonia and primary spermatocytes by binding to Nucleolin, ultimately resulting in male infertility (Figure 7b). [score:4]
42, 53 We then sought to determine whether Nucleolin post-transcriptionally regulates the expression of miR-320a and miR-383. [score:4]
NLC1-C represses the expression of miR-320a and miR-383 directly binds Nucleolin in the nucleus. [score:4]
Next, we examined whether Nucleolin and NLC1-C co-regulate miR-320a and miR-383 expression. [score:4]
These results demonstrate that Nucleolin binding to NLC1-C co-regulates miR-320a and miR-383 transcription mediating the increase of NLC1-C expression induced by Nucleolin. [score:4]
These findings demonstrate that Nucleolin and NLC1-C repress the expression of miR-320a/miR-383 at the level of transcription and not through post-transcriptional regulation. [score:4]
To verify that these potential NLC1-C/Nucleolin -binding sites were important for the transcriptional activity of miR-320 and miR-383, expression vectors encoding Nucleolin and/or NLC1-C were transiently co -transfected with miR-320 or SGCZ (miR-383) promoter reporter plasmids into 293 T cells. [score:3]
NT2 cell proliferation was inhibited the most significantly when transfected in combination with the miR-320a mimic, miR-383 mimic, and NLC1-C shRNA (Figure 6d). [score:3]
[58] In this study, we found that in the normal male testes, NLC1-C inhibited miR-320a and miR-383 transcripts by binding to Nucleolin in the nucleus. [score:3]
In summary, we demonstrate that NLC1-C binding to Nucleolin functions as a positive regulator of cell proliferation by directly repressing miR-320a and miR-383 transcripts. [score:3]
To validate whether the accumulation of NLC1-C in the nucleus represses both miR-320a and miR-383 transcripts resulting in hyperactive proliferation of germ cells associated with male infertility, we transfected NT2 cells with pcDNA3.1-NLC1-C or pZW1-sno-NLC1-C plasmid, which stably expresses a nuclear NLC1-C. Forty-eight hours after transfection, RNA ISH followed by immunofluorescence or real-time PCR was performed. [score:3]
Overexpression of Nucleolin and NLC1-C decreased the activity of the miR-320/SGCZ (miR-383) promoter region (−1050/+50 bp), which contains a putative NLC1-C binding site located at −225  to −153 bp (miR-320 promoter) or −793  to −740 bp (SGCZ (miR-383) promoter), by about 50 and 50%, respectively (Figure 4k and l). [score:3]
As described in this study, NLC1-C binding to Nucleolin co-regulates miR-320a and miR-383 transcription. [score:2]
Conversely, Mutation of putative NLC1-C binding site in the miR-320/SGCZ (miR-383) promoter region recued the luciferase activity repression induced by Nucleolin and NLC1-C (Figure 4k and l). [score:2]
WT miR320 promoter and miR-383 promoter were obtained by amplifying two −1000 /+50 bp fragments of miR320 promoter and miR-383 promoter harbouring the NLC1-C -binding sites, whereas mutated miR320 promoter and miR-383 promoter were generated by PCR -based site-directed mutagenesis. [score:2]
WT NLC1-C-pMIR-Report was obtained by amplifying a 730-bp fragment of NLC1-C harbouring the miR-320a and miR-383 -binding sites, whereas mutated NLC1-C-pMIR-Report was generated by PCR -based site-directed mutagenesis. [score:2]
In addition, the NLC1-C/Nucleolin-miR-320a/miR-383-NLC1-C pathways are identified in the regulation of NT2 cell survival. [score:2]
Co-transfection of the miR-320a or miR-383 mimic and the reporters into 293 T cells resulted in an ~50% decrease in luciferase activity (Figure 3k), whereas mutation of the seed sequences abolished the silencing effects of miR-320a or miR-383 (the right panel of Figure 3k). [score:2]
Dysregulation of NLC1-C/Nucleolin-miR-320a/miR-383-NLC1-C pathways is associated with spermatogeneic arrest. [score:2]
The probes sequences of miR-320 and miR-383 are listed in Supplementary Table S3. [score:1]
We next examined the effects of miR-320a/miR-383 on NT2 cell proliferation and apoptosis induced by NLC1-C. Our results revealed that co-transfection of any two of miR-320a mimic, miR-383 mimic and NLC1-C shRNA into NT2 cells resulted in more significant decrease in cell proliferation than transfection with any one of them (Figure 6d). [score:1]
miR-320a and miR-383 mediate the proliferation and apoptosis of NT2 cells induced by NLC1-C depletion. [score:1]
