sort by

185 publications mentioning mmu-mir-223 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-223. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 392
When NB4 cells were induced with retinoic acid to differentiation, miR-223 was greatly up-regulated, but IGF-1R down regulated, which suggested that IGF-1R acted as the target. [score:7]
When we inhibited miR-223 with synthetic sponge inhibitor, miR-223 lost its inhibitory function and the Renilla luciferase activities of IGF-1R 3′UTR reporter returned to the level similar to control group. [score:7]
We also noted that re -expression of IGF-1R in miR-223 group could abolish the inhibition effect of miR-223 and reversed the inhibition of IGF-1R -mediated downstream Akt/mTOR/p70S6K signal pathway. [score:7]
However, ERK1/2 was down-regulated not only at total protein level, but also at phosphorylation level in miR-223 group as compared with the group, which indicated that ERK pathway was inhibited although Rasa1 was targeted. [score:7]
However, ERK1/2 was down-regulated not only at the total protein level, but also at phosphorylation level in miR-223 group as compared with EV group (Fig. 7-B) which indicated that ERK pathway was inhibited even though Rasa1 was targeted. [score:7]
In order to find out the mechanisms and target mRNAs that were responsible for the suppressive function of miR-223, we detected several putative targets of miR-223 including FBXW7, LMO2, STMN1, Mef 2C, NF1A and found that all their mRNA levels changed slightly. [score:7]
MiR-223 suppression of IGF-1R expression could be reversed by adding exogenous miR-223 inhibitor at the final concentration of 50 nM (p<0.01) (Fig. 3-F). [score:7]
Rasa1 was predicted by Targetscan 5.1 as a target of miR-223 and indeed observed to be targeted by miR-223 in current study at both mRNA and protein levels (Fig. 7-A,B). [score:7]
Summary of miR-223 inhibiting tumor growth by targeting IGF-1R and suppressing the downstream Akt/mTOR/p70S6K signal pathway. [score:7]
Thus miR-223 might serve as a doubled-edge sword by targeting opposite functional targets, since one miRNA can target a dozen mRNAs which impact many molecules that are involved in different signal pathways. [score:7]
Therefore Rasa1 could not be the functional target of miR-223 because it failed to regulate ERK pathway after miR-223 targeting. [score:6]
Therefore Rasa1 could not be the functional target of miR-223 in this system because it failed to regulate ERK pathway after miR-223 targeting. [score:6]
The expression of IGF-1R was successfully knocked down (Fig. 5-A) by IGF-1R-sh through transient transfection, and this led to a similar suppression of the cell growth as miR-223. [score:6]
Knockdown of IGF-1R not only decreased cell viability (Fig. 5-B), but also inhibited the PI3K/Akt/mTOR/p70S6K signal pathway (Fig. 5-C) mentioned above, which was quite similar to the inhibition by miR-223. [score:6]
These results strongly indicated that the wild type 3′UTR of IGF-1R interacted with miR-223 and was suppressed at both transcription and translation stages. [score:5]
However, IGF-1R could be the functional target of miR-223, which was responsible for the inhibition of cell growth. [score:5]
The expression of the reporter containing IGF-1R 3′UTR was suppressed by miR-223, but not in the mutated construct. [score:5]
Overexpression of miR-223 suppressed HeLa cell growth. [score:5]
As miR-223 suppressed IGF-1R expression, the next question that needed to uncover was whether the IGF-1R -mediated downstream signal pathway was also impacted by miR-223. [score:5]
Inhibition of miR-223 abolished the suppression of miR-223 on IGF-1R 3′UTR at a final concentration of 50 nM. [score:5]
Our results thus far demonstrate that miR-223 suppressed IGF-1R in both mRNA and protein levels, and subsequently suppressed the downstream Akt/mTOR/p70S6K signal pathway. [score:5]
In SMMC-7721, BEL-7404, or Huh-7 hepatoma cells infected with miR-223 constructs, all the cell growth rates slowed down (Fig. 8-E) and the expression level of IGF-1R was significantly inhibited (Fig. 8-F,G). [score:5]
The expression of Rasa1 was suppressed by miR-223, but the mutant couldn't. [score:5]
The inhibitor of miR-223 abolished the suppression of miR-223 on Rasa1 at a final concentration of 50 nM. [score:5]
Transfection with miR-223 in NB4 cells also led to significant inhibition of IGF-1R mRNA and protein expression (p<0.05) (Fig. 8-C,D) and the cell growth (Fig. 8-E). [score:5]
In hepatoma cells (SMMC-7721, BEL-7404, or Huh-7) IGF-1R also served as the common target when miR-223 inhibited the cell growth. [score:5]
In the present study, miR-223 suppressed IGF-1R and its signaling and acted as a tumor suppressor. [score:5]
The inhibition of Akt/mTOR/p70S6K was reversed by re -expression of IGF-1R (IGF-1R rescued) in miR-223 group. [score:5]
In summary (Fig. 9), we established a miR-223 overexpression mo del by using lentivirus delivery system and observed that miR-223 suppressed the proliferation of tumor cells both in vivo and in vitro. [score:5]
In this study, we established a miR-223 over -expression mo del and observed miR-223 suppression of cell growth, colony formation in vitro, and the tumorigenesis in vivo. [score:5]
To further investigate the mechanism of miR-223 inhibition of tumorigenicity and proliferation of HeLa cells, we searched for potential targets by using the prediction algorithm of Targetscan 5.1, 9 molecules including POLE3, POLR3G, FBXW7, IGF-1R, p70S6K, Rasa1, Fox O1, Fox O3 and Cdc27 were selected. [score:5]
These results strongly indicated that miR-223 suppressed of Akt/mTOR/p70S6K pathway is by targeting IGF-1R. [score:5]
Third, both mRNA and protein of IGF-1R were down regulated in miR-223 group as compared with EV group, but transfection with IGF-1R cDNA without 3′UTR sequence overcome the inhibition by miR-223 and rescued the expression of IGF-1R. [score:5]
Both precursor and mature IGF-1R (2 bands) were suppressed after miR-223 overexpression. [score:5]
On the other hand, miR-223 is significantly up-regulated in bladder cancers [15], recurrent ovarian cancer [16] and increases cyclin E protein and activity levels, and elevates genomic instability [23]. [score:4]
In hepatocellular carcinoma cells (HCC) miR-223 was repressed as compared with normal liver tissue by microarrays [17] and STMN1 was the potential target which serves as an oncogene implicating that miR-223 may serve as a tumor suppressor [18]. [score:4]
Further, knockdown of IGF-1R by shRNA could induce similar inhibitory effects with miR-223 on IGF-1R and Akt/mTOR/p70S6K signal pathway. [score:4]
It was also reported that miR-223 was significantly up-regulated in bladder cancer [15] and recurrent ovarian cancer [16]. [score:4]
The regulation of miR-223 relied on the pathway triggered by the target. [score:4]
In this mo del, miR-223 targeted IGF-1R and its downstream signal pathway, which exerted a major function in tumor cell growth regulation. [score:4]
These results suggest that miR-223 functioned as a negative regulator or tumor suppressor for the cell growth, which is consistent with the role of miR-223 in HCC [18]. [score:4]
N = 6. (F) IGF-1R expression was measured by quantitative PCR and was down-regulated in both SMMC-7721 and BEL-7404 cells infected with miR-223 construct. [score:4]
The expression level of IGF-1R was also examined and down regulated in miR-223 group. [score:4]
In the tumor tissues at xenograft nude mice, the expression of IGF-1R was also suppressed in miR-223 group as compared with EV group (Fig. 3-H). [score:4]
IGF-1R was directly targeted by miR-223. [score:4]
Knockdown of IGF-1R mimicked miR-223 inhibition. [score:4]
Both phosphorylation and total protein levels were reduced and the results were similar to the inhibition miR-223. [score:3]
The expression of miR-223 in miR-223 group was up-regulated 7.19 folds after sorting as compared with EV group, which was confirmed by both semi-quantitative RT-PCR (reverse transcription polymerase chain reaction) and quantitative PCR (Fig. 1-D, E) besides the fluorescent measurement. [score:3]
In NB4 cells, promyelocytic leukemia cells, which were treated with retinoic acid, the expression level of miR-223 increased abruptly (Fig. 8-A, left panel, p<0.05). [score:3]
These results suggested that miR-223 suppressed the proliferation of HeLa cells both in vitro and in vivo. [score:3]
MiR-223 acts as “a fine-tuner” of granulocytic differentiation and maturation [7] and promotes granulocytic differentiation in acute promyelocytic leukemia (APL) cells treated with retinoic acid (RA) which can induce up-regulation of C/EBPα (CCAAT-enhancer -binding proteins α). [score:3]
Lentivirus -mediated miR-223 over -expression in HeLa cells. [score:3]
To further demonstrate that IGF-1R targeting by miR-223 is sufficient to effect the reduced cell proliferation phenotype, we performed a loss-of-function experiment by transfection of IGF-1R-sh carried by plasmid p Silencer 4.1CMV-puro into HeLa cells. [score:3]
This result suggested that miR-223 targeted IGF-1R not only in HeLa cells, but also in leukemia and hepatoma cells. [score:3]
Quantitative PCR analysis of the mRNA expression levels of FBXW7 (A), LMO2, Mef 2C and STMN1 (B), NF1A (C) in EV and miR-223 groups. [score:3]
Transfection with IGF-1R cDNA(complementary DNA) could totally overcome the suppression caused by miR-223 (Fig. 3-B) since the construct contained no 3′UTR. [score:3]
C/EBP αcan further compete with NF1A and promote miR-223 expression [5], [6]. [score:3]
The mutated psi CHECK™-2-IGF-1R 3′UTR was also transfected under the same condition, and the miR-223 inhibitor and its control were used at the final concentration of 50 nM to measure the inhibitory effect of miR-223 on the 3′UTR of IGF-1R. [score:3]
By re -expression of IGF-1R, the growth rate of miR-223 group that was transfected with IGF-1R rose after 48 hours and reached to 1.98 folds as much as the group of miR-223 at the time point of 72 hours post transfection (Fig. 3-G). [score:3]
First, IGF-1R 3̀UTR reporter experiment showed a significant decrease in luciferase activity after miR-223 over -expression. [score:3]
Over -expression of miR-223 in HeLa cells. [score:3]
It was through IGF-1R and its downstream signal pathway that miR-223 suppressed the cell growth. [score:3]
Indeed several other molecules including Rasa1 were also observed to be targeted by miR-223 in current study at both mRNA and protein levels. [score:3]
High expression of miR-223 (left panel) was confirmed by quantitative PCR. [score:3]
IGF-1R was the major mRNA among the miR-223 targets in our study. [score:3]
The luciferase reporter assay did show that the 3′UTR of Rasa1 gene was targeted by miR-223 directly. [score:3]
Therefore Lentivirus vector pLL3.7 was used in this study to establish miR-223 over -expression. [score:3]
0027008.g008 Figure 8(A) NB4 cells were treated with 1 µmol/L retinoic acid for 48h and the expression level of miR-223 was determined by quantitative PCR (left panel). [score:3]
To confirm that, we cloned the 3′UTR of IGF-1R into the site directly downstream of the luciferase reporter gene in psi- CHECK™-2 and constructed the three nucleotide mutation within the region that miR-223 seed sequence potentially bound with (Fig. 3-E). [score:3]
To investigate IGF-1R as the general target of miRNA-223, miR-223 targeting IGF-1R was further studied in several other tumor cell lines. [score:3]
Interference of IGF-1R mimicked the suppression of growth and Akt/mTOR/p70S6K signal pathway by miR-223. [score:3]
Screen results by quantitative PCR suggested that the expression of POLE3, POLR3G, FBXW7, Mef 2C, LMO2, NF1A and STMN1 did not reduce significantly in miR-223 group although the examination was at mRNA levels. [score:3]
The sorted miR-223-infected HeLa cells were then used as the stable miR-223 overexpression mo del. [score:3]
IGF-1R was targeted by miR-223. [score:3]
After infection of HeLa cells with either EV(Empty Virus Vector) (Fig. 1-B, left) or pLL3.7-miR-223 (right), the infected cells were screened and sorted by a FACS machine based on the expression of GFP which indicated the presence of the plasmids pLL3.7-miR-223 or the EV (Fig. 1-C). [score:3]
0027008.g004 Figure 4(A): The Akt/mTOR/p70S6K pathway downstream of IGF-1R were suppressed in miR-223 group. [score:3]
The luciferase reporter assay did show that the 3′UTR of Rasa1 mRNA was targeted by miR-223 directly (Fig. 7-C). [score:3]
However, we observed that IGF-1R was strongly targeted by miR-223. [score:3]
The expression of miR-223 was then reported to promote granulocytic differentiation [8]. [score:3]
MiR-223 suppressed IGF-1R -mediated Akt/mTOR/p70S6K signal pathway. [score:2]
miR-223 regulated IGF-1R in other tumor cells. [score:2]
MiR-223 suppression of HeLa cell proliferation. [score:2]
We found that the relative luciferase activity of the reporter that contained wild-type 3′UTR of IGF-1R was significantly suppressed in miR-223 group as compared with EV group (p<0.01) (Fig. 3-F). [score:2]
However, the relative luciferase activity of the mutant IGF-1R 3′UTR reporter construct with 3 nucleotide mutation within the putative seed sequence (226-228bp in IGF-1R 3′UTR) (Fig. 3-E) was almost at the same level as the control psi- CHECK™-2 group and failed to respond to miR-223 (Fig. 3-F). [score:2]
Furthermore, IGF-1R was also down regulated in NB4 (promyelocytic leukemia) cells infected with miR-223. [score:2]
MiR-223 inhibition of Akt/mTOR/p70S6K signal pathway. [score:2]
Original magnification 10× (D,E) Mir-223 was over-expressed in HeLa cells and confirmed by both stem-loop RT-PCR (D) and quantitative PCR (E). [score:2]
Although miR-223 was thought to promote differentiation, some documents reported that miR-223 negatively regulates granulocyte differentiation in miR-223 [-/Y] transgenic mice [14]. [score:2]
Two pairs of primers (IGF-1R-1 and IGF-1R-2) designed at different positions of IGF-1R produced similar results showing suppression caused by miR-223. [score:2]
Second, mutation of three nucleotides of IGF-1R 3′UTR within miR-223 seed sequence binding site abolished the response to miR-223. [score:2]
The signaling pathway of mTOR is important in miR-223 regulation of cell growth, which is consistent with the previous bioinformatics prediction [16]. [score:2]
To construct the lentivirus vector pLL 3.7-miR-223 which expressed miR-223, a fragment encoding the pre-miR-223 sequence plus 110bp at both 5′- and 3′-flanking regions (chrX:65238602-65238931, from UCSC web site) was amplified with the primers 5′CCGGTTAACCTGGCAGTCCATTCGTCA3′and 5′CCGCTCGAGCCTCTAGGGTCACATCTCC3′ by PCR from NB4 cell genomic DNA and then cloned into the Hpa I/Xho l sites of pLL 3.7 vector. [score:2]
5×10 [6] miR-223 or EV-infected HeLa single cell suspensions in 150 µl sterile PBS were injected subcutaneously to the skin under the front legs of the mouse. [score:1]
In this study, we investigated the roles of miR-223 in cell growth and sought for the mechanism by which the inhibition of cell growth by miR-223 is mediated. [score:1]
Original magnification 100× (C) NB4 cells were infected with miR-223 construct. [score:1]
MicroRNA-223 (miR-223) was identified bioinformatically and subsequently characterized in the hematopoietic system, where it is mainly expressed in the myeloid, granulocytic, and monocytic compartments [3], [4], but not in B and T lymphocytes. [score:1]
Mature IGF-1R appeared at 2 bands which might be due to different modifications, but reduced together in miR-223 group. [score:1]
MiR-223 regulation of IGF-1R in leukemia and hepatoma cells. [score:1]
The bottom panel shows the GFP signal carried by the pLL3.7 vector under a fluorescent microscope and indicated the formation of tumor caused by either miR-223 or EV-infected HeLa cells. [score:1]
In this study, we investigated and found that PI3K/Akt/mTOR/p70S6K signal pathway was suppressed by miR-223 (Fig. 4-A). [score:1]
Packaging of virus was performed by co-transfection of three plasmids and the efficiency was about 70% (Fig. 1-A) according to GFP (green fluorescent protein) signal that was carried by pLL3.7 vector or pLL3.7-miR-223. [score:1]
The number of colonies, which were defined as more than 50 cells which derived from a single cell, in miR-223 group was greatly repressed to 43.72% of the control and the difference of the colony number between the two groups reached significance (p<0.01) (Fig. 2-B,C). [score:1]
EV group stood for vector control at the left and pLL3.7-miR-223 infection group was at the right. [score:1]
The functions of miR-223 in previous reports were not clear or somewhat contradicted in both hematopoietic and non-hematopoietic systems. [score:1]
0027008.g001 Figure 1 (A) Lentivirus vector pLL3.7-miR-223 was packaged in HEK-293T cells which was less 20 generations. [score:1]
The fluorescence -positive cells were collected in either EV control (left) or miR-223 (right) group. [score:1]
HeLa cells was infected with either pLL3.7(EV) or pLL3.7-miR-223 in the presence of 8 µg/ml polybrene (Sigma-Aldrich, St. [score:1]
In blank group, PBS replaced the first antibody in either EV or miR-223 group. [score:1]
NV: no virus control, EV: empty virus vector control, Input: positive mature miR-223. [score:1]
However, the detailed mechanisms of miR-223 in differentiation or tumor progression still remain unclear. [score:1]
The Lentivirus -mediated miR-223 packaging system contained three plasmids pLL3.7 or pLL3.7-miR-223, Δ8.9 and Vsvg at the ratio of 4∶3∶2 in quantity. [score:1]
The average tumor weight of miR-223 group was significantly less than control (p<0.05, Fig. 2-E). [score:1]
To further confirm the above findings, an in vivo mo del was carried out by subcutaneous injection of 5×10 [6] EV or miR-223-infected cells into the mouse skin under the front right or left legs respectively. [score:1]
In miR-223 group, the signal of IGF-1R staining was significantly weaker than that in EV group. [score:1]
We referred to the infected cells by either miR-223 or EV as miR-223 or EV groups respectively, in the following experiments. [score:1]
Wild type and three nucleotides mutated within IGF-1R 3′UTR were cloned into the reporter based on the predicted binding site in the 3′UTR of IGF-1R with miR-223 seed sequence. [score:1]
The miR-223 locus is located on the X chromosome and is transcribed independently of any known genes [5], [6]. [score:1]
[1 to 20 of 117 sentences]
2
[+] score: 371
Given our observation of significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in cells treated with 3.5 mM Pi, we used RT-qPCR to determine the expression levels of representative VSMC phenotypic marker genes - most of which are targeted by these miRNAs [8], [10]. [score:11]
Elevated Pi significantly downregulates expression of miR-143 and miR-145 and upregulates miR-223. [score:9]
miR-223 upregulation modulates the expression of target proteins mef2c and Rhob. [score:8]
To complement these in vitro findings, we also observed significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in aorta samples collected from ApoE knock-out mice, which display vascular calcification. [score:8]
We also found that NFIA, an experimentally validated miR-223 specific target known to be expressed in VSMCs [33] was significantly downregulated at both messenger and protein levels in the presence of high Pi concentrations. [score:8]
On the other hand, we show in our study that miR-223 upregulation affects the expression of two other recently described miR-223 targets, Mef2C [19]– [20] and RhoB [21]. [score:8]
To upregulate and knock-down the expression of miR-223, VSMCs were transfected for 48 h with pre-miR-223 and anti-miR-223, respectively. [score:7]
0047807.g004 Figure 4 To upregulate and knock-down the expression of miR-223, VSMCs were transfected using pre-miR-223 and anti-miR-223, respectively. [score:7]
To up-regulate and knock-down the expression of miR-223, VSMCs were transfected for 48 h with pre-miR223 and anti-miR-223, respectively. [score:7]
We also show that modulating the expression of miR-223 affects the expression of its reported targets Mef2c and RhoB in our in vitro mo del. [score:7]
Evidence from our studies suggests that Pi alters cell proliferation and migration, reduces the amount of the actin cytoskeleton, downregulates miR-143 and miR-145 and upregulates miR-223. [score:7]
0047807.g005 Figure 5To up-regulate and knock-down the expression of miR-223, VSMCs were transfected for 48 h with pre-miR223 and anti-miR-223, respectively. [score:7]
0047807.g003 Figure 3 To upregulate and knock-down the expression of miR-223, VSMCs were transfected for 48 h with pre-miR-223 and anti-miR-223, respectively. [score:7]
There was significant downregulation of miR-143 and miR-145 and concomitant upregulation of miR-223 in 20-week-old ApoE- KO mice. [score:7]
To upregulate and knock-down the expression of miR-223, VSMCs were transfected using pre-miR-223 and anti-miR-223, respectively. [score:7]
Interestingly, miR-223 upregulation induced a significant downregulation of SMαA mRNA and a mild increase in Serum Response Factor (SRF) mRNA but did not significantly affect other marker genes. [score:7]
miR-143 and miR-145 are downregulated and miR-223 is upregulated in ApoE- KO mice. [score:7]
Our in vivo results in a well-established murine mo del thus reflected our in vitro findings, i. e. downregulation of miR-143 and miR-145 and upregulation of miR-223 in the presence of calcium-Pi deposits. [score:7]
Additionally, we found that the expression of two of the known miR-223 targets, Mef2c and RhoB, was highly reduced in Pi treated as well as miR-223 over -expressing VSMCs. [score:7]
Effect of miR-223 up- and downregulation on VSMC proliferation, cytoskeleton size and marker gene expression. [score:6]
Two independent studies have validated that miR-223 directly targets and inhibits Mef2c mRNA [19]– [20]. [score:6]
Accelerated migration, a less structured and decreased actin cytoskeleton in the presence of high Pi, and a modulation of target genes Mef2c and RhoB could be linked (at least in part) to upregulation of miR-223. [score:6]
A key finding of our study was that miR-223 (which is conventionally associated with carcinogenesis [25]– [26]but is also a newly described marker of skeletal and cardiac muscle damage [11]– [12] is expressed in VSMCs and is strongly upregulated in calcifying VSMCs and in calcified aortas from ApoE- KO mice. [score:6]
Interestingly, we also found that miR-223 (a marker of muscle damage and a key factor in osteoclast differentiation) is expressed in VSMCs and is significantly upregulated in Pi -treated cells. [score:6]
Lastly, we detected the upregulation of miR-223 expression in vivo, in aorta collected from ApoE- KO mice (a well-established mo del of atherosclerosis and vascular calcification, displaying Ca*Pi [3]). [score:6]
Here, we found that miR-223 was expressed in smooth muscle and that its upregulation is a potential marker of VSMC damage. [score:6]
Cells were collected and processed for further analysis after 48 h. Figure S7 shows that VSMCs transfected with pre-mir-223 or anti-mir-223 significantly up-regulated or reduced the expression of miR-223, respectively. [score:6]
Furthermore, we detected downregulation of SMαA at both the mRNA and protein levels during overexpression of miR-223. [score:6]
Surprisingly, up- or downregulating miR-223 in VSMCs did not alter NFIA expression (data not shown). [score:6]
Nuclear factor IA (NFIA, an experimentally validated miR-223 target [13]) appeared to be downregulated in cells treated with 3.5 mM Pi, as expected (given the increase in miR-223). [score:6]
Similarly, we saw significant downregulation of MYO (which is involved in cell migration and proliferation [8]– [10] when miR-223 was over-expressed. [score:6]
However, impressively, in Pi treated cells, the expression of miR-223 increased dramatically and the relative expression increased up to 700% fold. [score:5]
Additionally, we normalized the expression of miR-223 to the expression of the VSMC-specific miR-143 (Figure S3). [score:5]
Finally, we show strong reduction in the expression of two of miR-223 targets, Mef2c and RhoB, which have established roles in VSMC biology. [score:5]
In Figure S6, we show that, as previously described in Figure 3, mir-223 overexpression increases VSMC migration, mir-223 inhibition decreases VSMC migration, and high Pi treatment (3.5 mM) increases VSMC migration. [score:5]
Figure S2 miR-223 is expressed in VSMCs, and its expression is increased by high Pi. [score:5]
Moreover, quantitative real-time PCR evidenced strong (4-fold) upregulation of miR-223 in Pi -treated cells (Figure 1E); this finding was confirmed by in situ Hybridization (ISH) (Figure S2). [score:4]
Like with Mef2c, miR-223 upregulation significantly decreased the amount of mRNA (of approximately 90%, Figure 5A) with a concomitant decrease of the RhoB protein (of approximately 40%, Figure 5B and C). [score:4]
Accordingly, in our mo del, miR-223 upregulation induced a strong and significant decrease of Mef2c mRNA (of approximately 80%, Figure 5A) and a concomitant decrease of the protein product, as evidenced by immunofluorescence protein staining (of approximately 35%, Figure 5B and C). [score:4]
On the other hand, miR-223 knock-down had no effect on the expression of these markers. [score:4]
Despite consulting several databases, we did not find any binding sites for miR-223 on SMαA, MYO or SRF mRNAs; this argues in favour of an indirect effect of miR-223 on expression of these species. [score:4]
Effect of miR-223 up- and down regulation and Pi on miR-223 specific targets Mef2c and RhoB. [score:4]
Up-regulation of miR-223 further enhances VSMC migration and reduces the amount of actin cytoskeleton. [score:4]
We found that upregulating miR-223 in VSMCs induces a significant increase in cell proliferation and migration and reduces the amount of the actin cytoskeleton. [score:4]
We also looked at the effect of miR-223 regulation on another recently described miR-223 target, RhoB [21]. [score:4]
One of our study's most important findings was the upregulation of miR-223 in VSMCs treated with high levels of Pi and in ApoE- KO mice displaying vascular calcification. [score:4]
Over -expressing miR-223 in VSMCs increased proliferation and markedly enhanced VSMC migration. [score:3]
RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
Our results suggest that (i) high levels of Pi increase VSMC migration and calcification, (ii) altered expression levels of miR-223 could play a part in this process and (iii) miR-223 is a potential new biomarker of VSMC damage. [score:3]
Figure S3 Expression of miR-223 relative to miR-143 in control or Pi treated VSMCs. [score:3]
In contrast, significantly greater expression of miR-223 (1.6-fold) was observed in older, 20-week-old ApoE- KO mice (which displayed vascular calcification), relative to WT mice (Figure 5B). [score:3]
This strongly argues against a direct regulation of NFIA mRNA by miR-223 in our mo del. [score:3]
We also determined the effect of Pi on expression levels of the osteogenesis marker miR-223 [13], which is also a newly described marker of muscle damage [11], [12]. [score:3]
We attempted to determine miR-223′s role in VSMC biology and showed that overexpressing this species increased VSMC proliferation. [score:3]
Figure S7 Effect of pre-miR-223 and anti-miR-223 on expression of miR-143 and miR-223 in VSMCs. [score:3]
Interestingly, high Pi attenuates the effect of miR-223 inhibition on migration, and the levels of the combination of both treatments are comparable to control levels, ie high Pi neutralizes the effect of anti-miR-223. [score:3]
In the present study, we used two independent techniques to show that miR-223 over -expression had a significant impact on VSMC migration. [score:3]
This was further confirmed by immunofluorescence protein staining, which clearly showed a very low level of SMαA and MYO and a high level of SRF when miR-223 was over-expressed in VSMCs (Figure 4D-E). [score:3]
Vascular smooth muscle cells transfected with pre-miR (over -expression) and anti-miR (knock-down) specific for miR-143 and miR-223 were compared with a scrambled RNA control (Figure 3A). [score:3]
0047807.g006 Figure 6 RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
To the best of our knowledge, this is the first report of expression of miR-223 in VSMCs (Figure 1E and Figure S2). [score:3]
This indicates that anti-miR-223 and high Pi neutralize each other's effect on both VSMC migration and SMαA expression (data not shown). [score:3]
Over -expression of miR-223 enhances VSMC migration. [score:3]
Figure S6 Effect of a combination of over -expression of miR-223 and high Pi on VSMC migration. [score:3]
Expression of miR-143, miR-145 and miR-223 in wild-type and ApoE- KO mice. [score:3]
Again, this agrees with studies correlating miR-223 over -expression with increased tumour cell migration [20], [26]. [score:3]
The relative expression of miR-223 compared to miR-143 at basal level, i. e. in control cells is approximately 1000 times lower than the VSMC specific miR-143. [score:2]
We next looked at the effect of miR-223 regulation on several VSMC marker genes (Figure 4C). [score:2]
We next investigated the effect of miR-223 regulation on reported targets Mef2c and RhoB. [score:2]
Relative to control experiments, over -expression of miR-223 significantly increased the metabolic activity of VSMCs (by 17%, according to the WST-1 assay). [score:2]
However, miR-223 knock-down had no effect (Figure 4A). [score:2]
We found similar results (a 25% increase) for miR-223 upregulation in the BrdU assay, which measures DNA synthesis and thus VSMC proliferation. [score:1]
Pre-miR-223 induced a highly significant 64% increase in cell migration. [score:1]
Cells were transfected for 48 h with pre-miR-223/anti-miR-223 or treated with Pi for 10 days. [score:1]
To the best of our knowledge, ours is the first report of an effect of miR-223 on migration in normal (i. e. non-tumor) cells. [score:1]
Accordingly, anti-miR-223 treatment was associated with significantly (28%) lower migration (Figure 3A). [score:1]
Our results suggest that miR-143, miR-145 and miR-223 are potential biomarkers of vascular calcification. [score:1]
We thus evidenced a significant impact of miR-223 on VSMC migration. [score:1]
Lastly, we sought to study the fate of miR-143, miR-145 and miR-223 under in vivo vascular calcification conditions. [score:1]
The resulting increase in miR-223 could be a compensatory mechanism for alleviating (at least in part) the cellular damage. [score:1]
miR-223 was first described as a myeloid-specific miRNA [12] and as a biological marker for several tumoral processes [25]– [26]. [score:1]
miR-223 increases VSMC migration and proliferation and decreases the amount of actin cytoskeleton. [score:1]
This independent and complementary technique yielded similar results after 5 h of migration: pre-miR-223 was associated with significantly greater (75%) cell migration, vs. [score:1]
First, VSMCs were seeded in 6-well culture plates (Corning) and transfected with irrelevant scramble, anti-miR-223/143 or pre-miR-223/143 ((Applied Biosystems). [score:1]
Indeed, increased levels of miR-223 have been reported in damaged skeletal muscle (in Duchenne muscular dystrophy [11]) and in cardiomyocytes [12]). [score:1]
Furthermore, anti-miR-223 treatment was associated with a VSMC migration rate that was 33% lower than for controls (Figure 3B). [score:1]
We also highlighted (for the first time) a potential role for miR-223 in these conditions. [score:1]
As in the Mef2c experiments, anti-miR-223 treatment had no detectable effect. [score:1]
This is suggestive of the role of miR-223 in VSMC calcification. [score:1]
– an observation that fits well with miR-223′s known involvement in many tumoral processes [25]– [26]. [score:1]
Furthermore, miR-223 has been linked to osteogenesis and calcium-phosphate deposits(Ca*Pi) [13]. [score:1]
Our results thus suggest that miR-223 has a role in the VSMCs' complex response to Pi. [score:1]
[1 to 20 of 92 sentences]
3
[+] score: 365
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-155, mmu-mir-146b
From the work presented here, we can now appreciate that the expression of IL-6 in response to LPS or poly (I∶C) initiates a positive feedback loop in which secreted IL-6 down-regulated miR-223 expression, leading secondarily to an increase in STAT3, which then drives the expression of IL-6 and IL-1β in a positive regulatory loop. [score:11]
Figure S3 The down-regulation of miR-223 expression in peritoneal macrophages upon the stimulation of IL-6. Mouse peritoneal macrophages were treated with IL-6 at a final concentration of 10 ng/ml for the indicated time points, the expression of miR-223 was determined by qPCR and normalized to the expression of U6 in each sample. [score:10]
In the present study, we found that IL-6 appears to not only activate transcription of STAT3 gene, but also to down-regulate miR-223 expression and, consequently, relieve the miR-223 -mediated translational suppression of STAT3. [score:10]
However, no significant change in STAT3 mRNA level was found between the control cells and the cells treated with miR-223 mimics or antagomirs at 12 h post-LPS stimulation (Fig. 5E), suggesting that STAT3 expression could be inhibited by miR-223 via translational inhibition but not mRNA degradation. [score:9]
Thus, it is likely that an increase in IL-6 production during LPS or poly (I∶C) stimulation serves two purposes: first, it directly activates STAT3 transcription through an IL-6 response element (IL-6RE) in the STAT3 gene promoter [27]; and second, it provides additional signals to down-regulate miR-223 expression, thus serving as a posttranscriptional gene regulation mechanism. [score:8]
MiR-223 overexpression down-regulates IL-6 and IL-1β, but not TNF-α, expression levels in TLR-activated macrophages. [score:7]
This result suggested that the endogenous down-regulated miR-223 might be responsible for the up-regulation of luciferase activity. [score:7]
Taken together, these results suggested that miR-223 can regulate STAT3 protein expression and that it is at least partially responsible for the increase in STAT3 protein expression observed in macrophages during stimulation by LPS. [score:6]
Conversely, increases in IL-6 and IL-1β expression were observed in RAW264.7 cells treated with anti-miR-223 (Fig. 2C, D and Fig. 3D–F), suggesting that LPS- or poly (I∶C) -induced decrease of miR-223 expression may be involved in the regulation of IL-6 and IL-1β production. [score:6]
MiR-223 targets mouse STAT3 for translational inhibition but not mRNA degradation. [score:6]
In addition, transfection with miR-223 mimics significantly down-regulated STAT3 protein expression in RAW264.7 cells, while an increase in STAT3 protein level was shown in RAW264.7 cells treated with miR-223 antagomirs (Fig. 5D). [score:6]
This is also an important piece of evidence indicating that secreted IL-6 could down-regulate miR-223 expression after LPS stimulation. [score:6]
To further determine the functional significance of miR-223 down-regulation, RAW264.7 cells were transfected with miR-223 mimics to overexpress miR-223. [score:6]
IL-6 acts as a main factor responsible for the down-regulation of miR-223 expression. [score:6]
The use of IL-6 instead of LPS or poly (I∶C) induced a quicker down-regulation of miR-223 expression. [score:6]
Down-regulation of miR-223 expression in RAW264.7 cells and primary macrophages stimulated with TLR agonists. [score:6]
Similarly, the stimulation of IL-6 (10 ng/ml) also induced the down-regulation of miR-223 expression in primary peritoneal macrophages (Fig. S3). [score:6]
MiR-223 itself targets NFI-A, thereby turning off its repressor once it is expressed, forming a positive autoregulatory circuit [17]. [score:5]
IL-6 induces miR-223 down-regulation and promoted the augment and activation of STAT3, which in turn facilitates the production of IL-6 and IL-1β, thus forming a positive regulatory loop for the production of pro-inflammatory cytokines (Fig. 8I). [score:5]
And we demonstrated that miR-223 directly targets STAT3 to regulate the pro-inflammatory cytokines. [score:5]
To further demonstrate a more direct causal relationship between miR-223 and STAT3, we first transfected RAW264.7 cells with STAT3 siRNA to knock down STAT3 expression, then miR-223 mimics or controls were transfected 18 h later. [score:5]
In turn, IL-6, which is triggered by TLR stimulation, is responsible for the down-regulation of miR-223, thus forming a positive regulatory loop for pro-inflammatory cytokine production. [score:5]
MiR-223 mimics and control, miR-223 inhibitors and inhibitor control, STAT3 small interfering RNA (siRNA) and control siRNA were from GenePharma (Shanghai, China). [score:5]
Collectively, these data demonstrated, for the first time, a causal role for miR-223 for regulating IL-6 signal transduction by directly targeting STAT3 in augmenting TLR -driven inflammatory responses. [score:5]
The change in miR-223 expression was accompanied by a substantial increase in STAT3 protein expression. [score:5]
These data suggest that miR-223 regulates STAT3 expression in TLR-triggered macrophages, a process that may be associated with the regulation of inflammatory responses in macrophages during microbial infection. [score:5]
Collectively, these results suggested that the effect of miR-223 to inhibit IL-6 and IL-1β production, but not TNF-α, was dependent upon targeting of STAT3. [score:5]
MiR-223 was in the first cadre of miRNAs discovered to be highly expressed in myeloid cells of the bone marrow, where it is mainly expressed in the myeloid, granulocytic and monocytic compartments [15], [16]. [score:5]
Computational prediction via Targetsan 5.1 revealed that miR-223 was one of the non-conserved miRNAs that putatively target murine STAT3's 3′-UTR (Fig. 5A). [score:5]
The expression of miR-223 was determined by qPCR and normalized to the expression of U6. [score:5]
As shown in Fig. 8C, no decrease in miR-223 was detected in the presence of an IL-6-specific blocking antibody compared with an immunoglobulin G1 (IgG1) isotype-matched control antibody upon LPS challenge, suggesting that LPS -induced miR-223 down-regulation is dependent on IL-6. We also transfected RAW264.7 cells with STAT3 siRNA and then exposed them to LPS for the indicated time followed by q-PCR analysis of miR-223 expression. [score:5]
The down-regulation of miR-223 upon stimulation of multiple TLR agonists suggests that miR-223 may function as a regulator of TLR -associated signaling events in macrophages. [score:5]
Furthermore, forced expression of miR-223 was associated with a significant decrease in levels of STAT3 and a reduction in the production of IL-6 and IL-1β while miR-223 antagomirs exhibited a reverse effect in regulating IL-6 and IL-1β production. [score:4]
RAW264.7 cells transfected with miR-223 inhibitors showed increased STAT3 protein and phosphorylation level as compared to the cells transfected with inhibitor control (Fig. 4D). [score:4]
It showed that STAT3 knockdown resulted in less decreased miR-223 expression (Fig. 8D). [score:4]
In primary bone marrow-derived macrophages, a similar down-regulation pattern for miR-223 was observed (Fig. 1C–D). [score:4]
The down-regulation of miR-223 probably prevents macrophage hyperactivation yet primes the macrophage for certain responses to pro-inflammatory stimuli [20]. [score:4]
To elucidate the molecular mechanisms underlying the IL-6/miR-223/STAT3 axis -mediated regulation of TLR signaling, RAW264.7 were transfected with miR-223 mimics and treated with recombinant IL-6. IL-6 alone significantly induced STAT3 protein expression, up to the 24 h time point (Fig. 8E). [score:4]