WT and mutated miR320 promoter and miR-383 promoter sequences were inserted into the KpnI and XhoI sites of the pGL3-basic vector. [score:1]
The accumulation of NLC1-C in the nucleus represses both miR-320a and miR-383 transcription by binding to Nucleolin is associated with male infertility. [score:1]
Analysis of bioinformatics data revealed one seed site for miR-320a and miR-383, separately, in the NLC1-C RNA sequence (Figure 3e). [score:1]
For NLC1-C, β-actin, miR-320, miR-383 NB, total RNAs collected from transfected cells were resolved on 1.5% denatured agarose gels ands were carried out according to the manufacturer's protocol (DIG Northern Starter Kit, Roche). [score:1]
Digoxigenin (DIG) -labelled antisense of NLC1-C and β-actin probes were made using either SP6 or T7 RNA polymerases by in vitro transcription with the DIG Northern Starter Kit (Roche) and 5'-end DIG -labelled LNA modified DNA oligonucleotides (LNAs) complementary to the mature miR-320 and miR-383 were supplied by Exiqon A/S (Vedbaek, Denmark). [score:1]
Analysis of bioinformatics data revealed that there is one binding site of NLC1-C on the miR-320 and SGCZ (miR-383) promoter (Figure 4j). [score:1]
Similarly, miR-320a and miR-383 enhanced apoptosis of NT2 cells induced by NLC1-C depletion (Figure 6e). [score:1]
[1 to 20 of 46 sentences]
3
[+] score: 148
This idea is supported by results of luciferease experiments in which induced miR-383 expression resulted in only 25% reduction of luciferase activity in comparison with the effect of miR-224 which caused 45% downregulation of expression. [score:8]
Since altered expression of miR-224 and miR-383 was observed in tumors of tissues expressing type 1 iodothyronine deiodinase it suggests that these tumors may also present disturbed expression of DIO1. [score:7]
The 3′UTR of DIO1 is a direct target for miR-224 and miR-383Computational analysis of DIO1 3′UTR with TargetScan5.1 revealed two putative binding sites for miR-224 and miR-383, located at nucleotides 1788–1794 and 898–904 of DIO1 transcript (NM_00792.5), respectively (Figure S2 in Supplemental Data). [score:6]
miR-224 was shown to increase apoptotic cell death and proliferation in hepatocellular carcinoma (54) while overexpression of miR-383 inhibited proliferation of testicular embryonic carcinoma cells (55). [score:5]
The expression is shown as percentage of control C. D. Mean fold T: C change of expression of miR-383 224 in samples divided according to tumor differentation grades (G1, G2, G3). [score:5]
Transfection with miR-224 decreases expression of endogenous DIO1 To determine the functional effect of miR-224 and miR-383 on endogenous DIO1 mRNA, Caki-2 cells were transfected with pre-miR-224, pre-miR-383 (microRNA precursors), anti-miR-224, anti-miR-383 (microRNA inhibitors), or scrambled control. [score:5]
We observed differing expression of miR-224 and miR-383, whereas expression of the five other candidate miRNAs: miR-610, miR-637, miR-659, miR-1202 and miR-1266 did not differ significantly between ccRCC and control tissue (Figure S1, Supplemental Data). [score:5]
Successful transfection was confirmed in SQ PCR analysis by a large induction of miR-224 and miR-383 after transfection with microRNA precursors and significant decrease of miRNAs expression when inhibitors were used (Figure 3). [score:5]
Caki-2 cells were seeded at 0.5×10 [5] cells per 12-well dish and transfected 24 hours later using Lipofectamine 2000 reagent (Invitrogen, USA) as described by the manufacturer with 37.5 pmoles of miRNA precursors: pre-miR-224 and pre-miR-383 (Pre-miR [™] miRNA Precursor Molecule, Ambion, USA), miRNAs inhibitors: anti-miR-224 and anti-miR-383 (Anti-miR™ miRNA Inhibitor Molecule, Ambion, USA) or control scrambled microRNA (Negative microRNA Control, Ambion, USA). [score:5]
Regarding miR-383, it was reported as downregulated in hepatocellular carcinoma (51), breast and ovarian cancers, melanoma (40), acute myeloid leukemia (52) and central nervous system tumors (53). [score:4]
0024541.g004 Figure 4The DIO1 3′UTR is the direct target for miR-224 and miR-383. [score:4]
These studies revealed statistically significant (p = 0.0002) over four fold increase in the expression of miR-224 and nearly two fold increase (p = 0.0236) in the expression of miR-383, in samples T compared to control samples C (Figure 1). [score:4]
Thus, our work is the first one showing upregulation of miR-383 in cancer. [score:4]