Our initial observation of significant down-regulation of miR-223 in murine macrophages upon TLR ligand stimulation (e. g. LPS, poly (I∶C)) prompted us to study the potential effect of miR-223 on macrophage function. [score:4]
In cells of the granulocytic lineage, myeloid-specific miR-223 negatively regulates progenitor proliferation, granulocyte differentiation and activation by targeting Mef2c [19]. [score:4]
To further investigate the molecular mechanisms underlying the IL-6/miR-223/STAT3 axis -mediated regulation of TLR signaling, we pre -treated RAW264.7 cells with the IL-6 neutralization antibody and found it restored miR-223 expression and significantly diminished the LPS -induced increase in STAT3 expression. [score:4]
One of those miRNAs, miR-223, was slightly decreased at 4 h post-stimulation and was rapidly down-regulated during the next 4 h, reaching the minimum at 16 h to 24 h (Fig. 1A–B). [score:4]
IL-6 down-regulates miR-223 after TLR ligand activation. [score:4]
To verify whether the TLR-triggered IL-6 is required for miR-223 down-regulation, RAW264.7 cells were pretreated with an IL-6-specific blocking antibody following LPS stimulation. [score:4]
Expression of miR-223 is regulated by a combination of factors. [score:4]
In the present study, we reported that LPS or poly (I∶C) stimulation induced miR-223 down-regulation in a murine macrophage cell line and in primary macrophages. [score:4]
MiR-223 inhibits IL-6 mRNA expression but not TNF-α, in TLR-triggered macrophages. [score:4]
Additionally, miR-223 mimics significantly inhibited STAT3 augment and activation after IL-6 challenge, while an increase in STAT3 protein and phosphorylation level was observed in RAW264.7 cells treated with miR-223 antagomirs. [score:3]
Similarly, in primary peritoneal macrophages and bone marrow-derived macrophages stimulated with LPS, the miR-223 mimics markedly inhibited the production of IL-6 and IL-1β, but not TNF-α (Fig. S1). [score:3]
LPS and poly (I∶C) stimulation significantly induced the decrease in miR-223 expression in macrophages. [score:3]
The expression of miR-223 was analyzed by q-PCR after LPS treatment for the indicated time. [score:3]
0042971.g002 Figure 2 RAW264.7 cells were transfected with mimics or inhibitors of miR-223 and their controls at a final concentration of 30 nM. [score:3]
The result was consistent with the effect of miR-223 over -expression on cytokine production. [score:3]
Treatment of RAW264.7 with 10 or 20 ng/ml recombinant murine IL-6 significantly decreased the expression of miR-223, starting at the 0 to 2 h time-point, which is much earlier than that seen with LPS or poly (I∶C) challenge (Fig. 8A, B). [score:3]
Raw264.7 cells were transfected with mimics or inhibitors of miR-223 and their controls at a final concentration of 30 nM. [score:3]
Transfection of miR-223 mimics to STAT3-siRNA pretreated cells abolishes its ability to inhibit IL-6 production. [score:3]
It may provide useful insights to the understanding of molecular mechanisms by which the IL-6/miR-223/STAT3 pathway controls the inflammatory response and promotes the pathogenesis of inflammatory diseases. [score:3]
The results showed that miR-223 mimics markedly decreased the mRNA and protein expression levels of IL-6 and IL-1β, but not TNF-α, production in RAW264.7 stimulated with LPS or poly (I∶C) (Fig. 2A, B and Fig. 3A–C). [score:3]
0042971.g005 Figure 5 (A) The alignment of miR223 and its target sites in 3′-UTR of STAT3 is shown. [score:3]
The results showed that miR-223 significantly inhibited STAT3 augment and activation after IL-6 challenge (Fig. 8G). [score:3]
Therefore, we hypothesized that STAT3 is a potential target of miR-223. [score:3]
The expression of miR-223 was measured by q-PCR and normalized to the expression of U6. [score:3]
RAW264.7 cells were transfected with mimics or inhibitors of miR-223 and their controls at a final concentration of 30 nM. [score:3]
0042971.g003 Figure 3 Raw264.7 cells were transfected with mimics or inhibitors of miR-223 and their controls at a final concentration of 30 nM. [score:3]
More recent work has identified that miR-223 targets IKK-α during human monocyte-macrophage differentiation. [score:3]
We assessed the effect of miR-223 mimics on the expression levels of several components of the NF-κB and MAPK pathway in RAW264.7 cells. [score:3]
However, the kinetic response of STAT3 phosphorylation with LPS challenge was altered in the presence of miR-223 inhibitors. [score:3]
In addition, the expression of miR-223 was significantly decreased with lower concentrations of LPS or poly (I∶C) (Fig. 1E–F). [score:3]
As shown in Figure 4A, over -expression of miR-223 did not influence the phosphorylation of IκBα, ERK1/2 or P38 upon LPS stimulation. [score:3]
Another important finding of this study was the preferential up-regulation of IL-6 and IL-1β (compared with TNF-α) by miR-223/STAT3 pathway. [score:3]
RAW 264.7 cells were transfected with the plasmids in combination with miR-223 mimics or inhibitors. [score:3]
Mouse peritoneal macrophages were transfected with miR-223 inhibitors or control at a final concentration of 30 nM. [score:3]
The results showed that miR-223 mimics markedly decreased, while miR-223 inhibitors significantly enhanced the luciferase activity in cells transfected with the STAT3 3′-UTR vector compared with the cells transfected with pMIR-empty plasmid. [score:2]
In this study, we demonstrated that miR-223 may be involved in the IL-6 classical versus trans-signaling in regulating the TLR -driven inflammatory responses. [score:2]
MiR-223 expression was determined by qPCR at the indicated time points. [score:2]
Our results uncovered an essential mechanism of miR-223 -mediated regulation of TLR-triggered inflammatory cytokines in macrophages. [score:2]
MiR-223 inhibits the production of IL-6 and IL-1β, but not TNF-α, in TLR-triggered macrophages. [score:2]
As mentioned above, we detected a significant decrease in miR-223 levels in RAW264.7 cells following LPS or poly (I∶C) stimulation for up to 24 h. To investigate the factors responsible for miR-223 down-regulation, several cytokines were tested. [score:2]
No change in luciferase activity was observed in cells transfected with the mutant STAT3 3′-UTR construct (Fig. 5B), indicating that STAT3 could be regulated post-transcriptionally by miR-223. [score:2]
Two transcriptional factors (NFI-A and C/EBPα) compete for binding to the miR-223 promoter. [score:1]
Figure S1 The effect of miR-223 on the production of IL-6 and IL-1β in primary macrophages. [score:1]
These results extend the roles of miR-223 to monocyte/macrophage differentiation, in addition to the previous description of a role in granulocytic differentiation. [score:1]
Surprisingly, a decrease in the protein levels of phosphorylated and total STAT3 was seen in cells transfected with miR-223 mimics (Fig. 4B). [score:1]
Since the LPS -induced decrease in miR-223 levels occurred at similar time points, our data suggests that miR-223 may function as a modulator of STAT3 protein. [score:1]
IL-6 was found to serve as a stimulatory factor in inducing the decrease in miR-223 levels. [score:1]
Figure S2 The effect of miR-223 antagomirs on IL-6 and IL-1β production in peritoneal macrophages. [score:1]
As shown in Fig. 7A, C and D, miR-223 mimics significantly decreased the production of IL-6 and IL-1β, but not TNF-α (Fig. 7B, E), in control siRNA pretreated RAW264.7 cells. [score:1]
MiR-223 negatively regulates the activation of STAT3 in macrophages. [score:1]
0042971.g007 Figure 7. (A, B) RAW264.7 cells were first transfected with STAT3 siRNA or ctrl RNAs, 18 h later, cells were secondly transfected with ctrl or miR-223 mimics. [score:1]
MiR-223 negatively regulates LPS -induced STAT3 activation in macrophages. [score:1]
However, the detailed functions of miR-223 in TLR-triggered cytokine production in macrophages still remain unclear. [score:1]
Further work has shown that miR-223 gene resembles a “myeloid gene” and might be driven by the myeloid transcription factors, PU. [score:1]
Mouse peritoneal macrophages (A, B, C) or bone marrow derived macrophages (D, E, F) were transfected with miR-223 mimics or control at a final concentration of 30 nM. [score:1]
0042971.g004 Figure 4 (A) RAW264.7 cells were transfected with control and mimics of miR-223 at a final concentration of 30 nM, then stimulated with LPS (100 ng/ml) for the indicated time points. [score:1]
Conversely, an increase in STAT3 protein and phosphorylation level was observed in RAW264.7 cells treated with miR-223 antagomirs (Fig. 8H). [score:1]
MiR-223 negatively regulates LPS or poly (I∶C)-triggered IL-6 and IL-1β production in macrophages. [score:1]
However, miR-223 mimics has no effect on IL-6 or IL-1β secretion in STAT3-siRNA pretreated cells (Fig. 7A, C and D). [score:1]
And the miR-223 antagomirs have a reverse effect on IL-6 and IL-1β production in peritoneal macrophages after LPS or poly (I∶C) stimulation (Fig. S2). [score:1]
[1 to 20 of 98 sentences]
4
[+] score: 351
We selected Il17rd as a candidate target gene of miR-223-3p by analysis of post-transcriptional miRNA-mRNA interaction networks using miRNA prediction algorithms and demonstrated that miRNA-223-3p downregulated Il17rd mRNA expression and IL-17RD protein levels and upregulated Il6 mRNA expression in both mouse and human synovial cells. [score:13]
We additionally report that miR-223-3p targets molecules involved in IL-17RD expression, thereby downregulating IL-17RD levels and that miR-223-3p upregulates IL-6 induction in the IL-17RD expressed synovial cells. [score:13]
The transfection of plasmid vectors overexpressing miR-223-3p into NIH3T3 and MH7A cells resulted in the downregulation of Il17rd expression and upregulation of Il6 expression. [score:13]
This study is the first to demonstrate that miR-223-3p downregulates IL-17RD in both mouse and human cells; miR-223-3p may contribute to the pathogenesis of RA by downregulating the expression of IL-17RD and upregulating that of IL-6 in synovial cells. [score:12]
We also observed miR-223-3p downregulated IL-17RD but upregulated Il6 expression in human MH7A cell, and that TNF-α stimulation increased miR-223-3p and Il6 mRNA levels but decreased Il17rd mRNA expression in MH7A cells. [score:11]
In order to predict the target genes of upregulated miR-223-3p in SKG mice treated with ß-glucan, we used five different miRNA target prediction algorithms (miRWalk, DIANA-microT, PITA, RNAhybrid, Targetscan) and cross-evaluated the output from these algorithms to identify target mRNAs with greater accuracy. [score:10]
Expression of miR-223-3p and Il6 mRNA in MH7A cells was upregulated; however, that of Il17rd mRNA was downregulated following TNF-α stimulation. [score:9]
We observed that plasma levels of miR-223-3p are elevated in RA mo del of SKG mice, and that miR-223-3p downregulated IL-17RD but upregulated Il6 expression in mouse NIH3T3 cells. [score:9]
In contrast, transfection with miR-223-3p -expressing clone#7 upregulated Il6 mRNA expression in these cells (Fig 5G). [score:8]
We performed inhibition assay using chemically modified single stranded RNA molecules designated to specifically bind to and inhibit endogenous miRNA molecules (miR-223-3p inhibitor) or scrambles as anti-miRNA inhibitors negative control (Life Technologies, Madrid, Spain). [score:8]
As shown Fig 7, miR-223-3p transiently upregulated at 3h but downregulated at 6, 12, and 24h after TNF-α stimulation. [score:7]
0169702.g007 Fig 7MH7A cells were stimulated with TNF-α (100 ng/ml) and the expression levels of miR-223-3p (A), Il6 (B) and Il17rd mRNA (C) in MH7A cells were analyzed after 3, 6, 12 and 24 h. were expressed as the relative fold change in the expression levels of these RNAs in the untreated control. [score:7]
Transfection with miR-223-3p -expressing clone#7 resulted in increased miR-223-3p mRNA expression (Fig 5C) but decreased Il17rd mRNA expression (Fig 5D) in MH7A cells. [score:7]
miR-223-3p was shown to be overexpressed in synovial tissue of patients with RA [19], and silencing of miR-223-3p expression was found to reduce disease severity in experimental arthritis [48]. [score:7]
In order to confirm the functional role of miR-223-3p in post-transcriptional miRNA-mRNA interaction in human synovial cells, we transfected IL-17RD -expressing human synovial cells (MH7A) with miR-223-3p plasmids, and showed that transfection with these plasmids resulted in decreased Il17rd expression and increased Il6 mRNA expression in MH7A cells. [score:7]
To determine the functional role of miR-223-3p in the expression of Il17rd, we transduced miR-223-3p overexpression vector into NIH3T3 cells that constitutively expressed IL17RD (Fig 1A). [score:7]
MH7A cells were stimulated with TNF-α (100 ng/ml) and the expression levels of miR-223-3p (A), Il6 (B) and Il17rd mRNA (C) in MH7A cells were analyzed after 3, 6, 12 and 24 h. were expressed as the relative fold change in the expression levels of these RNAs in the untreated control. [score:7]
High expression level of miR-223-3p is seen in myeloid cells and upregulation of miR-223-3p is an important element of myeloid cell differentiation [16– 18]. [score:6]
miR-223-3p may contribute the pathogenesis of RA, representing a novel target for the development of therapies against this disease. [score:6]
These results indicate that miR-223-3p interacts with Il17rd mRNA, downregulating Il-17RD protein expression in NIH3T3 cells. [score:6]
In order to determine whether miR-223-3p mediates IL-17RD expression in humans via direct interaction with its 3’UTR, we used bioinformatics software TargetScan to predict the potential binding sequences in the 3’UTR of hIl17rd. [score:6]
MiR-223-3p downregulates IL-17rd expression. [score:5]
The activity of miR-223-3p was analyzed by transfection of plasmid vectors overexpressing miR-223-3p into IL-17RD -expressing NIH3T3 and MH7A cell lines. [score:5]
Il17rd was identified as the candidate target gene of miR-223-3p using five miRNA target prediction algorithms. [score:5]
Next, we examined the effect of miR-223-3p inhibitor on Il17rd mRNA expression in MH7A clone#7. [score:5]
We observed an increase in Il6 mRNA expression, but a decrease in that of Il17rd, following transfection of mouse NIH3T3 cell line with the miR-223-3p expression vector. [score:5]
List of target gene for miR-223-3p from five miRNA target prediction algorithms. [score:5]
As shown in Fig 5H, Il17rd mRNA expression was increased by the treatment of miR223-3p inhibitor (Fig 5H). [score:5]
analysis of the plasma showed upregulation of miR-223-3p and miR-709 in the plasma of SKG mice treated with ß-glucan relative to untreated SKG mice. [score:4]
The top five upregulated miRNAs (miR-1195, miR-223-3p, miR-129-2-3p, miR-709, and miR-224-5p) were selected for subsequent analysis, which was performed via quantitative real-time PCR analysis of the plasma from individual mice in each group. [score:4]
Upregulation of miR-223-3p, but not of miR-709, was statistically significant. [score:4]
MH7A cells were stimulated with various concentrations of TNF-α and the expression levels of miR-223-3p (A, D) Il17rd (B, E), and Il6 mRNA (C, F) were analyzed after 3 h (A, B, C) and 24 h (D, E, F). [score:3]
We additionally observed that TNF-α stimulation increased miR-223-3p and Il6 mRNA levels but decreased Il17rd mRNA expression in MH7A cells. [score:3]
The expression of miR-223-3p was significantly augmented at 3 h, but not at 24 h, after TNF-α stimulation (Fig 6A and 6D). [score:3]
To confirm the relationship between miR-223-3p and IL17-RD expression in the synovial cells, we transfected miR-223-3p into the human synovial cell line MH7A (Fig 1B). [score:3]
Among the 5 clones selected using puromycin, high expression levels of miR-223-3p miRNA were detected in several clones, such as #1, #2, and #7, using real-time PCR (Fig 1B). [score:3]
The next day, 20 ng of reporter plasmid, pmG/ mIl17rd or pmG/ hIl17rd (both pmG/ hIl17rd wild type or deleted for the miR-223-3p seed site), was co -transfected with 80 ng of either miR-223-3p overexpression vector (pBA/miR-223-3p) or negative control vector (pBA/NC). [score:3]
miR-223-3p is overexpressed in the synovium and peripheral T cells of patients with RA [12, 19– 21]. [score:3]
Among the 23 clones selected using neomycin, high levels of expression of miR-223-3p miRNA were detected in several clones, such as #1, #3, #6, #13, and #15, using real-time PCR (Fig 1A). [score:3]
Next, we examined the effect of miR223-3p on IL-17RD expression at the protein level. [score:3]
Reporter plasmid and mouse pmG/mIl17rd were transfected into HeLa cells with either miR-223-3p overexpression vector (pBA/miR-223-3p) or negative control vector (pBA/NC). [score:3]
By contrast, the inhibitory effect of miR-223-3p on luciferase activity was partially restored by the deletions of binding sequences in the 3’UTR of hIl17rd (Fig 5B). [score:3]
Although the correlations between IL17RD and IL-6 expression are still not known, our observations support these previous findings, confirming that miR-223-3p contributes to functional interplay between IL-17RD, inflammatory cytokines, and TLR families. [score:3]
As shown in Fig 4A, transfection with pBA/miR-223-3p significantly inhibited luciferase activity relative to transfection with pBA/NC (Fig 4A). [score:3]
Effects of miR-223-3p overexpression on the human cells. [score:3]
IL-17rd is a target gene of miR-223-3p. [score:3]
Effect of TNF-α on the expression of miR-223-3p, Il17rd, and Il6 mRNA in MH7A cells. [score:3]
The bioinformatics approach identified 1,115 mRNAs as commonly predicted target genes from miR-223-3p by all the algorisms (S2 Table). [score:3]
Kinetics of the expression of Il17rd, and Il6 mRNA and miR-223-3p after TNF-α stimulation. [score:3]
Expression of miR-223-3p in stable transfected cells. [score:3]
miRNA-223-3p was also reported to be a biomarker of disease activity in RA [49]. [score:3]
TNF-α induces miR-223-3p and IL-6 expression in the human synovial cell line. [score:3]
In order to examine the effect of different diose of TNF-α on miR-223-3p expression in synovial cells, we stimulated MH7A cells with TNF-α. [score:3]
This result indicates that Il17rd is a target gene of miR-223-3p. [score:3]
This study aimed to analyze the functional role of miR-223-3p in the pathogenesis of RA by overexpressing miR-223-3p in synovial cell lines. [score:3]
In order to construct the miR-223-3p overexpression vector (pBA/miR-223-3p), the following oligonucleotides were annealed and inserted into the BamHI/HindIII site of pBAsi-hU6 Neo or Puro vector (TaKaRa Bio): 5’- GATCCGTGTCAGTTTGTCAAATACCCCAGTGTGCTGTCCTGGGGTATTTGACAAACTGACACTTTTTTA-3’ and 5’- AGCTTAAAAAAGTGTCAGTTTGTCAAATACCCCAGGACAGCACACTGGGGTATTTGACAAACTGACACG-3’ (the sequence of miR-223-3p is underlined). [score:3]
Effects of miR-223-3p overexpression on the mouse cells. [score:3]
Elevated plasma levels of microRNA-223-3p (miR-223-3p) in patients with RA are implicated in the pathogenesis of the disease. [score:3]
IL-17rd is a target gene of miR-223-3p in humans. [score:3]
The expression of miR-223-3p was significantly increased in NIH3T3 clone#13 transfected with pBA/miR-223-3p (Fig 4B). [score:3]
This reporter plasmid vector was transfected into HeLa cells, together with either the miR-223-3p overexpression plasmid vector (pBA/miR-223-3p) or the negative control vector (pBA/NC), to compare the effects of transfection with pBA/miR-223-3p and pBA/NC on luciferase activity. [score:3]
We next examined the effect of miR-223-3p on IL-6 expression in NIH3T3 cells. [score:3]
We next examined the kinetics of miR-223-3p, Il6, and Il17rd mRNA expression after TNF-α (100 ng/ml) stimulation. [score:3]
Either pmG/ hIl17rd WT or pmG /hIl17rd del was transfected into HeLa cells with either miR-223-3p overexpression vector (pBA/miR-223-3p) or negative control vector (pBA/NC). [score:3]
Our results indicated that expression of miR-223-3p was inversely correlated to that of IL-17RD in synovial cells. [score:3]
0169702.g006 Fig 6MH7A cells were stimulated with various concentrations of TNF-α and the expression levels of miR-223-3p (A, D) Il17rd (B, E), and Il6 mRNA (C, F) were analyzed after 3 h (A, B, C) and 24 h (D, E, F). [score:3]
MiR-223-3p augments IL-6 expression. [score:2]
Pools of 5 clones with pBA/miR-223-3p vectors or 4 pBA/NC control vectors were isolated as stable transfectants. [score:1]
0169702.g001 Fig 1 NIH3T3 cells (A) or MH7A cells (B) were transfected with pBA/miR-223-3p or pBA/NC and the resulting cells were individually picked for expansion using conventional cloning techniques. [score:1]
Five miRNAs (miR-1195, miR-223-3p, miR-129-2-3p, miR-709, and miR-224-5p), whose levels were found to be significantly elevated in the pooled plasma of ß-glucan -injected SKG mice by panel real-time PCR, were analyzed. [score:1]
As shown in Fig 5B, co-transfection with pmG/ hIl17rd WT and pBA/miR-223-3p showed a significant decrease of the luciferase activity relative to transfection with pBA/NC. [score:1]
We transfected the luciferase reporter plasmid into HeLa cells, together with either pBA/miR-223-3p or pBA/NC. [score:1]
The sequence of human miR-223-3p is the same as that of mouse miR-223-3p. [score:1]
miR-223-3p miRNA was determined using real-time PCR. [score:1]
NIH3T3 cells (A) or MH7A cells (B) were transfected with pBA/miR-223-3p or pBA/NC and the resulting cells were individually picked for expansion using conventional cloning techniques. [score:1]
However, the precise role of miR-223-3p in the pathogenesis of RA is still unknown. [score:1]
Then we designed pmirGLO luciferase reporter constructs containing either the wild-type (pmG/ hIl17rd WT) or deleted (del) miR-223-3p binding sequences in the 3’UTR of hIl17rd (pmG/ hIl17rd del) (Fig 5A). [score:1]
in humansThe sequence of human miR-223-3p is the same as that of mouse miR-223-3p. [score:1]
Our observations support previous reports demonstrating that miR-223-3p is involved in the pathogenesis of RA in humans as well as in animal mo dels [48, 49]. [score:1]
In order to perform the luciferase assay, the 3’UTR of mouse IL17rd (mIl17rd) and human IL17rd (hIl17rd) genes containing miR-223-3p target sequences were amplified from mouse or human genomic DNA by PCR, using the following primers, mIl17rd-3’UTR F: 5’-GGACTCGGAAGAGTCTAAGCA-3’, mIl17rd-3’UTR R: 5’-TTACAAGAAAACATTTTATTTGATGTAGAA-3’, hIl17rd-3’UTR F: 5’-CAAAACGAAAGAGTCTAAGCATTG-3’, and hIl17rd-3’UTR R: 5’-TTAAAACAAAACATTTTATTTAATGCAGA-3’. [score:1]
In order to confirm whether miR-223-3p interacts with Il17rd mRNA, we used luciferase reporter plasmid vector driven by pmG/mIl17rd. [score:1]
was performed using stable NIH3T3 and MH7A transfectant cells harboring pBA/miR-223-3p or pBA/NC vectors. [score:1]
0169702.g005 Fig 5(A) Schematic diagram of the luciferase reporter plasmids including IL-17RD3’UTR wild type (WT) or deleted (del) miR-223-3p binding sequences in the 3’UTR in which six nucleotide forming the seed region of miR-223-3p were deleted. [score:1]
For transfection, NIH3T3 cells were grown to 90% confluence and transfected with pBA/miR-223-3p or pBA/NC using Lipofectamine 3000. [score:1]
Pools of 23 clones with pBA/miR-223-3p vectors or 9 pBA/NC control vectors were isolated as stable transfectants. [score:1]
[1 to 20 of 85 sentences]
5
[+] score: 274
Expression of miR-223 Is Up-Regulated in Atherosclerotic Lesions in ApoE [−/−] MiceTo analyze the expression of miR-223 during atherosclerosis, we quantified its expression in mice mo dels of high-fat diet (HFD) -induced atherosclerotic lesion. [score:10]
As shown in Figure 2A, LPS induced a slight decrease in miR-223 levels at 2 h post-stimulation and an obvious down-regulation of miR-223 mRNA was observed during the next 2 h. Notably, the mRNA levels of miR-223 were gradually down-regulated with the inchmeal increased times of LPS stimulation in RAW 264.7 cells. [score:7]
To specifically induce or silence miR-223 expression in macrophages, the miR-223 mimics and miR-controls, miR-223 inhibitor and inhibitor controls (10 nM) were all from GenePharma (Shanghai, China). [score:7]
Expression of miR-223 Is Up-Regulated in Atherosclerotic Lesions in ApoE [−/−] Mice. [score:6]
Precondition with PDTC also resulted in the similar down-regulation of IL-6 (Figure 5D) and NO (Figure 5E) levels in anti-miR-223 inhibitor -treated cells. [score:6]
As expected, pretreatment with PDTC significantly abrogated the increase in phosphor-p65 expression triggered by miR-223 down-regulation (Figure 5B). [score:6]
Western blotting analysis conferred an obvious up-regulation of phospho-AKT (p-AKT) expression when cells were transfected with miR-223 mimics (Figure 6A). [score:6]
Importantly, miR-223 up-regulation significantly abrogated the activation of TLR4 and p65, which was notably increased when preconditioned with LY294002, a specific inhibitor for PI3K/AKT signaling (Figure 6B). [score:6]
In accordance with our hypothesis, miR-223 up-regulation remarkably dampened the activation of TLR4 and its downstream NF-κB, but reversely increased the activation of TLR4-NF-κB by blocking miR-223 expression. [score:6]
In conclusion, this research demonstrates the expression of miR-223 in plaques and down-regulation in activated macrophages with LPS stimulation. [score:6]
Importantly, a similar down-regulation pattern for miR-223 expression was also confirmed in primary bone marrow-derived macrophages (BMDMs) (Figure 2B). [score:6]
To analyze the expression of miR-223 during atherosclerosis, we quantified its expression in mice mo dels of high-fat diet (HFD) -induced atherosclerotic lesion. [score:5]
When blocking this pathway with the specific inhibitor LY294002, the inhibitory effect of miR-223 on the activation of TLR4-NF-κB signaling was attenuated. [score:5]
miR-223 has recently been confirmed to be involved in several inflammatory diseases, including inflammatory bowel disease and type 2 diabetes [26, 27]. [score:5]
Recently, abundant research has not only confirmed the important function of miR-223 during influenza or hepatitis B infection, leukaemia and breast cancer, but also corroborated its association with several inflammatory diseases, such as inflammatory bowel disease, type 2 diabetes and rheumatoid arthritis [26, 27, 28, 29]. [score:5]
Figure 2LPS inhibited the expression of miR-223 in RAW 264.7 and BMDMs. [score:5]
Following transfection with miR-223 mimics (A) or anti-miR-223 inhibitor (B), the expression levels of miR-223 in RAW 264.7 cells were assessed by qRT-PCR. [score:5]
Further analysis validated that miR-223 overexpression strikingly antagonized LPS -induced macrophage-derived foam cell formation, but increased it in miR-223 inhibitor -treated groups (Figure 3C). [score:5]
Moreover, the anti-miR-223 inhibitor treatment dramatically reduced the expression levels of miR-223 mRNA (Figure 3B). [score:5]
Liu Y. Wang R. Jiang J. Yang B. Cao Z. Cheng X. miR-223 is upregulated in monocytes from patients with tuberculosis and regulates function of monocyte-derived macrophages Mol. [score:5]
Further mechanism assays corroborated that miR-223 down-regulation -induced increase in lipid accumulation was strikingly inhibited when pretreated with PDTC (Figure 5C). [score:5]
Then, the qRT-PCR was performed to detect the expression of miR-223; and (C) Following stimulation with the indicated doses of LPS for 16 h, the expression of miR-223 was assessed. [score:5]
Accordingly, miR-223 could reversely regulate macrophage -mediated lipid deposition and inflammatory response primarily by suppressing TLR4-NF-κB signaling. [score:4]
Down-Regulation of miR-223 Was Confirmed in Macrophages Stimulated with TLR Agonists. [score:4]
Therefore, the data suggests that miR-223 could regulate lipid deposition and the inflammation response in macrophages triggered by LPS via suppression of TLR-4-NF-κB signaling. [score:4]
Simultaneously, miR-223 up-regulation obviously accelerated cholesterol efflux to apoA-I (Figure 3E). [score:4]
To further address the association between miR-223 and the TLR4-NF-κB pathway during macrophage-regulated lipid uptake and inflammation, we blocked this pathway by addition of PDTC, a specific inhibitor for NF-κB pathway. [score:4]
The corresponding functions of PDTC pre-treatment on miR-223 down-regulation-triggered lipid accumulation (C), IL-6 (D) and NO (E) levels were also detected. [score:4]
However, this study only demonstrated the mechanisms involved in anti-lipid deposition and the inflammatory response effect of miR-223 predominantly by negatively regulating TLR4 signaling in vitro, but did not to provide direct evidence of its anti-atherosclerosis function by regulating lipid metabolism and inflammation through the TLR4 pathway in vivo. [score:4]
In patients with tuberculosis, miR-223 can regulate macrophage function by inhibition of cytokine production and NF-κB activation [31]. [score:4]
As shown in Figure 4A, stimulation of macrophages by LPS resulted in the significant production of IL-6, which was obviously down-regulated by the transfection of miR-223 mimics in activated macrophage. [score:4]
The down-regulated miR-223 promoted the production of pro-inflammatory cytokines triggered by LPS, via signal transducer and activator of transcription 3 (STAT3) [30]. [score:4]
In the current research, LPS dose- and time -dependently blocked the expression of miR-223 mRNA in RAW 264.7 and bone marrow-derived macrophages. [score:3]
However, an increased expression of miR-223 was observed in atherosclerotic lesions. [score:3]
Further mechanism analysis demonstrated that the inhibitor effect of miR-223 on lipid accumulation triggered by LPS stimulation was remarkably attenuated following LY294002 pretreatment (Figure 6C), concomitant with the corresponding increase in IL-6 (Figure 6D) and NO production (Figure 6E). [score:3]
Following transfection with miR-223 mimics, an obvious up-regulation of miR-223 mRNA was demonstrated in RAW 264.7 cells, compared with the control group (Figure 3A). [score:3]
Therefore, miR-223 may be a promising therapeutic agent against cardio-cerebral vascular disease. [score:3]
Simultaneously, the similar increase in inflammatory cytokines IL-6 and NO levels was also corroborated, indicating that PI3K/AKT may contribute for the inhibitor role of miR-223 on TLR4 -mediated lipid accumulation and inflammation in macrophages. [score:3]
To further clarify the mechanism involved in the inhibitor effect of miR-223 on lipid deposition and inflammatory in macrophages, the TLR4 signaling was therefore explored. [score:3]
Together, these results suggested a time- and dose -dependent decrease in miR-223 expression in LPS-triggered macrophages. [score:3]
Activation of the TLR4-NF-κB Pathway Is Abrogated by miR-223 Mimics and Responsible for the Inhibitory Effect of miR-223 on Lipid Accumulation and Inflammatory Response. [score:3]
Following transfection with miR-223 mimics, the increases in TLR4 and phosphor-p65 expression levels triggered by LPS stimulation were notably mitigated (Figure 5A). [score:3]
Forty-eight hours later, the activation of PI3K/AKT signaling was determined by western blot analysis; (B) Following pretreatment with 20 μM LY294002 (PI3K inhibitor) for 4 h, the effect of miR-223 on activation of TLR4-NF-κB pathway was analyzed. [score:3]
miR-223 silencing enhanced LPS -induced expression of TLR4 and its downstream signaling effector NF-κB. [score:3]
Here, miR-223 overexpression obviously abrogated the ratio of CE/TC and subsequent lipid -loaded macrophage foam cell formation, concomitant with the increase of cholesterol efflux to apoA-I. Importantly, macrophages activated by LPS stimulation exhibited the increases in the production of pro-inflammatory cytokines IL-6 and NO, which were dramatically reduced by miR-223 transfection. [score:3]
The expression level of miR-223 in each sample was normalized to U6 in the same sample according to 2−ΔΔ Ct. [score:3]
Simultaneously, blocking miR-223 expression accelerated lipid deposition and inflammatory cytokine production in macrophages stimulated with LPS. [score:3]
In murine macrophages, the expression of miR-223 was significantly decreased after LPS stimulation [30]. [score:3]
Figure 1Expression of miR-223 in atherosclerotic lesions. [score:3]
A corresponding decrease in cholesterol efflux was observed when silencing miR-223 expression. [score:3]
Furthermore, miR-223 elevation remarkably attenuated nitrite production in RAW 264.7 macrophages exposure to LPS, but increased it in the anti-miR-223 inhibitor -treated groups (Figure 4B). [score:3]
The increased expression of miR-223 in atherosclerotic lesions might indicate a feedback mechanism. [score:3]
Therefore, this result confirmed an increase of miR-223 in atherosclerotic lesion, indicating a potential function of miR-223 in the development of atherosclerosis. [score:2]
miR-223 overexpression can block multinucleated cell formation compared with control cells [32]. [score:2]
After transfection with miR-223 mimics or anti-miR-223 inhibitor, cells were exposed to LPS (50 ng/mL) for 16 h. Then, the levels of IL-6 were demonstrated by ELISA assay (A); the culture supernatants were subsequently isolated and analyzed for nitrite levels (B). [score:2]
As shown in Figure 1, the expression of miR-223 was obviously increased at three months later in HFD-feeding atherosclerotic groups, compared with the wild type control group. [score:2]
Importantly, we demonstrate that miR-223 might negatively regulate TLR4 signaling-triggered lipid accumulation and inflammation primarily by activating the PI3K/AKT pathway in macrophages. [score:2]
Following construction of atherosclerotic mo dels of ApoE [−/−] mice by fed with the high-fat diet (HFD) for three months, the expression levels of miR-223 were determined by qRT-PCR assay in atherosclerotic lesion areas. [score:2]
Importantly, miR-223 synchronously attenuated lipid accumulation and inflammatory in activated macrophages by LPS stimulation through negatively regulating TLR4 -dependent signaling pathway. [score:2]
These results indicated that miR-223 antagonized LPS -induced IL-6 and NO production, indicating its potential as a negative regulator to inflammatory response in TLR-triggered macrophages. [score:2]
[#] p < 0.05, compared to the LPS treated control group; (B) Cells were treated with 30 μM NF-κB inhibitor PDTC for 4 h, prefer to exposure to LPS for 16 h. The effect of miR-223 silencing on the phosphor-p65 levels was confirmed by western blotting. [score:2]
2.4. miR-223 Negatively Regulated Inflammatory Response to LPS in TLR-Triggered Macrophages. [score:2]
However, how does miR-223 exerts its regulatory role in the PI3K/AKT pathway? [score:2]
Yu C. -H. Xu C. -F. Li Y. -M. Association of MicroRNA-223 expression with hepatic ischemia/reperfusion injury in mice Dig. [score:2]
Accordingly, the above data corroborated miR-223 might act as a negative regulator for macrophage foam cell formation. [score:2]
Together, these results confirmed that miR-223 might block TLR4 signaling-triggered lipid accumulation and inflammation predominantly by activating the PI3K/AKT pathway. [score:1]
However, silencing miR-223 levels significantly augmented LPS -induced IL-6 production. [score:1]
Recently, miR-223 was found increased in the aorta of ApoE KO mice [34]. [score:1]
To further elucidate the underlying mechanism involved in the inhibitor effect of miR-223 on TLR4 signaling during lipid uptake and inflammation in macrophages, we investigated Akt activity as well. [score:1]
Figure 4Effect of miR-223 on the production of inflammatory cytokines in LPS-activated macrophages. [score:1]
Haneklaus M. Gerlic M. O’Neill L. A. Masters S. L. miR-223: Infection, inflammation and cancer J. Intern. [score:1]
These findings may suggest a new mechanism for the effect of miR-223 in atherosclerosis, potentially facilitating plaque stabilization. [score:1]
Here, we sought to investigate the expression of miR-223 in atherosclerotic plaque and its effects on lipid accumulation and inflammation responses in LPS-activated macrophages. [score:1]
2.6. miR-223 Mitigates TLR4 Signaling Activation through the PI3K/AKT Pathway. [score:1]
As expected, miR-223 induced the activation of PI3K/AKT signaling. [score:1]
Hence, the expression of miR-223 in inflammatory macrophages triggered by LPS was investigated. [score:1]
miR-223 was also involved in human granulocytic differentiation [33]. [score:1]
To clarify the underlying mechanisms involved in the inhibitory effects of miR-223 on lipid deposition and inflammatory response in macrophages, TLR4 signaling, a key pathway during atherosclerosis, was investigated. [score:1]
Furthermore, the mRNA levels of miR-223 were about 0.28-fold and 0.21-fold over control when exposure to 5 and 10 ng/mL LPS, respectively (Figure 2C). [score:1]
Following transfection with miR-223 mimics or anti-miR-223 inhibitor, a detailed study to investigate the involvement of miR-223 in macrophage foam cell formation was performed. [score:1]
In the present study, we observed a significant increase of miR-223 in atherosclerotic plaque. [score:1]
RAW 264.7 cells transfected with miR-control or inhibitor control were used as control, respectively; (C) RAW 264.7 cells pre -treated with miR-223 mimics or inhibitors were stimulated with LPS (50 ng/mL, for 16 h), prior to incubation with ox-LDL (50 μg/mL) for 48 h. Oil red O staining was performed to analyze the effect of miR-223 on foam cell formation; (D) The ratio of cholesteryl ester/total cholesterol (CE/TC) was determined by HPLC to evaluate lipid deposition in LPS-triggered macrophages; and (E) After labeled with [3]H-cholesterol (5 μCi/mL), the effect of miR-223 on cholesterol efflux from RAW 264.7 was investigated. [score:1]
Moreover, elevation of miR-223 in macrophages significantly attenuated LPS -induced lipid deposition evidence as the ratio of cholesteryl ester/total cholesterol (CE/TC) decreased from 50.88% to 25.34%, but increased to 68.23% in miR-223 silencing groups (Figure 3D). [score:1]
miR-223 also plays a critical role in osteoclast differentiation. [score:1]
2.3. miR-223 Attenuated LPS-Triggered Foam Cell Formation. [score:1]
Interestingly, the augmented effect of miR-223 silencing on lipid accumulation and inflammation in activated macrophages was obviously attenuated when preconditioned with PDTC. [score:1]
[1 to 20 of 86 sentences]
6
[+] score: 272
Other miRNAs from this paper: mmu-mir-22
The results are shown in Figures 5f and g. MTDs could upregulate the enrichment of NLRP3 mRNA in RNA -induced silencing complex (RISC), whereas miR-223 mimics or inhibitors significantly upregulated or downregulated the accumulation of NLRP3 mRNA, respectively. [score:12]
MTDs time -dependently upregulated miR-223 expression in WT mouse BMDNs and downregulated NLRP3 expression. [score:11]
These experiments show that MTDs can upregulate the translation of NLRP3 in vitro, whereas miRNA-223 can inhibit the translation of NLRP3 3′UTR in BMDNs. [score:10]
[31] miR-223 has a wide range of targeted inhibitory effects, including RHOB, [40] FBXW7, [41] FOXO [42] and other important disease targets. [score:9]
It is interesting to note that systemic immunosuppression has been observed in patients with non-pulmonary ARDS, and although there is a severe inflammatory response in the lungs, its potential underlying mechanism, according to this study, is presumed that miR-223 expression inhibits the number of Ly6G+ cells in the circulation and leads to feedback immunosuppression. [score:9]
The results suggest that systemic immunosuppression in patients with ARDS is dependent on the number of Ly6G+ cells and that MTDs induce the upregulation of miR-223 expression. [score:8]