Luciferase experiments confirm the hypothesis that binding of miR-383 to DIO1 3′UTR results in translation blockage, as luciferase activity is a direct consequence of actual luciferase protein levels. [score:4]
The 3′UTR of DIO1 is a direct target for miR-224 and miR-383. [score:4]
The DIO1 3′UTR is the direct target for miR-224 and miR-383. [score:4]
Site-directed mutagenesis of the miR-224 and miR-383 target sites: GTGACTT of miR-224 within nt 1788–1794 and TCTGATCT of miR-383 within nt 898–904 in the DIO1 3′UTR was performed using Quick change-mutagenesis kit (Stratagene, Germany). [score:4]
of DIO1 3′UTR with TargetScan5.1 revealed two putative binding sites for miR-224 and miR-383, located at nucleotides 1788–1794 and 898–904 of DIO1 transcript (NM_00792.5), respectively (Figure S2 in Supplemental Data). [score:3]
Conversely, in breast cancer, miR-383 is lost (40) while DIO1 expression significantly increases (41). [score:3]
This may suggest that miR-383 acts on a posttranscriptional level, causing translation blockage rather than degradation of DIO1 mRNA. [score:3]
Expression of miR-224 (A and B) and miR-383 (C and D) in ccRCC. [score:3]
We did not observe this overexpression when cells were transfected with anti-miR-383 (Figure 3). [score:3]
We identified 7 potential miRNAs targeting the 3′UTR of human DIO1 (Table 1): miR-224, miR-383, miR-610, miR-659, miR-637, miR-1202 and miR-1266. [score:3]
In summary, we demonstrated that DIO1 3′UTR is targeted by two microRNAs: miR-224 and miR-383. [score:3]
In the experiments performed in Caki-2 cells, miR-383 did not affect the expression of endogenous DIO1. [score:3]
E and F. Scatter plots of T3 concentration T: C ratio versus T: C miR-224 (E) and miR-383 (F) expression ratios. [score:3]
miR-224 and miR-383 are overexpressed in ccRCC. [score:3]
Expression of miR-224, miR-383, miR-610, miR-637, miR-659, miR-1202 and miR-1266 was analyzed in 32 matched pairs of tumor (T) and control (C) samples. [score:3]
C and D. Scatter plots of the T: C ratios of DIO1 mRNA versus T: C miR-224 (C) and T: C miR-383 (D) expression ratios. [score:3]
Thus, disturbed expression of miR-224 and miR-383 in ccRCC was confirmed by two different analytical approaches. [score:3]
The luciferase activity in cells transfected with DIO1-3′UTR383mut was inhibited by 40% after pre-miR-224 addition, whereas transfection with DIO1-3′UTR224mut and pre-miR-383 resulted in ∼23% decrease in luciferase activity (Figure 4). [score:3]
The luciferase activity of the reporter constructs: DIO1-3′UTR224mut and DIO1-3′UTR383mut, in which target sites recognised by the microRNA were mutated, was unaffected by transfection with pre-miR-224 or pre-miR-383, respectively (Figure 4). [score:3]
To determine the functional effect of miR-224 and miR-383 on endogenous DIO1 mRNA, Caki-2 cells were transfected with pre-miR-224, pre-miR-383 (microRNA precursors), anti-miR-224, anti-miR-383 (microRNA inhibitors), or scrambled control. [score:3]
To study the direct interaction between the miR-224, miR-383 and DIO1 transcript we cloned the 3′UTR of DIO1 downstream of the luciferase reporter gene in the pGL3-control vector – (DIO1-3′UTR). [score:2]
Induced expression of miR-224 and miR-383 in ccRCC was confirmed in a specific TaqMan microRNA assay. [score:2]
C. Increased miR-383 expression in ccRCC tumor samples (T) compared to control samples (C). [score:2]
B and C. The level of miR-224 (B) and miR-383 (C) in cells transfected with pre-miRs or anti-miRs. [score:1]
Taken together, these data show that the 3′UTR of DIO1 contains specific binding sites for microRNAs miR-224 and miR-383. [score:1]
Binding sites of miR-383 and miR-224 are indicated and their positions (miR-383: nt 898-904, miR-224: nt 1788–1794) are given according to DIO1 mRNA sequence (NM_00792.5). [score:1]
In contrast, no correlation was observed for miR-383 and DIO1. [score:1]
pre-miR-383 did not have this effect (Figure 3). [score:1]
miR-383 changes did nor correlate with T3. [score:1]
Cells were cotransfected with obtained constructs and precursors of microRNAs: pre-miR-224, pre-miR-383 or control (scrambled miRNA). [score:1]
Both microRNAs, miR-224 and miR-383 are believed to be implicated in control of proliferation or apoptosis. [score:1]
Whether impaired expression of DIO1 truly results from altered miR-224 and miR-383 levels in these cancers needs to be evaluated by separate studies. [score:1]
Mean fold change of miR-224 and miR-383 was analyzed in different tumor gradings but did not depend on the differentiation grade of tumor sample. [score:1]
The question whether miR-224 and miR-383 are involved in ccRCC proliferation awaits future studies. [score:1]
[1 to 20 of 47 sentences]
4
[+] score: 80
So, we selected the most downregulated one, miR-383-5p to further identify its expression level in mice kidney samples and human podocytes under the indicated treatments. [score:6]
As shown in Fig. 8a, the expression of miR-383-5p was downregulated after treatment with resveratrol; however, there was no difference between db/m and db/db mice. [score:6]
The sequence of the miR-383-5p mimics (5′ to 3′): sense AGAUCAGAAGGUGAUUGUGGCU antisense CCACAAUCACCUUCUGAUCUUU, the sequence of the Negative mimics (5′ to 3′): sense UUCUCCGAACGUGUCACGUTT antisense ACGUGACACGUUCGGAGAATT, the sequence of the miR-383-5p inhibitors (5′ to 3′): AGCCACAAUCACCUUCUGAUCU, the sequence of the Negative inhibitors (5′ to 3′): CAGUACUUUUGUGUAGUACAA. [score:5]
While, treatment with bafilomycin A still increased the expression of p62 and LC3-II in podocytes although the suppression of miR-383-5p decreased the level of p62 (Fig. 8e). [score:5]
In addition, miR-383-5p overexpression inhibited LC3-I to LC3-II conversion. [score:5]
Expression of miR-383-5p was suppressed after treatment with resveratrol in both db/db mice kidney and human podocytes. [score:5]
The following were purchased from GenePharma (Shanghai, China): miR-383-5p mimics; Negative mimics, miR-383-5p inhibitors and Negative inhibitors. [score:5]
The results are shown in Fig. 7. From the differentially expressed miRNAs, we found when db/db mice treated with resveratrol (db/db + RES), the expression of miR-383-5p caused the most obvious decrease relative to db/db mice. [score:5]
, miR-383-5p mimics/inhibitors or negative mimics/inhibitors were transfected into the cells by using Lipofectamine 2000. [score:5]
Resveratrol regulates autophagy and apoptosis in db/db mice and human podocytes through the suppression of miR-383-5p. [score:4]
We will explore miR-383-5p target gene(s) and its exact mode of action in the regulation of autophagy in future studies. [score:4]
As shown in Fig. 8c, overexpression of miR-383-5p significantly blocked the increase in autophagy and attenuation of HG -induced apoptosis induced by resveratrol. [score:3]
Importantly, our results suggested that the protective effects of resveratrol are mediated by the suppression of miR-383–5p. [score:3]
Transfection of miR-383-5p mimics and inhibitors. [score:3]
Further, overexpression of miR-383-5p significantly blocked the resveratrol -induced increase in autophagy and increased HG -induced apoptosis. [score:3]
miR-383-5p inhibitors. [score:3]
Interestingly, our findings suggested miR-383-5p might play a role in the regulation of autophagy by resveratrol; this discovery may explain the prime mechanism of resveratrol. [score:2]
The expression of miR-383 was measured by qRT-PCR with SYBR Green PCR Kit (Takara) on an Applied Biosystems StepOne-Plus real-time PCR system and human U6 RNA was amplified as an internal control. [score:1]
Real-time reverse transcriptase (qRT-)PCR for miR-383 quantification. [score:1]
Further investigation of miR-383-5p target genes and signaling pathways is necessary to reveal the specific mechanism of resveratrol in modulating autophagy and protecting against DN. [score:1]
In consistence, miR-383-5p was significantly decreased in podocytes after the addition of resveratrol with the dose of 10 μM and15 μM (Fig. 8b). [score:1]
The localisation of the expression of miR-383-5p in the kidney is not investigated, this needs to be further studied in vivo with a podocyte-specific method. [score:1]
The relative expression ratio of miR-383 was calculated by the 2 [−ΔΔCT] method. [score:1]
Next, we checked whether miR-383-5p had an effect on autophagy and apoptosis under HG plus resveratrol treatment. [score:1]
Thus, we propose miR-383-5p as a novel autophagy-related microRNA. [score:1]
[1 to 20 of 25 sentences]
5
[+] score: 43
Real-time PCR confirmed microarray analysis results: expression of miR-302a and miR-491-3p was up-regulated (Fig. 2) and miR-520d-3p and miR-383 was down-regulated (Fig. 2) in patients with NOA. [score:9]