miRNA-223 mimics or inhibitor was co -transfected into BMDNs with the NLRP3 3′UTR reporter plasmid, and the results are shown in Figures 6c and d. miR-223 mimics attenuates BMDN luciferase activity, whereas the inhibitor slightly upregulates BMDN luciferase activity. [score:8]
The expression of miR-223 of patients with ARDS caused by trauma and blood transfusion was significantly upregulated, whereas ARDS caused by infection and inhalation remained unchanged. [score:6]
In addition, MTDs upregulate miR-223 expression, which occurs after the onset of the inflammatory response, and therefore, miR-223 may be used as a negative feedback molecule to alleviate MTD -induced ALI. [score:6]
miR-223 has been shown to inhibit NLRP3 expression in vitro, but its role in the NLRP3 -mediated MTD -induced ALI process is unclear; therefore, understanding the molecular regulation of miRNA-223 during DAMP -induced injury may help improve the treatment of non-pulmonary ARDS. [score:6]
More importantly, the decrease in NLRP3 expression in the BMDNs of WT mice is dependent on the upregulation of miR-223 and is time dependent after MTD stimulation. [score:6]
miR-223 negative feedback regulation inhibits NLRP3 expression in MTD -induced BM-derived neutrophils. [score:6]
As illustrated in Figure 8, miR-223 feedback inhibits NLRP3 activation, inhibits early pulmonary inflammatory factor dysregulation and relieves MTD -induced ALI. [score:6]
Although miR-223 expression was dependent on the X-chromosome, the physiological or pathological expression of miR-223 was not different (P>0.05) among the C57BL/6J background mice or ARDS subjects. [score:5]
Cytokine release in MTD -induced WT mice was significantly inhibited by lipopolysaccharide stimulation, whereas cytokines in the peripheral blood of miR-223−/+ mice was significantly greater than that in the WT mice, indicating that miR-223 was a possible cause of peripheral immunosuppression in non-pulmonary ARDS. [score:5]
Our findings verified that miR-223 inhibited the expression of NLRP3 in BMDNs. [score:5]
Studies have shown that miR-223 is least expressed in tissue-infiltrated macrophages but highly expressed in circulating monocytes and neutrophils. [score:5]
This evidence suggests that miR-223 expression physiological feedback inhibits the MTD -induced activation of the NLRP3 inflammasome. [score:5]
This suggests that downregulation of IL-1 β mediates the beneficial effect of miR-223 on ARDS recovery. [score:4]
Figure 7b showed that Ly6C+ and Ly6G+ cells could be downregulated by MCC950, anakinra and miR-223 mimics treatment. [score:4]
This evidence strongly suggests that miR-223 negative feedback regulates the expression of NLRP3 and that a miR-223 deficiency may cause NLRP3 inflammasome signal blockade in response to MTD stimulation, thus resulting in excessive production of IL-1 β. Finally, we demonstrated whether selective blocking of the miR-223–NLRP3–IL-1 β could alleviate MTD -induced ALI. [score:4]
In addition, in miR-223−/+ mouse BMDNs, NLRP3 expression was slightly changed in response to MTD induction, and correspondingly, IL-1 β release was significantly greater than that in WT mouse. [score:3]
In other words, routine treatment will be more effective among ARDS patients with higher has-miR-223 expression. [score:3]
The results, which are shown in Figure 3c, indicate that miR-223 was highly expressed in the Ly6G+ cells of WT mice at levels greater than in miR-223−/+ mice after stimulation by MTDs. [score:3]
In our study, miR-223 expression increased in the BALF of ARDS patients with non-infectious aetiologies (trauma and blood transfusion), and the correlation was significant. [score:3]
miR-223−/+ mice were administered the NLRP3 small-molecule inhibitor MCC950, the IL-1R agonist anakinra or miR-223 mimics followed by the administration of MTDs. [score:3]
The expression of NLRP3 in the BMDNs of miR-223−/+ mice was not changed following MTD induction. [score:3]
Meanwhile, the NLRP3 3′UTR [delete] did not react to miR-223 mimics or inhibitor. [score:3]
BM chimeric mice showed that the haematopoietic system is the source of increased miR-223 expression. [score:3]
These results suggest that the increase in miR-223 expression following MTD stimulation is contributed by Ly6G+ cells from the haematopoietic system. [score:3]
RRPL3 3′UTR, miR-223 mimics and miR-223 inhibitor transfection. [score:3]
Figure 1e shows that miR-223 expression began to increase in WT mice 48 h after MTD stimulation, which was later than the induction of ALI by MTDs. [score:3]
PGL3-luc-NLRP3 3′UTR plasmid, pGL3-luc-NLRP3 3′UTR delete plasmid, miR-223 mimics and miR-223 inhibitor were obtained from GenePharma. [score:3]
As shown in Figure 5d, miR-223 -deficient mice exhibited more severe inflammatory cytokine and chemokine dysregulation compared with WT mice, especially in the expression of IL-1 β, IL-6 and TNF- α. In addition, the release of cytokines was detected after using Ly6C and Ly6G antibodies, respectively. [score:3]
A total of 29 miRNAs that are highly associated with the inflammatory response were detected as described by Chen et al. [30] As shown in Supplementary Figure S1A, miR-223 expression was the highest in bronchoalveolar lavage fluid (BALF) from patients with ARDS caused by trauma and blood transfusion. [score:3]
In addition, MTDs significantly induce the expression of multiple inflammatory cytokines and chemokines in the lungs, and miR-223 deficiency leads to increased cytokine release. [score:3]
In vitro, NLRP3 has been shown to be inhibited by miR-223 [37] and has received widespread attention. [score:3]
qPCR was used to detect the expression level of miR-223. [score:3]
Meanwhile, Figure 2b shows that miR-223 expression in WT mice that received miR-223−/+ mouse BM cells was significantly lower than that in miR-223−/+ mice transplanted with WT mouse BM cells. [score:3]
miR-223 administration to mice in vivoMCC950 and anakinra were purchased from MedChemExpress (Princeton, NJ, USA) and administered intraperitoneally at 40 mg/kg/day to mice. [score:3]
IL-1 β is mainly activated by the NLRP3 inflammasome, and we aimed to verify whether miR-223 inhibits the activation of NLRP3. [score:3]
Therefore, we analysed the expression of miR-223 in the lung myeloid cell lineage. [score:3]
Detection of miR-223 expression in the sorted cells revealed that the increase in miR-223 induced by MTDs was mainly contributed by Ly6G+ neutrophils, indicating that increased miR-223 will result in a decrease in the number of Ly6G+ neutrophils. [score:3]
miR-223 expression in miR-223−/+ mice was lower than that in WT mice and had no obvious effect on MTDs. [score:3]
This suggests that the differentiation of GMPs into Ly6G+ cells is caused by the increased endogenous expression of miR-223 in GMP cells. [score:3]
miRNA-223 is a haematopoietic cell-specific miRNA, and recent studies have shown that miR-223 is almost exclusively expressed in myeloid cell lineage. [score:3]
miR-223-deficiency aggravates MTD -induced cytokine dysregulation. [score:2]
In this study, the miR-223−/+ mice were knockout heterozygous mice, and it is unknown whether miR-223 deficiency in the lung or blood causes the increase in lung injury. [score:2]
In summary, our study highlights the key regulatory effect of Ly6G+ cells and the miR-223–NLRP3–IL-1 β pathway in MTD -induced ARDS. [score:2]
Nevertheless, the regulatory role of miR-223 in MTD -induced ARDS is still unknown. [score:2]
In addition, the PAR-CLIP assay confirmed that the NLRP3 mRNA sequence was highly enriched in RISC after stimulation with MTDs and that the enrichment process was enhanced and attenuated by miR-223 mimics and inhibitors, respectively. [score:2]
32, 33 Thus we investigated whether systemic immunosuppression of non-pulmonary ARDS was regulated by miR-223. [score:2]
Histological results, as shown in Figure 1f, indicate that the lung injury and inflammation in the miR-223−/+ mouse lungs was greater than that in the WT mice 4 days after induction by MTDs. [score:1]
Haematopoietic cell-derived miR-223 relieves MTD -induced ALI. [score:1]
As shown in Figure 4a, the number of GMPs in the miR-223−/+ mouse BM and the number of Ly6G+ cells in the peripheral blood and BALF were significantly higher and lower than those in WT mice, respectively. [score:1]
[39] Our clinical data show that the miR-223 is negatively correlated with serum IL-1 β levels and that IL-1 β levels are negatively correlated with the prognosis of ARDS patients. [score:1]
Therefore, miR-223-deficiency leads to an increase in Ly6G+ cells in the peripheral blood of mice. [score:1]
miR-223 participates in MTD -induced ARDS. [score:1]
miRNA-223−/+ mice and miRNA-223−/+ CD45.1+ mice on a C57BL/6J background were a gift from Dr. [score:1]
Both WT and miR-223−/+ mice that received BM cells from miR-223−/+ mice were sensitive to MTD -induced lung injury after excessive exposure to X-ray, whereas BM cells from WT mice were insensitive to MTD induction. [score:1]
Moreover, we examined the number of GMPs, which are the precursor population of Ly6G+ neutrophils, in the BM, and the results suggested that miR-223 blocks the differentiation of GMPs into LyG+ neutrophils. [score:1]
Thus, in this study, we focussed on the role of miR-223 in the pathogenesis of MTD -induced acute ARDS. [score:1]
Then, 2 weeks after transplantation, we observed significant reductions in the frequency of GMPs derived from BM cells of CD45.1+miR-223−/+ mice (Figure 3c), indicating a cell-intrinsic defect in the differentiation of GMPs in miR-223 -deficient mice. [score:1]
For the detection of miR-223, total miRNA was extracted from the BALF using the RNAeasy Small RNA Isolation Kit (Beyotime Biotechnology). [score:1]
MCC950, anakinra and miR-223 mimics all reduced MTD -induced ALI in miR-223−/+ mice. [score:1]
miR-223 was administered as the synthesized mmu-miR-223 via a nanoparticle. [score:1]
The enrichment of miR-223 in RISC was detected using the method described by Llobet-Navas et al. [54] RISC consists of the Dicer enzyme, Argonaute protein, siRNA and other biological macromolecules. [score:1]
Although the miR-223 in patients with ARDS caused by infection and inhalation was not significantly different from that in the control patients, there was a positive linear relationship between the level of has-miR-223 in all patients with ARDS and the prognosis following conventional therapy. [score:1]
24, 36, 37, 38 According to the clinical data we collected, miR-223 levels were positively correlated with LY6G+ cells in the lungs of patients with ARDS, whereas LY6G+ cells had a negative correlation with the prognosis of patients with ARDS, suggesting that LY6G+ cells may mediate the miR-223 mechanism of action. [score:1]
miR-223 administration to mice in vivo. [score:1]
These results indicate that miR-223 deficiency in haematopoietic-derived cells leads to aggravated MTD -induced lung injury in mice. [score:1]
There was a negatively linear relationship between IL-1 β and ΔPaO [2]/FiO [2] or miR-223 in ARDS patients (Supplementary Figure S1C and F), where higher levels of IL-1 β during the acute phase correlated with worse prognosis following conventional therapy. [score:1]
At the same time, the linear relationship between miR-223 and LY6G+ cells (Figure 1e) showed that miR-223 was negatively correlated with the percentage of LY6G+ cells in the lungs of ARDS patients. [score:1]
In addition, WT and miR-223−/+ mice acquired the opposite phenotype after transplantation with the other’s BM, including the PaO [2]/FiO [2] (Figure 2d), lung wet/dry weight ratio (Figure 2e) and the number of inflammatory cells in the lungs (Figure 2c). [score:1]
More importantly, blocking miR-223–NLRP3–IL-1 β could ameliorate the reduction of pulmonary cytokine release following MTD induction, as shown in Figure 7e. [score:1]
To determine whether GMP differentiation to Ly6G+ cells is affected by the intrinsic or extrinsic need for miR-223, we generated BM chimeric mice in which CD45.1+ WT or CD45.1+ miR-223−/+ BM cells were transferred with an equal number of CD45.2+ BM cells into lethally irradiated CD45.2+ recipients. [score:1]
The percentage of Ly6G+ cells in the peripheral blood and BALF of WT mice transplanted with miR-223−/+ mouse BM cells and miR-223−/+ mice transplanted with WT mouse BM cells was also increased and decreased, respectively. [score:1]
We used X-rays to destroy the haematopoietic system of mice and found that WT and miR-223−/+ mice exhibited the opposite lung phenotype in response to MTD induction after transplantation of the other’s BM. [score:1]
Furthermore, BM chimeric mouse experiments showed that miR-223 is essential for the differentiation of GMPs into Ly6G+ neutrophils. [score:1]
In addition, PaO [2]/FiO [2] was significantly decreased (Figure 7c), and the increase in the lung dry/wet weight ratio (Figure 7d) was reversed by the application of MCC950, anakinra and miR-223 mimics. [score:1]
org/) to predict the possibility of miRNA-223 binding to the NLRP3 3′UTR. [score:1]
Next, we examined the effect of MTDs on the level of NLRP3 and IL-1 β in the BMDNs of WT and miR-223−/+ mice. [score:1]
The miRNA223−/+ mice and WT mice were divided into 7 groups (12 mice in each group). [score:1]
These results suggest that miR-223 can lead to a decrease in the number of peripheral Ly6G+ neutrophils, thereby alleviating MTD -induced ALI. [score:1]
Therefore, WT mice and miR-223−/+ mice transplanted with the other’s BM cells exhibited the opposite myeloid cell characteristics, suggesting that miR-223 inhibits the differentiation of GMPs into Ly6G+ cells. [score:1]
BM chimeric mice were constructed using the method described by Zhou et al. [52] Briefly, following exposure to an X-ray dose of 5 Gy × 2, miRNA223−/+ and WT-C57BL/6J mice received an intravenous administration of BM cells (approximately 4 × 10 [6] cells) from miRNA223−/+ or WT-C57BL/6J mice not exposed to X-ray. [score:1]
It is worth noting that, both at the physiological level and MTD -induced level, the Ly6G+ cells in the peripheral blood of miR-223−/+ mice were significantly higher than that in WT mice. [score:1]
To identify the major source of miR-223, we examined the myeloid cell population in WT and miR-223−/+ mouse BALF. [score:1]
The results suggest that miR-223 deficiency leads to an increase in Ly6G+ cells in the peripheral blood of mice. [score:1]
miR-223 from Ly6G+ neutrophils. [score:1]
This evidence suggests that miR-223 deficiency aggravates MTD -induced ALI. [score:1]
In vivo experiments showed that MTDs induce hypoxemia, inflammatory and ALI in WT mice and the miR-223−/+ mice more sensitive to MTD induction. [score:1]
miR-223 blocks granulocyte and monocyte precursors from differentiating into LY6G+ cells. [score:1]
In addition, we analysed the relationship between miR-223 levels from the acute period of ARDS and ΔPaO [2]/FiO [2], using the PaO [2]/FiO [2] difference before and after 4 days of positive end-expiratory pressure (PEEP) treatment as a prognostic index. [score:1]
Thus genetic or pharmacological modulation of the miR-223–NLRP3–IL-1 β pathway may be a promising new treatment for MTD -induced ALI and ARDS. [score:1]
was used to sort the myeloid cells, and miR-223 were detected by qPCR. [score:1]
Figure 3b shows that induction with MTDs resulted in increased myeloid cell populations in the peripheral blood of miR-223−/+ and WT mice. [score:1]
[1 to 20 of 97 sentences]
7
[+] score: 264
It seems contradictory that miR-223 can suppress tumor invasion and metastasis through targeting Artemin [10], but may promote tumor by inhibiting the expression of EPB41L3, a tumor suppressor in human NPC [10]. [score:11]
These findings demonstrated that miR-223 regulates the NPC development by targeting MAFB expression, and implicates miR-223 as a candidate target for NPC diagnosis and treatment. [score:9]
MiR-223 up-regulation in Hela cells inhibits cell proliferation by targeting IGF-1R [9]. [score:7]
d. RT-qPCR confirmed that the gene expression of MAFB was inhibited by miR-223 overexpression. [score:7]
The expression level of miR-223 was also down-regulated in another two NPC cell lines HONE-1 and SUNE-1 (data no shown). [score:6]
In Hela cells, overexpression of MiR-223 suppresses cell proliferation by targeting IGF-1R [9]. [score:6]
The microarray results for miR-223 down-regulated MAFB gene expression were verified through RT-qPCR and. [score:6]
And MAFB expression was decreased accompanied with miR-223 overexpression. [score:5]
These results indicated that miR-223 inhibits the growth and migration of NPC cells through reducing MAFB gene expression. [score:5]
We obtained the consistent result that miR-223 suppressed MAFB gene expression in CNE-2 cells (Fig.   5d). [score:5]
The results are consistent with the discovery in hepatic carcinoma that the inhibition of miR-223 accompanies the enhancement of Stathmin1 expression [24]. [score:5]
Exogenous expression of miR-223 in CNE-2 cells could inhibit cell proliferation both in vitro and in vivo. [score:5]
In addition, both of miR-223 -mimic administration and reduction of MAFB expression all lead to the inhibition of cell growth and migration. [score:5]
The inhibition of MAFB gene expression on protein level through miR-223 mimic administration was confirmed by. [score:5]
On the other hand, there has been another report suggesting that miR-223 functions as a potent tumor suppressor of the Lewis lung carcinoma cell line by targeting insulin-like growth factor-1 [29]. [score:5]
MiR-223 negatively regulates the growth and migration of NPC cells via reducing MAFB expression, and this finding provides a novel insight into understanding miR-223 regulation mechanism in nasopharyngeal carcinoma tumorigenesis. [score:5]
MAFB is identified as a direct target of miR-223. [score:4]
However, in the gastric cancer development, miR-223 acts as an oncogene to promote cell invasion and migration via affecting expressions of EPB41L3 and FBXW7/hCdc4 genes [10, 26, 27]. [score:4]
MiR-223 -mimic administration could lead to the suppression of MAFB expression both in RNA and protein levels. [score:4]
In addition, miR-223 has been report to regulate the proliferation and invasion of human breast cancer cells for targeting Caprin-1 [28]. [score:4]
Exogenously up -regulating miR-223 could suppress cell proliferation and colony formation, increase tumor formation in nude mice (Fig.   2 and 4). [score:4]
Based on miRNA microarray we found that miR-223 was down-regulated in NPC cell line CNE-1 and CNE-2, and further verified the role of miR-223 in NPC pathogenesis. [score:4]
The discrepant results of miR-223 role seemed to indicate that miR-223 regulates different gene expression to play different role in various cancers. [score:4]
Fig. 5MAFB is a direct target gene of miR-223. [score:4]
In hematopoietic cells, miR-223 can negatively post-transcript regulate the expression of LMO2 and CEBP-β to reduce cell proliferation [25]. [score:4]
Exogenous miR-223 inhibits cell proliferation and colony formation in vitro. [score:3]
In our study, we demonstrated that exogenous miR-223 inhibits CNE-2 cell migration and invasion (Fig.   3). [score:3]
This observation suggested that miR-223 may inhibit the proliferation of NPC cells. [score:3]
After miR-223 mimic and negative control microRNA transfected, we found that 39 transcripts were differentially expressed between two groups. [score:3]
As miR-223 maybe also targets other genes in nasopharyngeal carcinoma, further analyses are needed to elucidate the full spectrum of miR-223 functions. [score:3]
Real-time quantitative PCR and were used to confirm miR-223 and MAFB expression levels. [score:3]
a. The RT-qPCR confirmed that the miR-223 expression was significantly lower in CNE-1 and CNE-2 than that in NP69 (*P < 0.05). [score:3]
These results demonstrated that miR-223 inhibits the migration and invasion of NPC cells in vitro. [score:3]
To fully realize its effect, we observed that miR-223 inhibited NPC cell growth, migration and invasion both in vitro and in vivo. [score:3]
Here, we identified miR-223 as down-regulated in undifferentiated nasopharyngeal carcinoma cell line CNE-2, compared with immortalized nasopharyngeal epithelial cell line NP69. [score:3]
To investigate the mechanism of miR-223 inhibition NPC cells, we performed a cDNA expression microarray analysis. [score:3]
Fig. 3Exogenous miR-223 suppresses cell migration and invasion in vitro. [score:3]
c. The cDNA microarray analysis revealed that there were 39 differentially expressed genes between the CNE-2 transfected with miR-223 mimics and the CNE-2 transfected with negative control. [score:3]
MAFB, a transcription factor of Maf family members, was identified as a target gene of miR-223. [score:3]
Those transcripts have not been reported as targets for miR-223. [score:3]
These results indicated that exogenous miR-223 suppresses tumor growth in vivo. [score:3]
In this study, we found the reduction of miR-223 expression both in NPC cells and in NPC patients’ plasma. [score:3]
These results encouraged us to check the expression level of miR-223 in clinical specimens. [score:3]
org [13], were used to predict the interaction probability between miR-223 and MAFB, including binding sites for miR-223 in MAFB and the targeting efficiency. [score:3]
The findings implicated that miR-223 could be a potential target for intervention and diagnosis to NPC. [score:3]
As shown in Fig.   2c and d, both plate and soft agar colony formation abilities were suppressed by exogenous miR-223 in CNE-2 cells. [score:3]
The mutated MAFB 3’UTR containing mutations of the miR-223 binding sit was obtained using GeneTailor Site-Directed Mutagenesis System (Invitrogen), namely mutated 3’UTR (mt-UTR). [score:3]
The miR-223 expression was analyzed with U6 as a normalizer. [score:3]
Fig. 2Exogenous miR-223 suppresses cell proliferation and colony formation in vitro. [score:3]
c. The miR-223 expression was significantly decreased in NPC patients’ plasma. [score:3]
b. RT-qPCR confirmed that the miR-223 expression was significantly lower in CNE-1 and CNE-2 than that in NP69 (*P < 0.05). [score:3]
The data were showed as means ± SD (n = 10) In vitro, the cells transfected with miR-223 mimics showed a higher miR-223 expression level (Fig.   2a). [score:3]
MAFB was identified as a miR-223 target gene. [score:3]
MiR-223, which was recently identified to be related with migration and invasion of malignant tumors, was lower expressed in NPC cell lines CNE-1 and CNE-2. We employed RT-qPCR to validate the microarray results and a consistent result was observed (P < 0.05; Fig.   1b). [score:2]
MiR-223 expression is significantly lower in CNE samples than control samples. [score:2]
MiR-223 suppresses tumor growth in vivo. [score:2]
By wound healing assay, we found that exogenous miR-223 inhibited CNE-2 cell migration (Fig.   3a). [score:2]
Compared with NP69, miR-223 expression was significantly lower in NPC cell line CNE-1 and CNE-2 (Fig.   5a) that was consistent with the miRNA microarray results (Fig.   1a). [score:2]
Our results illuminate the role of miR-223 in NPC development and provide valuable information for clinical implications. [score:2]
a. RT-qPCR result confirmed that the miR-223 expression was significantly higher as compared with untreated and control group after exogenous miR-223 transfection in CNE-2 (*P < 0.05). [score:2]
Consistently, the results of in vitro transwell migration and Matrigel invasion assay showed that exogenous miR-223 inhibited CNE-2 cells migration and invasion (Fig.   3b and c). [score:2]
* indicates P < 0.05 compared with control group The proliferation inhibition of miR-223 in CNE-2 cells prompted us to examine the effect of miR-223 on the migration and invasion of NPC cells. [score:2]
Li J, Guo Y, Liang X, Sun M, Wang G, De W, Wu W: MicroRNA-223 functions as an oncogene in human gastric cancer by targeting FBXW7/hCdc4. [score:2]
The targeting relationship between miR-223 and MAFB was verified using dual luciferase reporter assay. [score:2]
MiR-223 inhibits NPC cell migration and invasion. [score:2]
* indicates P < 0.05 compared with control group As exogenous miR-223 suppresses cell proliferation of NPC cells in vitro, we examined the effect of miR-223 in vivo. [score:2]
We found that the average miR-223 level was significantly lower in the plasma of 10 NPC patients than that from 10 normal healthy subjects. [score:1]
Extrogenous miR-223 in CNE-2 cells would decrease the ability of colony formation and migration. [score:1]
The plasma miR-223 levels in NPC patients were detected by TaqMan analysis. [score:1]
a. The appearance of xenograft subcutaneous NPC in miR-223 mimics transfection and control groups. [score:1]
As a result, the growth rate was significantly decreased in CNE-2 cells due to exogenous miR-223 (Fig.   2b). [score:1]
MiR-223 was firstly reported to be involved in the regulation of human granulopoiesis [6, 7]. [score:1]
CNE-2 cells transfected with miR-223 mimic and control microRNA (2 × 10 [6]) or MAFB specific siRNA and negative control siRNA in 100 μl no serum medium were injected respectively into particular side of each mouse. [score:1]
The expression of miR-223 was measured by real-time quantitative PCR (RT-qPCR) by using One Step SYBR® PrimeScript® RT-PCR Kit II (Takara) and following the manufacturer’s protocol on ABI 7500 HT real-time PCR detection system as normalized to the housekeeping gene U6. [score:1]
MiR-223/Ect2/p21 signaling regulates osteosarcoma cell cycle progression and proliferation [35]. [score:1]
These findings suggest that miR-223 is associated with migration and invasion of malignant tumor. [score:1]
After 24 h transfection of miR-223 mimic and negative control in CNE-2, total RNA was isolated and hybridized to an Affymetrix GeneChip Human Genome U133 Plus 2.0 Array. [score:1]
The potential role of miR-223 mimic in cell proliferation and colony formation was observed. [score:1]
The total tumor size for negative control and miR-223 mimic transfected groups was 995.37 ± 674.63 and 598.38 ± 613.23 mm [3] respectively (Fig.   4c). [score:1]
However, to our knowledge, the role of miR-223 in nasopharyngeal carcinogenesis remains undefined. [score:1]
After injected with CNE-2 cells that were transfected with miR-223 mimic or control microRNA respectively, we found that tumors grew at a slower rate and had smaller sizes (Fig.   4a- b). [score:1]
Fig. 4Exogenous miR-223 attenuates nasopharyngeal tumor growth in mouse xenograft mo dels. [score:1]
c. Total tumor weight of miR-223 mimic transfection and control groups. [score:1]
a. The function of exogenous miR-223 on CNE-2 cells migration. [score:1]
org software to predict the potential targets for miR-223 and combined the results to select MAFB for further investigation. [score:1]
The miR-223 expression was decreased in CNE-1, CNE-2 cells as compared with NP69 cells, an immortalized human nasopharyngeal epithelial cell line, and its level also reduced in NPC patients’ plasma as compared with healthy controls. [score:1]
The above-mentioned reports with our study indicate that miR-223 could be a serum biomarker of NPC patients to give early diagnosis for optimal treatment. [score:1]
[1 to 20 of 87 sentences]
8
[+] score: 260
To identify diseases, functions and pathways controlled by miR-223, we used the pool of 1995 miR-223 predicted targets (predictions by two out of the following four algorithms, TargetScan v5.2, Miranda, August 2010, MicroCosm (miRBase) Targets v5 and DIANA-microT v3) to run an (IPA). [score:9]
In particular, miR-19 was reported to be upregulated in the Basal subtypes, miR-200c downregulated in Normal-like tumors and miR-223 downmodulated in luminal-B breast cancers [64]. [score:7]
Given that miR-223 is expressed in stroma cells, that it is expressed in tumor samples and that it could be transferred to breast cancer cells from surrounding cells, we evaluated miR-223 biological functions or target gene expression in MDAMB231 or SUM149PT cells. [score:7]
Biological analyses on miR-223 overexpressing cells in culture, following CM treatment or overexpression (pre-miR or expression vectors), proved that miR-223 participates to relevant cell functions. [score:7]
Only miR-223 targets predicted by at least two out of 4 prediction algorithms (TargetScan, release 5.2, Miranda, release August 2010, MicroCosm (miRBase) Targets v5 and DIANA-microT v3.0) were considered for (IPA) [42], [43], [44], [45]. [score:6]
When HeLa cells were co -transfected with miR-223 and reporter vectors containing the full length wild type (STAT5A) or mutated (STAT5AMUT) 3′UTR or empty vectors, a significant decrease in luciferase activity was specifically observed when miR-223 was overexpressed with wild type but not mutant STAT5A 3′UTR reporter vector, indicating a direct targeting for miR-223 on STAT5A 3′UTR (Figure 5D). [score:6]
0084859.g005 Figure 5 of miR-223 predicted targets and STAT5A direct targeting. [score:6]
Ingenuity Pathway Analysis of miR-223 predicted targets and STAT5A direct targeting. [score:6]
ITGA3, NRAS, STAT5A (all miR-223 predicted targets) protein expression was evaluated in stably or transiently miR-223 overexpressing (miR-223 or pre-miR-223) or control (empty or pre-control) MDAMB231 or SUM149PT cells (Figure 5B). [score:5]
When MDAMB231 or SUM149PT cells were stably transduced with miR-223 overexpressing (miR-223) or empty (empty) lentiviral vectors, or transiently transfected with miR-223 precursors or controls (pre-miR-223, pre-control), or grown in miR-223 overexpressing or control HEK293 CM, increased (200 to 10,000 folds) levels of miR-223 were obtained (Figure S2C–F). [score:5]
Diseases and functions related to miR-223 predicted targets. [score:5]
We further confirmed that conditioned medium (CM) from miR-223 overexpressing fibroblasts or HEK293 cells led to increased miR-223 expression in MDAMB231 cells suggesting a transfer of miR-223 from cell to cell. [score:5]
We exploited this database to look for enrichments in cellular functions, pathways or disease related genes among miR-223 putative targets. [score:5]
Considering that our expression analyses revealed that miR-223 is not present in tumor cell lines in culture, while it is expressed in stroma cells, we hypothesized a possible tumor-stroma interaction within the tumor mass. [score:5]
miR-223 expression in MDAMB231 cells grown in Conditioned Medium from miR-223 overexpressing cells. [score:5]
miR-223 over -expression was able to downmodulate NRAS, ITGA3 and STAT5 expression at the protein level. [score:5]
This was done by overexpressing miR-223 in tumor cells or by growing them in presence of conditioned medium (CM) derived from cells overexpressing miR-223 (see above). [score:5]
To note that miR-223 was not endogenously expressed by HEK293 cells, while expression was found in MEFs. [score:5]
While for miR-200b, miR-203 and miR-340 expression was low also in microenvironmental cells, for miR-223 a high expression (10 to 5000 fold increase) was observed in stroma cells compared to breast tumor cells. [score:4]
We identified STAT5A as direct target of miR-223 and correlated STAT5A with miR-223 functions. [score:4]
Instead, NRAS is a well-known oncogene, often constitutively active in breast cancer, along with PI3K members and regulators, which are also miR-223 predicted targets. [score:4]
Good/high levels of miR-223 expression were found in MDAMB231 cells when CM from miR-223 -overexpressing or control MEFs or HEK293 cells was used, compared to normal growth medium (Figures 2A, B and S2) suggesting a transfer of miR-223 from MEFs or HEK293 cells to MDAMB231 cells. [score:4]
While no effect on cell death was observed for ZVAD in absence (Basal+ZVAD) of PTX, a cell death inhibitory effect was observed in presence of PTX (PTX+ZVAD), for miR-223 overexpressing cells compared to controls (Figure 4E and S4E, F). [score:4]
miR-223 Affects Signal Transduction Pathways Involved in Cell Death and Directly Targets STAT5A. [score:4]
The number of predicted miR-223 targets assigned to each group is reported in the last column. [score:3]
Moreover miR-223 was found differentially expressed in ER+ and ER- tumors [13], [46], [65]. [score:3]
As shown in Figure S1B, good expression of miR-223 is visible in tumor or stroma components of breast cancer samples as well as in lymph nodes, while MDAMB231 cells are empty. [score:3]
A down-modulation of 60–80%, 28–50% and 28–40% was observed respectively for ITGA3, NRAS and STAT5A in miR-223 overexpressing cells. [score:3]
Figure S2 miR-223 expression levels in various cell lines. [score:3]
Alternatively MDAMB231 were grown for 48 h in conditioned medium (CM) collected from HEK293 (HEK) cells stably transduced with pLemiR empty (empty) or miR-223 overexpression (miR-223) vectors. [score:3]
By using the (IPA) for the predicted miR-223 targets, the involvement of miR-223 in cancer and mainly in cell death emerged. [score:3]
6.5×10 [4] cells were cotransfected with 50 ng of the pMIR REPORT™ (Ambion, Austin, TX) Firefly Luciferase constructs containing the 3′UTRs of the indicated miR-223 potential target, 20 ng of pRL-TK Renilla Luciferase normalization control (Promega, Madison, WI) and 75 nM of the indicated pre-miR using Lipofectamine [TM]2000 (Invitrogen Life Technologies, Carlsbad CA). [score:3]
miR-223 Expression Enhances Cell Death in Anoikis Conditions or in Presence of Chemotherapeutic Drugs. [score:3]
Since miR-223 was the only putative small RNA to be expressed uniquely in stroma but not in tumor cells in culture, we hypothesized a possible transfer of miR-223 from stroma to tumor cells within the human tumor mass. [score:3]
Alternatively, CM was derived from the cells in (A) stably transduced with miR-223 overexpression (miR-223) lentiviral vectors (B). [score:3]
Direct targeting was evaluated on STAT5A 3′UTR in a luciferase assay in miR-223 overexpressing and control (pre-miR-223, pre-control) cells. [score:3]
We exclude an induction of endogenous miR-223 in MDAMB231 cells by secreted factors present in the CM (i. e. growth factors, cytokines), since CM from miR-223-empty cells does not affect miR-223 expression in MDAMB231 cells. [score:3]
All these findings support our data, regarding the involvement of miR-223 and its target STAT5A in both anti-migratory and pro-chemotherapeutic effects and guide us to configure miR-223 as a player of the microenvironment in breast cancer. [score:3]
MDAMB231 cells were transfected with miR-223 or their negative controls (pre-miR-223 or pre-control) or stably transduced with pLemiR empty (empty) or miR-223 overexpression (miR-223) vectors or pre -treated for 48 h with conditioned medium (CM) collected from stably transduced HEK293 (HEK) cells with the above mentioned vectors (CM HEK empty or CM HEK miR-223). [score:3]
In experiments in which Conditioned Medium (CM) was used, MDAMB231 cells were grown, at different time points, in CM collected from MEFs (P3) or HEK293 cells stably transduced (or not) with pLemiR-empty (empty) or pLemiR-miR-223 (miR-223) expressing lentiviral vectors. [score:3]
These findings suggest an anti-invasive function of miR-223 expressed in tumor cells or transferred from surrounding cells. [score:3]
Similar results were obtained when MDAMB231 cells were grown for 48 hours in the presence of CM derived from miR-223 overexpressing HEK293 (HEK) cells (Figure 4D and S4D). [score:3]
In breast cancer, our findings suggest a suppressive role for miR-223 in tumor progression, similar to what proposed by [67] and more recently by Gong and colleagues [72]. [score:3]
In line with miR-223 function are the evidences that integrins, in particular ITGA3 and ITGB1, are key mediators of the outside-in and inside-out signalling in cancer and their depletion leads to decreased migratory abilities and inhibition of metastasis formation [77]. [score:3]
As a control of cell death, we performed an experiment with MDAMB231 cells transiently transfected with miR-223 precursors or controls (pre-miR-223, pre-control) in which cells were kept or not in presence of PTX and ZVAD, a caspase inhibitor. [score:3]
In a second approach, we evaluated miR-223 expression in MDAMB231 cells grown for 48 hours in presence of a conditioned medium (CM) derived from mouse embryonic fibroblasts (MEFs) or HEK293 cells or from the same cells previously transduced with miR-223 lentivirus vectors (expression levels in Figure S2A–B). [score:3]
Figure S1 miR-223 expression in stroma or tumor cell areas of paraffin-embedded tumor samples. [score:3]
No effect was found on cell adhesion and proliferation however a relevant inhibitory role was observed for miR-223 on migration and invasion as well as on cell survival in anoikis conditions or in presence of chemotherapeutic drugs suggesting various interventions during tumor progression. [score:3]
Specific enrichment was found for the already validated miR-223 targets, IGFR1 and E2F pro-survival genes and for NRAS, ITGA3 and STAT -family members. [score:3]
The ratio between miR-223 predicted targets (numbers in each bar) and the total number of genes in each pathway (not shown) is indicated by light–grey squares in each bar (relative to the right Y-axes). [score:3]
Alternatively MDAMB231 cells were grown for 48 h in condition medium (CM) collected from HEK293 (HEK) cells stably transduced with pLemiR empty (empty) or miR-223 overexpression (miR-223) vectors and further transferred to regular medium without (Basal) or with PTX for 48 hours and cell death was analyzed (D). [score:3]
It is important to note that overlapping functions of miR-223 and miR-148b could be due to common target genes, in fact miR-148b shares four nucleotides of the seed region with miR-223. [score:3]
However, even if we proved that STAT5A is a direct target for miR-223 with the luciferase assay, and observed that decreased (RNAi) or increased (cDNA, data not shown) levels of STAT5A lead to modulation of cell migration or chemotherapy induced cell death, further rescuing experiments are necessary to confirm that STAT5A is one of the main players of miR-223. [score:3]
miR-223 has an anti-proliferative function in cervical and colon-rectal cancer through the targeting of IGFR and FOXO1 [68], [69] and it exerts an anti-metastatic role in oesophageal carcinoma [70]. [score:3]
Representative images of transwell migration (top) or matrigel invasion (bottom) assays corresponding to Fig. 3. MDAMB231 cells were transfected with miR-223 or unrelated miR precursors or their negative controls (pre-miR-223 or unrelated pre-miR or pre-control) or stably transduced with pLemiR empty (empty) or miR-223 overexpression (miR-223) vectors or pre -treated for 48 h with conditioned medium (CM) collected from stably transduced HEK293 (HEK) cells (CM HEK empty or CM HEK miR-223). [score:2]
miR-223 binding site in the 3′UTR was mutagenized (STAT5AMUT) using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Cedar Creek, TX) according to the manufacturer’s instructions. [score:2]
Instead a 10% to 40% decrease in cell migration and invasion was found in transwell assays with or without matrigel (Figure 3A–F and S3) in presence of miR-223 overexpression or CM. [score:2]
This approach unravelled a group of six microRNAs, miR-19ab, miR-200bc, miR-203, miR-21, miR-223 and miR-340, predicted to be deregulated during breast cancer progression. [score:2]
When MDAMB231 cells were treated for 48 hours with conditioned medium (CM) derived from miR-223 overexpressing HEK293 (HEK) cells, decreased levels of STAT5A were observed compared to controls, suggesting a transfer of miR-223 from CM to MDAMB231 cells acting on STAT5A levels. [score:2]
are presented as fold changes (mean±SD) relative to miR-223 level in MDAMB231 cells. [score:1]