Quantitative real-time PCR analysis confirmed microarray data: miR-302a and miR-491-3p was up-regulated and miR-520d-3p and miR-383 was downregulated in NOA patients. [score:7]
A, D: HE stain of normal (A) and NOA testes (E); B, E: In the testis of normal control (B), miR-383 was highly expressed in primary spermatocyte (PS) and lowly expressed in spermatid (Sp); whereas the expression of miR-383 in NOA patient (E) is decreased compared with control. [score:6]
Furthermore, in situ hybridization data were also verified microarray analysis results: miR-383 expression (major in primary spermatocyte) levels were found to be down-regulated in patients with NOA (Fig. 3). [score:6]
As a potential target of miR-383, GADD45G can induce apoptosis and inhibit cell growth in response to stress shock [32]. [score:5]
For example, one of the predicted target genes of miR-302a and miR-383 is MLH1, while miR-491-3p and miR-520d-3p is SCP1 and SCP3, respectively. [score:3]
In this study, the expression of miR-383 was examined in testicular tissues. [score:3]
LNAs had the following sequences: LNA-miR-383, 5'-agccacaatcaccttctgatct-3'. [score:1]
In situ hybridization analyses using 5' DIG-conjugated, LNA -modified DNA probe complementary to miR-383 was performed on 10-μm frozen sections of the testes of NOA patient and normal control. [score:1]
To confirm the results obtained by microarray analysis, quantitative real-time RT-PCR analysis of normal and NOA testicular samples was performed for miR-302a, miR-491-3p, miR-520d-3p and miR-383. [score:1]
The miR-383 was chosen for further in situ hybridization analysis because the relative abundance of this miRNA was found be in meiotic prophase [36]. [score:1]
[1 to 20 of 11 sentences]
6
[+] score: 42
In order to confirm the results of the microarray analysis, we conducted a northern blot analysis to detect the expression levels of 8 representative differentially expressed miRNAs identified using the microarray, including 4 upregulated miRNAs (miR-196a, miR-193b, miR-383 and miR-143) and 4 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b and miR-590). [score:11]
The miRNAs that exhibited at least a 2-fold change in expression in the hADSCs before and after the induction of chondrogenic differentiation are listed in Table I, and these include 12 upregulated miRNAs (miR-196a, miR-143, miR-383, miR-193b, let-7i, miR-26a, miR-539, miR-199a-3p, miR-337-5p, miR-146a-5p, miR-646, and miR-381) and 8 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b, miR-96-3p, miR-302-3p, miR-23a-3p, miR-590, and miR-510). [score:9]
A northern blot analysis was conducted to confirm that miR-196a and miR-490-5p were indeed differentially expressed in all 3 samples, which is consistent with the microarray results, whereas miR-193b and miR-383 were found to be upregulated in only 2 samples, and miR-1307 was downregulated in only 1 sample. [score:9]
However, only 5 miRNAs [miR-196a, miR-193b, miR-383 (upregulated), miR-490-5p and miR-1307 (downregulated)] produced northern blot analysis signals. [score:7]
The results from northern blot analysis also revealed that miR-196a was overexpressed in all the 3 samples, whereas miR-193b and miR-383 were overexpressed in only samples 1 and 3 between the undifferentiated hADSCs and the hADSCs which were subjected to chondrogenic differentiation. [score:5]
The probe sequences were as follows: miR-196a antisense, 5′-CCCAACAACATGAAACTACCTA-3′; miR-193b antisense, 5′-AGCGGGACTTTGAGGGCCAGTT-3′; miR-383 antisense, 5′-AGCCACAATCACCTTCTGATCT-3′; miR-490-5p antisense, 5′-ACCCACCTGGAGATCCATGG-3′; miR-1307 antisense, 5′-AGCCGGTCGAGGTCCGGTCGA-3′; and U6 antisense, 5′-GCCATGCTAATCTTCTCTGTATC-3′. [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 27
Each scatter spot representing average normalized expression level of miRNA in three repeats of each treatment; (b) 13 miRNAs exhibiting aberrant expression in Jurkat cells cultured with TNF-α (20 ng/mL) for 7 days; (c) decreased expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 in RA T cells miRNA, compared with normal T cells. [score:6]
Initially, our studies showed that among the expression of T cell miRNAs affected by TNF-α in Jurkat cells, the expression levels of miR-139-3p, miR-204, miR-760, miR-383, miR-524-5p, miR-136, miR-548d-3p, and miR-214 were significantly decreased in RA T cells. [score:5]