Datasets hsa-miR-19ab-3p hsa-miR-200bc-3p hsa-miR-203a hsa-miR-21-5p hsa-miR-223-3p hsa-miR-340-5p Desmedt C et al. Clin Cancer Res2007 GSE 7390 – – – x(2) x(1) x(2) Miller LD et al. Proc Natl Acad USA2005 GSE 3494 x(3) x(3) x(3) x(3) x(3) x(3) Pawitan Y et al. Breast Cancer Res2005 GSE 1456 x(3) x(3) x(3) x(3) x(3) x(3)Significant enrichments of our six microRNAs among genes expressed in Recurrent (+) versus Non-Recurrent (−) samples, in the indicated breast cancer datasets, as evaluated by [47]. [score:1]
Bottom panel: human miR-223 sequence paired with a portion of the human STAT5A 3′UTR including the wild type or mutant binding site for miR-223. [score:1]
So far we only evidenced a functional correlation between miR223 and STAT5A. [score:1]
The function of miR-223 in tumors remains however still unclear and it depends on the kind of analyzed tumor. [score:1]
In this way we identified miR-19ab, miR-200bc, miR-203, miR-21, miR-223 and miR-340 as putative players of breast cancer progression. [score:1]
STAT5A downmodulation phenocopies miR-223 functions. [score:1]
Among them, we studied the function and the molecular mechanism of miR-223 in breast cancer malignancy. [score:1]
This is supported from data in the literature showing that miR-223 can be transferred to breast tumor cells from bone marrow stroma [67] or microvesicles derived from IL-4 activated macrophages [17]. [score:1]
These data correlate the role of STAT5A with miR-223 in cell movement and death. [score:1]
Considering that chemotherapy is the main therapeutic strategy against tumor cells, we investigated the effects of miR-223 overexpression on cell death induced by doxorubicin (DOXO) or paclitaxel (PTX) for 48 hours. [score:1]
In conclusion, we identified 6 microRNAs with a role in breast cancer progression and unravelled some functions of miR-223, a small RNA present in tumor and stroma cells, in breast cancer samples. [score:1]
Other putative miR-223 targets are currently under investigation. [score:1]
In addition, the analysis of RNA from punches of tumor or stroma components of breast samples revealed that miR-223 is equally present in the two tumor portions. [score:1]
Increased cell death was observed in MDAMB231 cells transiently transfected with miR-223 precursors or controls (pre-miR-223, pre-control and unrelated-pre-miR) (Figure 4B, C and S4B, C). [score:1]
To verify our hypothesis, we first evaluated miR-223 expression in pools of RNA derived from tumor or stroma components of human breast tumor samples following dissections (punches) performed in paraffin embedded tumors or stroma as shown in Figure S1A. [score:1]
Cells were transiently transfected with miR-223 or with unrelated miR precursors or their negative controls (pre-miR-223 or unrelated pre-miR or pre-control). [score:1]
Down-modulation of STAT5A Accounts for miR-223 Biological Effects. [score:1]
In this way, a group of six microRNAs, miR-19ab, miR-200bc, miR-203, miR-223, miR-21 and miR-340 (as from miRBase v13) or miR-19ab-3p, miR-200bc-3p, miR-203a, miR-223-3p, miR-21-5p and miR-340-5p (as from miRBase v20) was revealed. [score:1]
MDAMB231 cells were grown for 48(A) or in complete medium with Doxorubicin (DOXO) (B) or Paclitaxel (PTX) (C) after transient transfection with miR-223 or with unrelated miR precursors or their negative controls (pre-miR-223 or unrelated pre-miR or pre-control). [score:1]
miR-223 reduces cell migration and invasion. [score:1]
microRNA precursors: Pre-miR™ microRNA Precursor Molecules for Negative Control#1, Hsa-miR-223 (PM12301) or Hsa-miR-203 (PM10152) and Hsa-miR-196 (PM10068) used as unrelated microRNAs (controls for some experiments). [score:1]
miR-223 Impairs Tumor Cell Migration and Invasion. [score:1]
miR-223 binding site on STAT5A 3′UTR was then mutagenized as described for pMIR REPORT-luciferase-STAT5A. [score:1]
The potential role of STAT5A as a mediator of miR-223 effect on transwell migration or paclitaxel (PTX) induced cell death was evaluated in STAT5A-silenced MDAMB231 cells in which a 40% reduction in protein expression was observed as assessed by western blot analysis (Figure 6A). [score:1]
0084859.g004 Figure 4MDAMB231 cells were grown for 48(A) or in complete medium with Doxorubicin (DOXO) (B) or Paclitaxel (PTX) (C) after transient transfection with miR-223 or with unrelated miR precursors or their negative controls (pre-miR-223 or unrelated pre-miR or pre-control). [score:1]
miR-223 enhances anoikis and chemotherapy induced cell death. [score:1]
All tumor cells resulted almost empty for miR-223 and miR-340, while showed variable levels for miR-200b and miR-203 and higher levels of miR-19 and miR-21. [score:1]
In this way, we used three datasets [37], [38], [39] for microRNA predictions and, once more, miR-19ab, miR-200bc, miR-203, miR-223, miR-21and miR-340 were predicted (Table 1). [score:1]
Figure S3 Representative images of migration and invasion experiments for miR-223. [score:1]
Relevantly, miR-223, like other microRNAs such as miR-31 [73], miR-148b [46] and miR-200bc [74], is involved in drug sensitivity, suggesting a potential function as adjuvant therapy, as recently reported also by [75], [76]. [score:1]
Experimentally, we focused on miR-223 and analyzed its role in cell death induced by chemotherapy compounds and cell migration. [score:1]
[1 to 20 of 91 sentences]
9
[+] score: 255
TS1,target site 1 (a pooly conserved binding site); TS2, target site 2 (a conserved binding site); Bottom panel: with targets and their mutant along with miR-223/miR-Con overexpressing vectors. [score:9]
above demonstrate that miR-223 contributes to hypoxia -induced phosphorylation of MYPT1 by targeting RhoB and more importantly, has a direct inhibitory effect on MLC2 expression. [score:8]
Overexpression of miR-223 caused a remarkable decrease in MLC2 protein levels, while miR-223 inhibition increased the expression of MLC2. [score:7]
Chemically synthesized miRNA mimics or inhibitors to overexpress or inhibit miR-223 and each unrelated negative control (miR-Con or anti-Con), were purchased from Ribobio (Guangzhou, China). [score:7]
The correlation between the expression of RhoB and miR-223 was ascertained in primary culture of PASMC and in an in vivo PAH rat mo del by both miR-223 overexpression and/or knockdown approaches. [score:6]
To determine whether miR-223 expression in PASMC parallels expression in lungs of hypoxic mice, we isolated PASMC from Sprague-Dawley rats and exposed them to hypoxia. [score:5]
Our study demonstrates that miR-223 regulation directly targets RhoB and MLC2 to affect vascular remo deling and hypoxia -induced pulmonary hypertension. [score:5]
Here, we discovered that treatment with miR-223 agomir markedly attenuates chronic hypoxia -induced pulmonary vascular remo deling in vivo, due to its post-transcriptionally inhibitory effects on RhoB and MLC2 expression. [score:5]
Cells at 70% confluence after overnight culture on petri dishes were transfected with miR-223 mimic, mimic control (miR-Con) (50 nmol/L), or miR-223 inhibitors (anti-223), inhibitor control (anti-Con) (100 nmol/L) by Lipofectamine 2000 (Invitrogen). [score:5]
TargetScan predicted RhoB having two miR-223 target sites and defined site 1 as poorly conserved and site 2 as a conserved site. [score:5]
Therefore, a small molecular drug, like miR-223, may improve efficacy by targeting the RhoB/Rho Kinase/MLC2 signaling in pulmonary vascular diseases. [score:5]
miR-223 overexpression and inhibition. [score:5]
We elucidate a RhoB/ROCK -associated regulatory pathway that is suppressed by miR-223 and the decrease of miR-223 in hypoxia leads to pathologic changes in PASMC (as summarized in Fig. 7). [score:4]
The results above clearly show that RhoB is a direct target of miR-223 in PASMC. [score:4]
To determine how miR-223 regulates PASMC proliferation, migration and consequently pulmonary vascular remo deling, we identified the miR-223 target proteins involved in these processes. [score:4]
miR-223 is downregulated by hypoxia in PASMC. [score:4]
Identification of RhoB and MLC2 as direct targets of miR-223. [score:4]
Validation of miR-223 downregulation by hypoxia in mouse lungs (B), rat lungs, n = 8 (C) and rat pulmonary arteries (PA), n = 8 (D) was performed by qRT-PCR. [score:4]
In our study, we uncovered that there are gender differences in downregulation of serum levels of circulatory miR-223 in patients with CHD-PAH. [score:4]
Reporter gene analysis revealed that mutation of site 2 resulted in complete loss of the inhibitory activity of miR-223, while site 1 mutation showed no activity change compared to wild type construct, although it indicates that there may be more bases pairing with miR-223. [score:4]
This study reveals that miR-223 is rapidly downregulated in response to hypoxia in PASMC and is critical to chronic hypoxia -associated pulmonary vascular pathology, such as smooth muscle cell proliferation, migration and actomyosin reorganization, which ultimately results in vascular remo deling and distal arteriole muscularization. [score:4]
During the preparation of this manuscript, Meloche et al. most recently showed that miR-223 was downregulated in PAH-PASMCs and lungs of monocrotaline -treated PAH rats. [score:4]
Here we further corroborated RhoB as a direct target of rno-miR-223 in rat PASMC. [score:4]
Overexpression of miR-223 using agomir antagonized the hypoxic effects on pulmonary artery pressure and distal arteriolar muscularization in vivo. [score:3]
Comparable results were obtained when expression of miR-223 was studied in human PASMC (hPASMC) under hypoxic conditions (Fig. 1E, right panel). [score:3]
The results fit well with a recent report that hsa-miR-223 interacts with RhoB, in which the authors proposed that some AU-rich motif located upstream of distal miR-223 -binding site enhances the miRNA function, independent of the miRNA target sequence being tested 41. [score:3]
Moreover, the altered migration in miR-223 -expressing cells was associated with a decrease in stress fiber levels, a feature reflected by the higher F-actin content in cells that have active actomyosin contraction (Fig. 2D). [score:3]
miR-223 inhibits PASMC proliferation, migration and stress fiber formation. [score:3]
It was previously reported that the 3′-UTR of RhoB could be targeted by hsa-miR-223 in human cell lines 41. [score:3]
After RVSP recording, whole blood were collected via right ventricular puncture, filled in 1.5 ml tubes, centrifuged for 3,000 × g for 10 min at 4 °C, and serum collected for detection of miR-223 expression levels. [score:3]
Rats were injected with either agomir control (miR-Con) or agomir specifically expressing miR-223 (miR-223). [score:3]
Mutation of the downstream binding site (Mut 2) completely antagonized the inhibitory effect of miR-223 in the luciferase assay. [score:3]
HEK293 cells were seeded in 24-well plates and after the cells reached 80~90% confluence, each well of cells was transfected with 100 ng of 3′-UTR reporter vectors or mutated 3′-UTR reporter vectors, 900 ng of miR-223 expressing plasmid (pLVX-CMV-miR-223) with 2 μl of Lipofectamine 2000 (Invitrogen, Carlsbad, CA). [score:3]
Notably, a negative correlation of total MLC2 expression and miR-223 levels was found in rPASMC and hPASMC (Fig. 5D). [score:3]
A negative correlation between the expression of miR-223 and RhoB protein was detected in mouse lungs, as well as in rat and human PASMC exposed to hypoxia (Fig. 4A). [score:3]
We have not explored the miR-223 expression and RhoB/ROCK/MLC pathway in pulmonary artery endothelial cells (PAECs), the abnormality of which also contributes to the pathology of pulmonary arterial hypertention. [score:3]
In order to validate RhoB as a direct target of miR-223, we performed a reporter gene assay to ascertain the interactions between miR-223 and RhoB 3′-UTR. [score:3]
Our data show that increasing the expression of miR-223 abrogated the hypoxia -induced increase in proliferation, migration, as well as stress fiber assembly in both rPASMC and hPASMC. [score:3]
miR-223 inhibition also enhanced the phosphorylation of MYPT1 and MLC2, partially mimicking the effects of hypoxia. [score:3]
Hypoxia decreases miR-223 expression in lungs, pulmonary artery and pulmonary arterial smooth muscle cells. [score:3]
The mRNA level of RhoB in both hypoxia -treated rPASMC and hPASMC was also negatively correlated with miR-223 expression (Fig. 4B). [score:3]
Rangrez et al. found that overexpressing miR-223 in aortic vascular smooth muscle cells (VSMCs) increased proliferation and markedly enhanced cell migration 38, demonstrating miR-223 may function in a tissue-specific manner. [score:3]
Conversely, miR-223 inhibition augmented the proliferation of PASMC under normoxic conditions (Supplementary Figure S2A, B). [score:3]
miRNA target prediction with FINDTAR3 indicated a potential miR-223 binding site in the 3′-UTR of MLC2. [score:3]
This study identifies miR-223 as a potential target in experimental PAH and the possible benefits of miR-223 agomir therapy in its treatment. [score:3]
In this study, we discovered a decrease in expression of miR-223 in hypoxia -induced PAH mouse lungs, pulmonary artery and isolated PASMC. [score:3]
Conversely, overexpression of miR-223 reduced the levels of phosphorylated MYPT1 and MLC2 (Fig. 5D). [score:3]
Rho GTPase activation assay showed that miR-223 not only repressed the expression of RhoB but also markedly reduced its activity (Fig. 5C). [score:2]
The results revealed that standing out from 1040 miRNAs measured, there were five significantly changed miRNAs between normoxia and hypoxia (p < 0.01) and miR-223 (also called miR-223-3p) was the most significantly downregulated miRNA (Fig. 1A). [score:2]
It still remains unknown if there is a relationship between miR-223 reduction in female serum and gene regulatory abnormality on X chromosome in CHD-PAH patients. [score:2]
For miRNA assay, the mature miR-223 expression level was determined according to S-Poly(T) method, as we previously reported 53 54. [score:2]
To confirm the consequences of miR-223 on cell proliferation, EdU incorporation assay and PCNA immunoblotting were also performed in cells transfected with miR-223 inhibitor. [score:2]
Furthermore, enhanced expression of miR-223 also inhibited hypoxia -induced increase in cell migration in both rPASMC and hPASMC, as measured using a chamber invasion assay of cells passing through a transwell filter (Fig. 2C). [score:2]
Data are shown as means ± SE, ** p < 0.01. miR-223 attenuates hypoxia -induced smooth muscle cell proliferation, migration and actomyosin reorganization, and the consequent vascular remo deling and pulmonary hypertension by regulating the RhoB/MLC pathway. [score:2]
MiR-223 targets RhoB and MLC2 in pulmonary arterial smooth muscle cells. [score:2]
Further, we demonstrated the 3′-UTR of MLC2 mRNA was post-transcriptionally regulated by miR-223. [score:2]
An independent quantitative real-time PCR (qRT-PCR) assay confirmed the decreased expression of miR-223 in mouse lungs in response to hypoxia (Fig. 1B). [score:2]
Notably, the two target sites when tested in the assay exhibited substantial differences in their susceptibility to miR-223 mediated repression. [score:2]
How to cite this article: Zeng, Y. et al. MicroRNA-223 Attenuates Hypoxia -induced Vascular Remo deling by Targeting RhoB/MLC2 in Pulmonary Arterial Smooth Muscle Cells. [score:2]
Upper panel: putative miR-223 binding sites in the 3′-UTR of RhoB or MLC2 along with the mutation sites. [score:2]
They reported that miR-223 played anti-proliferative and pro-apoptosis roles in PAH-PASMC by directly repressing PARP-1 40. [score:2]
Co-transfection of HEK-293 cells with pre-miR-223 and a luciferase construct containing the two putative miR-223 binding sequences within the 3′-UTR of RhoB resulted in a significant decrease (about 50%, p < 0.01) in luciferase activity, indicating direct interaction between them. [score:2]
EdU incorporation assay and PCNA immunoblotting showed that miR-223 overexpression significantly prevented the increase in cell proliferation induced by hypoxia (Fig. 2A,B). [score:2]
As miR-223 locus is located on the X chromosome, a new study was carried out on 13 male CHD-PAH patients/ healthy donors or 17 female CHD-PAH patients/ healthy donors to determine whether gender differences exist (Supplementary Table S1). [score:1]
All the results above indicate that miR-223 is involved in the proliferative and migratory responses in PASMC to hypoxia. [score:1]
miR-223 agomirs (30 nmol), agomir control (30 nmol), or the normal saline (NS) were injected intravenously (tail vein, 0.3 ml) at day 7 and 14. [score:1]
A recent study on circulating miRNAs as potential markers for pulmonary hypertension by using a microarray approach identified that plasma miR-223 levels were decreased in these patients 34. [score:1]
To confirm our findings in vivo, we determined the effect of administering an agomir of miR-223 or an unrelated agomir control on right ventricular systolic pressure (RVSP) and pulmonary vascular muscularization in rats exposed to chronic hypoxia. [score:1]
We observed a 50% decrease in miR-223 levels, with a maximal decrease after 6 to 12 hours of hypoxia (Fig. 1E, left panel). [score:1]
It also suggests a potential use of miR-223 levels as a circulating biomarker for clinical diagnosis in women with CDH-PAH. [score:1]
Serum miR-223 is a potential circulating biomarker for PAH. [score:1]
These results point to miR-223 as a miRNA that is decreased by hypoxia in PASMC. [score:1]
Recently, Shi et al. reported that miR-223 antagonizes angiogenesis by abrogating VEGF and bFGF -induced cell proliferation, migration and tube formation in vascular endothelial cells 27. [score:1]
Another study on 7 male and 17 female CHD-PAH patients/ healthy donors (Supplementary Table S2) showed significant decrease in circulating miR-223 levels in CHD-PAH patients and confirmed the gender-related alteration (Fig. 6C,D). [score:1]
The decrease in miR-223 was also observed in rat lungs and in pulmonary arteries (PA) following 3-weeks of hypoxia (Fig. 1C,D, respectively). [score:1]
Serum miR-223 as a potential circulating biomarker for CHD-PAH. [score:1]
org), we found two potential miR-223 binding sites within RhoB 3′-UTR (Fig. 5A). [score:1]
Rats for in vivo studies were randomized into four groups (n = 8 each): 1) a normoxic control group, 2) a hypoxic control group, 3) a hypoxic group injected with agomir control, and 4) a hypoxic group injected with miR-223 agomir (Ribobio). [score:1]
We observed similar results with the cell proliferative marker PCNA, indicating that miR-223 has an anti-proliferative effect in experimental PAH. [score:1]
The miR-223 expression level in human serum samples was normalized to hsa-miR-16-5p and calculated using the 2 [(−ΔCt)] method. [score:1]
Our results show that pulmonary artery pressure and distal arteriolar muscularization following chronic hypoxia were significantly decreased when level of miR-223 was preserved. [score:1]
Coincident with the effects on pulmonary vascular pressure, the ratio of right to left ventricle plus septum weight [RV/(LV + S)] in rats treated with miR-223 agomir also showed an attenuated increase in hypoxia (Fig. 3B). [score:1]
Our results show that the levels of circulating miR-223 in CHD-PAH manifest a gender related difference. [score:1]
In an early study, Caruso et al. reported that miR-223 was decreased in chronic hypoxia -treated PAH rat lungs 37. [score:1]
Levels of miR-223 in 30 normal versus 30 CHD-PAH patients (A), 13 male normal versus 13 male CHD-PAH patients, and 17 female normal versus 17 female CHD-PAH patients (B), a second group of 24 normal versus 24 patients (C), 7 male normal versus 7 male patients, and 17 female donors versus 17 female patients (D), respectively were normalized to hsa-miR-16-5p and represented in scatter plots. [score:1]
Schematic mo del showing the role of miR-223 in pulmonary arterial hypertension in response to hypoxia. [score:1]
We found that serum miR-223 levels in patients were lower than that in healthy donors but with no significant difference (p = 0.058) (Fig. 6A). [score:1]