The expression levels of 12 miRNAs, including miR-139-3p, miR-204, miR-760, miR-432, miR-524-5p, miR-136, miR-548d-3p, miR-206, miR-214, miR-383, miR-224, and miR-887 were significantly lower, whereas the expression level of miR-146a was significantly higher, in Jurkat cells after being cultured with TNF-α for 7 days (fold change > 4, p < 0.05, Fig.   1b). [score:5]
Decreased expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 were noted in RA T cells. [score:3]
The expression levels of miR-383 showed a significant correlation with the use of sulfalsalazine, methotrexate, and daily steroid dosage. [score:3]
The expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 was found to be significantly lower in RA T cells (p < 0.05), compared with controls (Fig.   1c). [score:2]
The fold changes of expression levels for these miRNAs were 0.42-fold for miR-139-3p, 0.43-fold for miR-204, 0.13-fold for miR-760, 0.32-fold for miR-524-5p, 0.45-fold for miR-136, 0.19-fold for miR-548d-3p, 0.37-fold for miR-214;0.36-fold for miR-383, and 0.14-fold for miR-887, compared with controls. [score:2]
80) 0.65 (0.45– 0.94) – – – – – – 2.44 (1.08– 5.48) miR-383 1.08 (0.77–1.52) 0.71 (0.24–2.09) – – – 0.33 (0.08–1.36) 0.93 (0.82–1.05) – 0.81 (0.60–1.10) – miR-548d-3p 0.80 (0.52–1.22) 0.55 (0.14–2.16) – 0.62 (0.13–2.96) – – – – – – miR-760 0.72 (0. 46–1.11) 0.97 (0.25–3.81) – – – – – 2.54 (0.94–6.90) 1.35 (0.95–1.93) 3.66 (1.31– 10.22) Values shown are fold change (95% confidence interval) calculated using multiple linear regression analysis, and those in bold represent p < 0.05 ACPAs anti-citrullinated protein antibodies, CRP C-reactive protein, miRNA microRNAs, MTX methotrexate, RF rheumatoid factor [a]Biologic agent including: tumor necrosis factor antagonists, abatacept, and tocilizumab Fig. 1Altered expression of T cell miRNAs affected by TNF-α in patients with RA and healthy controls. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 25
We have identified miRNAs that are over-expressed in ependymomas, such as miR-135a and miR-17-5p, and down-regulated, such as miR-383 and miR-485-5p. [score:6]
Specific miRNAs were confirmed as over-expressed and down-regulated in ependymomas, such as miR-135a, miR-34a, miR-17-5p, miR-383 and miR-485-5p (Figure S1B). [score:6]
Over-expressed miRs (miR-135a and miR-17-5p) and down-regulated miRNAs (miR-383 and miR-485-5p) are represented. [score:6]
Individual assays were then performed to confirm the over -expression (e. g. miR-135a and miR-17-5p), and the down-regulation (e. g. miR-383 and miR-485-5p) of a few selected miRNAs (Figure S1B). [score:5]
Individual miRNA expression analysis for miR-135a, miR-17-5p, miR-485-5p, miR-383 and miR-34a were performed in triplicate in 96 well plates using the TaqMan® Individual miRNA assays (Applied Biosystems) according to the manufacture's instructions. [score:2]
[1 to 20 of 5 sentences]
9
[+] score: 19
Actually, a recent study demonstrated that miR-383 is an oncosuppressor gene that directly targets Cyclin D1 and then inhibits its downstream effectors. [score:8]
The authors also demonstrated that a decreased expression of miR-383 can deregulate the cyclin -dependent kinase 4 expression and promote DNA damage and the onset of testicular embryonal carcinoma [9]. [score:6]
However in literature no direct evidences are reported showing that deletions of miR-383 impair neurodevelopment, but evidences of its involvement in tumorigenesis are present. [score:3]
In the course of a systematic screening of patients with unexplained ID, by the use of the high-resolution SNP-array, we have identified, in a 9 years-old patient affected by mild ID, a de novo 1Mb interstitial deletion in the 8p22.3 chromosomal region overlapping SGCZ gene, miR-383 and mapping upstream of the TUSC3 gene. [score:1]
The DNA sequence inside intron 3 of SGCZ gene encodes also for miR-383. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 17
To assess whether miRNA with expression divergence on the human lineage might be associated with human cognitive functions, we investigated the expression of genes targeted by five miRNA showing human-specific expression, according to multiple methodologies: miR-184, miR-487a, miR-383, miR-34c-5p and miR-299-3p (Figure 2). [score:7]
This effect was significant for combined targets of the five miRNA, as well as for targets of miR-184 and miR-383 analyzed individually. [score:5]
Requiring significant support by at least two out of three methodologies (sequencing, microarrays and Q-PCR), expression changes in five miRNA (miR-184, miR-299-3p, miR-487a, miR-383 and miR-34c-5p) could be assigned to the human evolutionary lineage and two (miR-375 and miR-154*) to the chimpanzee evolutionary lineage (Figure 2). [score:3]
We chose three types of miRNA differences: (1) consistent by both methodologies: miR-383 and miR-34c-5p; (2) significant according to sequencing, but unconfirmed in the microarray experiment: miR-143 and miR-499; (3) significant according to sequencing, but not detected or masked on the microarrays: miR-184 and miR-299-3p. [score:1]
On the DNA sequence level, these miRNA tend to be conserved: miR-184 mature miRNA sequence is evolutionarily conserved from insects to humans, with only one nucleotide different at 3′end of mature sequence, while miR-383 and miR-34c-5p are classified as broadly conserved and miR-299-3p - as conserved among animal species [25], [31]. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Similarly, it has been found in a chicken, where it has been confirmed that DNMT3B expression was reestablished in a female germ cell-specific manner, downregulation by four miRNAs: miR-15c, miR-29b, miR-383, and miR-222 [13]. [score:6]
Interestingly, the miR-320 was differently expressed in the follicular fluid of women with PCOS in still one study [53] and was along miR-383 upregulated in comparison with healthy (control) women. [score:6]
Three different miRNAs, miR-224, miR-378, and miR-383, have been found to be involved in the regulation of aromatase expression during follicle development. [score:5]
[1 to 20 of 3 sentences]
12
[+] score: 11
Authors specifically found the upregulation of miR-34a, miR-124a and miR-383 and the downregulation of miR-130b and miR-181a. [score:7]
Moreover, it has been reported that miR-383 modulates the insulin signaling pathway through IGF-1 and its receptor [123], and that it is downregulated by a high-fat diet (HFD) in mice pancreatic islets [124]. [score:4]
[1 to 20 of 2 sentences]
13
[+] score: 11
E2F1 is binding target for miRNA-383 whose down-regulation may be associated with maturation arrest of infertile males 40 43, while BMPR2, a receptor for BMP ligands, has been shown to be expressed in mouse spermatogonia 44. [score:8]
E2F1 has recently been shown as a target of miRNA-383 in mouse spermatogenesis 40. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 7
The top four most significantly associated miRNAs - hsa-miR-130a (11q12.1), hsa-miR-22 (17p13.1), hsa-miR-93 (7q22.1) and hsa-miR-383 (8p22) - with DNA CNVs in breast cancer cell lines are shown in Figure 6. Figure 6 Association of miRNA expression with genomic copy number variation in breast cancer cell lines. [score:3]
The top four most significantly associated miRNAs - hsa-miR-130a (11q12.1), hsa-miR-22 (17p13.1), hsa-miR-93 (7q22.1) and hsa-miR-383 (8p22) - with DNA CNVs in breast cancer cell lines are shown in Figure 6. Figure 6 Association of miRNA expression with genomic copy number variation in breast cancer cell lines. [score:3]
The majority of these miRNAs (hsa-miR-130a, hsa-miR-93, hsa-miR-383, hsa-miR29c, hsa-miR-382, hsa-miR-31) were already found to be located in regions that exhibited DNA copy number abnormalities in breast cancer tumors [65]. [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 6
In another study, miR-383 was highly expressed in primary spermatocyte and poorly expressed in spermatids of samples of men with normal spermatogenesis; whereas the expression of miR-383 in tissues from men with severely impaired sperm production was noticeably lower compared with the control group [13]. [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 6
Six of them, namely, rno-miR-107-5p, rno-miR-383-5p, rno-miR-24-1-5p, rno-mir-191b, rno-miR-196b-5p, and rno-miR-3552, were upregulated, while only rno-mir-194-1 was downregulated in the MCAO group compared with the sham group. [score:6]
[1 to 20 of 1 sentences]
17
[+] score: 6
Another study revealed that the down-regulation of miR-383 is associated with male infertility and testicular germ cell tumors through its targeting of IRF1 [33]. [score:6]
[1 to 20 of 1 sentences]
18
[+] score: 5
In addition to a random sequence, miR-29b, miR-150, and miR-383 were employed as negative controls. [score:1]
We therefore chose miR-29b, miR-150, and miR-383, which have putative binding sites on the 3′-UTR of VEGF but do not have putative binding sites on Construct I or II, as predicted by all of the three algorithms, to test the specificity. [score:1]
As we expected, miR-29b, miR-150, and miR-383 did not show repressive effects on Construct I or II. [score:1]
All three of these miRNAs have putative binding sites predicted by one at least of the three algorithms on the 3′UTR of VEGF but miR-29b and miR-150 do not have binding sites on Construct I, and miR-29b and miR-383 have no binding sites on Construct II. [score:1]
In addition to a random sequence (NC), miR-29, miR-150, and miR-383 which have putative binding sites in the 3′-UTR of VEGF but not on Construct I or II, as predicted by all of the algorithms, were employed as negative controls. [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 5
miR-383 is associated with male infertility and promotes testicular embryonal carcinoma cell proliferation by acting as a negative regulator of proliferation by targeting IRF-1 (Interferon regulatory factor 1) [13]. [score:5]
[1 to 20 of 1 sentences]
20
[+] score: 4
Our miRNA profile (84) Chromosomal localization Fold change Reference DOWNREGULATED hsa-miR-206 6p12.2 −7.53(29) hsa-miR-219-2-3p 9q33.3 −6.64(52) hsa-miR-383 8p22 −6.56(12, 55, 56) hsa-miR-138 16q13.3/3p21.32 −5.16(12, 14) hsa-miR-323-3p 14q32.2 −4.96(12, 52) hsa-miR-122 18q21.31 −4.82 hsa-miR-105 Xq28 −4.66 hsa-miR-129-5p 11p11.2/7q32.1 −4.56(23) hsa-miR-935 19q13.43 −4.53(52) hsa-miR-329 14q32.2 −4.48 hsa-miR-129-3p 11p11.2/7q32.1 −4.43 hsa-miR-650 22q11.21 −4.19 hsa-miR-184 15q24.3 −4.14 hsa-miR-370 14q32.2 −3.99(12) hsa-miR-433 14q32.2 −3.96(29) hsa-miR-138-2* 16q13. [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 3
Of these, 5 miRNAs (miR-137, miR-214-3p, miR-301a-3p, miR-330-3p and miR-383-5p) affect all four categories, linking them strongly to leukemia pathogenesis and highlighting their potential as therapeutic targets. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
But the change of miR-383 expression was not statistically significant (Figure 1C). [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
Most of the changed microRNAs are involved in development (especially in the embryonic development) and some examples of them are miRNA-222, miRNA-383, miRNA-126, miRNA-133, miRNA-30, miRNA-10a, miRNA-196 and miRNA-18b. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Mir-21, mir-34c and mir-221/222 control self-renewal of undifferentiated spermatogonia [19], Mirc1, Mirc3 and Mirlet7 regulate spermatogonial differentiation [9], [20], mir-15a and mir-184 mediate differentiation of spermatocytes [18], [19], miR-18, miR-34b, miR-34c, miR-184, miR-383, miR-449 and miR-469 mediate meiotic division of spermatocytes to spermatids [21], [23]– [25] and miR-469, miR-34c regulate differentiation of spermatid to form spermatozoa [24], [25]. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
A proliferation-inducing ligand (APRIL), a member of the tumor necrosis factor (TNF) superfamily, is a newly discovered target of miR-383, contributing to tumor apoptosis [44]. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 2
Moreover, miR-383–5p expression was decreased by the OO diet compared with SO, FO, LO, and PO diets. [score:2]
[1 to 20 of 1 sentences]
27
[+] score: 2
MiR-383 promotes steroidogenesis by targeting RBMS1 via the inactivation of c-Myc [19]. [score:2]
[1 to 20 of 1 sentences]
28
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
In mammals, miR-383 regulates 17β-estradiol release from granulosa cells (Yin et al. 2012). [score:2]
[1 to 20 of 1 sentences]
29
[+] score: 1
We identified 4 central hub miRNAs (hsa-mir-130b, hsa-mir-636, hsa-mir-383, hsa-mir-129-5p) and 2 hub genes (CEBPB, and FEZ1) (Fig.   3). [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
In the Hh signalling pathway, we detected mir-495 and mir-383 for Gas1 and mir-654-5P for Gli3. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
These two FSHD1 fetal muscle biopsies share 11 miRNAs with similar modulations (Fig. 4), miR-1225–3p, miR-19b-1*, miR-208b, miR-22, miR-372, miR-383, miR-767–3p, miR-802, miR-872, miR-875–5p, and miR-892b. [score:1]
[1 to 20 of 1 sentences]