miR-223 attenuates chronic hypoxia -induced pulmonary vascular remo deling. [score:1]
These results are of great clinical significance as it highlights miR-223 as a potential diagnostic circulating biomarker in female CHD-PAH patients. [score:1]
In addition, we measured the protein levels of these two targets in rats with hypoxia -induced PAH with miR-Con and miR-223 agomir treatment. [score:1]
It will be of great interest to study whether miR-223 agomir shows better effect by intratracheal nebulization. [score:1]
To assess the role of miR-223 in modulating cell proliferation, cells were transfected with miR-223 mimic, which increased miR-223 levels in cultured rPASMC and hPASMC (Supplementary Figure S1). [score:1]
The miR-223 expression level was normalized to SNORD44 (in human tissue sample), rno-miR-16-5p (in rat serum sample) or snoRNA202 (in mice or rat tissue sample) and calculated using the 2 [(−ΔΔCt)] method. [score:1]
Serum levels of miR-223 in female CHD-PAH patients were significant lower than that in healthy female donors, but there was no difference between male CHD-PAH subjects and control subjects (Fig. 6B). [score:1]
Rat and human PASMC were transfected with mimic control (miR-Con) or miR-223 mimic (miR-223) and exposed to hypoxia (3% O [2]) or normoxia for 24 h in triplicate. [score:1]
Our results point to a gender-specific response in circulating miR-223 in pulmonary hypertension associated with CHD. [score:1]
These hypoxia -induced changes in RhoB were opposite to the effects on miR-223, pointing to a negative relationship between them. [score:1]
Expression of serum miR-223 was measured by qRT-PCR in healthy human donors (normal) and CHD-PAH patients. [score:1]
[1 to 20 of 98 sentences]
10
[+] score: 241
b Representative images of apoptotic RTECs at 48 h as detected by flow cytometry, * P < 0.05, n = 3. NC negative control, OD optical density, PI propidium iodide Fig. 6Expression of growth factors, chemokines, and antiapoptosis factors was suppressed by coculture with mesenchymal stem cells (MSCs) when miR-223 was inhibited; however, expression of proapoptosis factors was enhanced. [score:9]
GAPDH glyceraldehyde-3-phosphate dehydrogenase Fig. 7Expression of NLRP3 in renal tubular epithelial cells (RTECs) was upregulated after coculture with mesenchymal stem cells (MSCs), during which miR-223 was inhibited. [score:8]
DAPI 4,6-diamino-2-phenyl indole, GAPDH glyceraldehyde-3-phosphate dehydrogenase, NC negative control, NLRP3 NLR family-pyrin domain containing 3, UTR untranslated region To verify that miR-223/NLRP3 signaling plays a key role in the kidney protective function of MSCs, we specifically inhibited miR-223 expression in MSCs. [score:7]
To detect the role of the miR-223/NLRP3 pathway in renal I/R injuries, the RTECs were divided into the following two groups: 1) Negative control group (H/R -treated RTECs cocultured with MSCs transfected with negative control inhibitors); and 2) miR-223 inhibitor group (H/R -treated RTECs cocultured with MSCs transfected with a miR-223-specific inhibitor). [score:7]
The htMSCs displayed a protective function associated with an upregulation of miR-223 as induced by Notch1 and the downregulation of NLRP3. [score:7]
The downregulation of miR-223 in MSCs induced NLRP3 expression, indicating that miR-223 plays a key role in the mechanism by which MSCs protect kidney tissue (Fig.   7a and b). [score:6]
Next, miR-223 expression in the MSCs was downregulated to verify that MSCs protected RTECs via the transport of miR-223. [score:6]
Fig. 2Expression of miR-223 was upregulated in renal tubular epithelial cells (RTECs) cocultured with mesenchymal stem cells (MSCs) or hypoxia-pretreated MSCs (htMSCs). [score:6]
Expression of miR-223 was upregulated in RTECs cocultured with MSCs and htMSCs. [score:6]
Twenty-four KM/NIH mice (female, 34 ± 2.1 g) were used for in vivo assays and were randomly assigned to four different groups (six mice per group): 1) Control group (mice underwent I/R treatment and were abdominally intravenously injected with the same volume of normal saline as used for negative control groups); 2) MSC group (15 min before I/R treatment the mice were abdominally intravenously injected with 2 × 10 [6] MSCs in a volume of 200 μL and then transfected with a negative control inhibitor); 3) miR-223 inhibitor group (15 min before I/R treatment the mice were abdominally intravenously injected with 2 × 10 [6] miR-223 knockdown MSCs); and 4) htMSC group (15 min before I/R treatment the mice were abdominally intravenously injected with 2 × 10 [6] hypoxia-pretreated MSCs). [score:5]
Our previous studies showed that the protective effect of MSCs on a DCD rat kidney was associated with activation of miR-223, as well as the specific suppression of its targeted gene, NLRP3. [score:5]
miR-223 contributed to the attenuation of H/R injuries in RTECs by suppressing NLRP3 expression. [score:5]
In the I/R mouse mo dels, injection of either MSCs or htMSCs ameliorated the damage to kidney tissue, while suppression of miR-223 expression in MSCs reduced their protective effect on mouse kidneys. [score:5]
Moreover, Notch receptors expressed in MSCs were proven to be upstream regulators of miR-223 [21, 22]. [score:4]
A dual luciferase assay showed that miR-223 inhibited NLRP3 expression. [score:4]
Administration of MSCs suppressed the function of NLRP3 both in RTECs and kidney tissues, whereas knockdown of miR-223 blocked the effect of MSCs. [score:4]
For the following reasons, this hypothesis was validated in the current study: 1) RTECs from an induced H/R mo del displayed significantly decreased levels of miR-223 expression in vitro; and 2) knockdown of miR-223 in MSCs impaired the treatment effect of MSCs on RTECs in vitro, and on renal I/R mice in vivo. [score:4]
Given that NLRP3 is negatively regulated by microRNA-223 (miR-223) [20], an enhanced expression of miR-223 might be expected to ameliorate the damage to renal tissues. [score:4]
Moreover, the levels of antiapoptosis indicators also declined due to the knockdown of miR-223, while the expression levels of molecules known to promote apoptosis (i. e., caspase-1 and caspase-3) increased (Fig.   6b and c). [score:4]
Additionally, during the immunochemical detection of Notch1 in mouse kidney tissues, it was found that Notch1 levels in the MSCs of I/R -treated mice increased in synchrony with upregulation of miR-223 in the corresponding samples. [score:4]
Thus, the upregulation of miR-223 in kidney tissues by therapeutic modalities such as MSCs is a promising method for treating renal failure induced by an I/R process. [score:4]
Previous studies have shown that Notch1 receptors are expressed in MSCs, which were proven to serve as upstream regulators of miR-223 [21, 22]. [score:4]
Interestingly, downregulation of miR-223 significantly reduced creatinine clearance rates in the I/R + MSC group, indicating that miR-223 plays a role in the ability of MSCs to treat I/R -induced kidney injuries. [score:4]
Fig. 5Downregulation of miR-223 in MSCs decreased cell viability and accelerated the apoptosis process in RTECs. [score:4]
A previous study reported that MSCs secrete exosomes capable of transporting miR-223 into nearby cells for the purpose of regulating targeted pathways [24]. [score:4]
This suggests that miR-223 in MSCs might be upregulated by Notch signaling. [score:4]
After the kidney ischemia/reperfusion (IR) KM/NIH mouse mo dels were established, the mice were abdominally intravenously injected with MSCs, miR-223 inhibitor (miR-223 in) transfected MSCs or hypoxia-pretreated MSCs (htMSCs). [score:3]
These findings indicate that MSCs protect RTECs and kidney tissue by inhibiting NLRP3 via miR-223, and this effect was even more evident when Notch signaling in MSCs was activated by hypoxia treatment. [score:3]
In vivo implantation of MSCs ameliorated kidney I/R injuries via miR-223 -mediated NLRP3 suppression. [score:3]
Conversely, inhibition of miR-223 impeded the protective effect of MSCs. [score:3]
Because miR-223 secreted by MSCs is known to be transferred to RTECs via a paracrine mechanism, we investigated the levels of Notch1 expression in MSCs and found that Notch1 expression was significantly increased by hypoxia pretreatment (P < 0.05; Fig.   4e and f). [score:3]
As it has been demonstrated that hypoxia -treated MSCs can initiate Notch signaling [32], we found that the levels of miR-223 expression in MSCs were significantly increased. [score:3]
The MSCs had been transfected in advance with a miR-223 inhibitor (miR-223 in). [score:3]
The exosomal miR-223 secreted by MSCs was transferred into RTECs and attenuated damage to renal cells after NLRP signaling was suppressed. [score:3]
Cells were harvested at 48 h. a Expression of miR-223 in RTECs was detected by qRT-PCR. [score:3]
Thereafter, we investigated the levels of miR-223 target gene (NLRP3) expression in both RTECs and kidney tissue [20, 33]. [score:3]
This reduced level of apoptosis in the I/R + MSC group was absent when miR-223 was inhibited. [score:3]
Therefore, we hypothesized that MSCs might exert their protective function by suppressing NLRP3 via Notch -induced activation of miR-223. [score:3]
The MSCs had been pretreated with a miR-223 inhibitor. [score:3]
Our studies with an in vivo mouse mo del show that the therapeutic effect of MSCs on I/R -induced renal injuries was reduced by suppression of the miR-223/Notch signaling pathway. [score:3]
It was noteworthy that suppression of miR-223 decreased HGF, IGF-1, TGF-β, and VEGF production both in vitro and in vivo. [score:3]
b Expression of miR-223 in MSCs was detected by qRT-PCR. [score:3]
We found that the viability of cocultured RTECs became dramatically decreased concomitant with miR223 inhibition (P < 0.05; Fig.   5a), and the rates of RTEC apoptosis were accelerated (Fig.   5b). [score:3]
A bioinformatics analysis revealed a targeting relationship between miR-223 and NLRP3. [score:3]
ViaFect™ Transfection Reagent (Promega, Fitchburg, WI, USA) was used to cotransfect 1 μg of psiCHECK-2-mNLRP3-wt or psiCHECK-2-mNLRP3-mut with 50 nm/L miR-223 mimic or miR-223 inhibitor into RTECs. [score:3]
Moreover, the protective effect of MSCs on kidney tissue was enhanced by hypoxia pretreatment, which increased miR-223 levels by activating Notch1 expression. [score:3]
In the current study, we demonstrated that administration of MSCs could ameliorate kidney damage induced by I/R, and the related mechanism involved inhibition of NLRP3 activity via activation of miR-223. [score:3]
When taken together, our data show that MSCs can attenuate renal I/R -induced injuries by transporting miR-223 into kidney cells and inhibiting NLRP3. [score:3]
a The effect of miR-223 on NLRP3 expression. [score:3]
However, hypoxia treatment increased the levels of miR-223 expression in both MSCs (Fig.   2b) and RTECs (Fig.   2a). [score:3]
Those results proved the positive correlation between miR-223 expression and activation of Notch1. [score:3]
A miR-223-specific inhibitor (sequence: 5′-ACAGUCAAACAGUUUAUGGGUU-3′) or negative control (sequence: 5′-UGCGCUGCUGGUGCCAACCCUAUUCU-3′) purchased from Jikai Biosciences (Shanghai, China) was transfected into the MSCs using Lipofectamine 2000 reagent (Thermo Fisher Scientific Waltham, MA, USA) according to the manufacturer’s instructions. [score:3]
The promoting role of NLRP3 in an acute renal injury was negatively regulated by miR-223. [score:2]
Fig. 8Knockdown of miR-223 blocked the protective effect of mesenchymal stem cells (MSCs) on renal tubular epithelial cells (RTECs). [score:2]
The levels of those cytokines in mice injected with miR-223 knockdown MSCs were significantly lower than those in both the I/R + MSC and I/R + htMSC groups (P < 0.05). [score:2]
In a similar manner, results of BUN assays also indicated that treatment with MSCs or htMSCs significantly decreased the levels of BUN, whereas suppression of miR-223 impeded the reduction in BUN induced by MSCs or htMSCs (P < 0.05) (Fig.   9e). [score:2]
Data from apoptosis, BUN, and creatinine clearance studies also suggested a significant role for miR-223 in the alleviation of kidney I/R injuries by implanted MSCs. [score:1]
The binding site was between miR-223 and the 3′-UTR of NLRP3 mRNA. [score:1]
To detect the effect of MSCs on miR-223/NLRP3 activity, the RTECs were divided into the following four groups: 1) RTEC group (normal RTECs); 2) HR RTEC group, (H/R -treated RTECs); 3) HR RTEC + MSC group (H/R -treated RTECs cocultured with MSCs for 48 h); and 4) HR RTEC + htMSC group (H/R -treated RTECs cocultured with hypoxia-pretreated MSCs (htMSCs) for 48 h). [score:1]
After administration of MSCs alone, the levels of miR-223 in RTECs dramatically increased. [score:1]
Wang X Gu H Qin D Yang L Exosomal miR-223 contributes to mesenchymal stem cell-elicited cardioprotection in polymicrobial sepsisSci Rep. [score:1]
The cardioprotective effect of MSCs is mediated through exosomal miR-223. [score:1]
However, even though the miR-223 levels in MSCs had been reduced, the miR-233 levels in the I/R + MSC group were still higher than those in the I/R group (Fig.   8a). [score:1]
Recent studies have indicated that microRNA-223 (miR-223) plays a role in the tissue-protective effect of mesenchymal stem cells (MSCs). [score:1]
A bioinformatics analysis verified existence of a complementary binding site between miR-223 and the 3′-UTR of NLRP3 mRNA (Fig.   4a). [score:1]
A dual luciferase assay showed that treatment with the miR-223 mimic significantly decreased the relative amount of luciferase activity (Fig.   4b), indicating that miR-223 exerted a regulatory effect on NLRP3 mRNA. [score:1]
Moreover, miR-223 appeared to affect the amounts of growth factors and chemokines secreted by MSCs. [score:1]
Thus we investigated the relationship between Notch1 expression and miR-223 levels in MSCs. [score:1]
Administration of MSCs containing active miR-223 restored the integrity of cellular structures that had been damaged as a result of IR induction. [score:1]
The results obtained after administration of MSCs indicated that the MSCs had actively contributed to increasing the levels of miR-223 in H/R RTECs. [score:1]
Details of the histological changes seen in the mouse mo dels are shown in Fig.   9. H&E staining revealed that administration of MSCs with active miR-223 restored cellular structures that had been damaged due to I/R induction (Fig.   9a). [score:1]
The effect of MSC administration and the role of miR-223/NLRP3 signaling in renal I/R injuries were examined using hypoxia/reoxygenation (H/R) murine renal tubular epithelial cells (RTECs), and were then verified in a renal I/R KM/NIH mouse mo del. [score:1]
e Blood urea nitrogen (BUN) assays showed that treatment with MSCs or htMSCs significantly decreased the levels of BUN compared to those in the IR group; however, a decrease in miR-223 expression reversed the reductions in BUN caused by MSCs or htMSCs. [score:1]
Therefore, it was reasonable to hypothesize that miR-223 plays a key role in I/R -induced injuries to the kidney, as well as the ability of MSCs to protect kidney tissue. [score:1]
Ischemia/reperfusion Mesenchymal stem cell microRNA-223 NLR family-pyrin domain containing 3 Inflammation Renal blood flow is always temporarily disrupted during various surgical treatments, including those performed for the purposes of kidney transplantation, partial nephrectomy, aortic bypass, and treatment of sepsis [1– 4]. [score:1]
Our results demonstrate that miR-223 and NLRP3 play important roles in the treatment of renal tissue injuries with transplanted MSCs. [score:1]
Taken together, the central role played by miR-223 during the onset of a renal I/R injury was affirmed. [score:1]
[1 to 20 of 77 sentences]
11
[+] score: 238
For example, Dorhoi et al. reported in tuberculosis that miR-223 directly targets the chemoattractants CXCL2, CCL3, and IL-6 in myeloid cells [44] and miR-223 downregulated the expression of STAT3 in sepsis [45]. [score:9]
We found that the miR-223 mimic decreased the expression of the transcript containing the wild-type 3’-UTR of CLDN8, while the miR-223 inhibitor increased the expression (Fig.   5a, right panel). [score:7]
We found that miR-223 was upregulated, while CLDN8 was downregulated in colonic mucosa from IBD patients. [score:7]
B MiR-223 inhibitors downregulate miR-223 in colonic epithelial cells by qPCR. [score:6]
The 3’ untranslated region of the Roquin ubiquitin ligase gene was a target for miR-223 [40]. [score:5]
c MiR-223 inhibitors upregulate CLDN8 in colonic epithelial cells. [score:5]
Considering the role of miR-223 in targeting CLDN8, we determined whether they were differentially expressed in colonic mucosa of IBD patients. [score:5]
By inhibiting miR-223, the mirVana® miRNA inhibitor reactivated CLDN8 in colitis tissues (Fig.   6d-f, P <0.01), in parallel with the recovery in loss of body weight, and improvement of histological appearance, histological score and MPO activity, and the preservation of the integrity of the intestinal epithelial barrier. [score:5]
Activation of the IL23 cascade upregulates the pro-inflammatory miR-223. [score:4]
Using IL-10(−/−) mice as an animal mo del of Th1 -mediated inflammatory bowel disease, Schaefer et al. showed that miR-223 was one of the miRNAs that was dysregulated in colonic tissues and PBLs of mice with mild intestinal pathology. [score:4]
Pro-inflammatory miR-223 directly targets Claudin-8 (CLDN8), a critical family member in the maintenance of normal intestinal barrier property. [score:4]
A MiR-223 mimics upregulate miR-223 in colonic epithelial cells by qPCR. [score:4]
d Upregulation of miR-223 in UC and CD. [score:4]
For example, in this study we screened miRNAs that have been reported to be upregulated in IBD, including miR-223, miR-21, miR-155, miR-19a, miR-101, miR-594, and miR-16. [score:4]
F MiR-223 antagomirs upregulate CLDN8 as quantitated by western blot. [score:4]
E MiR-223 antagomirs downregulate miR-223. [score:4]
By targeting CLDN8, miR-223 directly bridges the IL23 signal with intestinal barrier properties in IBD. [score:4]
We then examined the regulatory effect of miR-223 on endogenous CLDN8 by transfecting vectors containing miR-223 mimic, inhibitor, or controls into Caco-2, NCM460, and SW480 cells (Additional file 4: Figure S2). [score:4]
MiR-223 was upregulated in IBD, and its activity was regulated through the IL23 pathway. [score:4]
E MiR-223 antagomirs upregulate CLDN8 as quantitated by qPCR. [score:4]
a Regulation of the CLDN8 3’-UTR reporter by miR-223 mimics or inhibitors. [score:4]
MiR-223 mimics inhibited CLDN8 expression at both the mRNA and protein levels (Fig.   5b, left panel: quantitative PCR; right panel: western blot). [score:4]
G MiR-223 antagomirs downregulate miR-223. [score:4]
Among them, miR-223 is the most upregulated miRNA. [score:4]
b miR-223 is upregulated in the colonic mucosa of mice with TNBS -induced colitis. [score:4]
In this study, we have made the novel observation that IL23 upregulates miR-223. [score:4]
Chemically modified miRNA antagomirs (Ambion, Austin, TX, USA) complementary to the mature miR-223 sequences were used to knock down miR-223 expression in vivo. [score:4]
In this study, we show that CLDN8 was downregulated in both IBD patients and in mice with TNBS -induced colitis under the control of miR-223. [score:4]
By targeting CLDN8, miR-223 impairs intestinal barrier, leading to the development of IBD. [score:4]
MiR-223 was upregulated in the colonic mucosa of TNBS -induced colitis mice (Fig.   7b). [score:3]
These data demonstrate a specific inhibitory effect of miR-223 on the 3’-UTR of CLDN8. [score:3]
Antagomir inhibition of miR-223 reactivated CLDN8 and improved a number of signs associated with TNBS -induced colitis in mice. [score:3]
In this study, we identified CLDN8 as a downstream target of miR-223 in the IL23 pathway. [score:3]
tw), it seems that some of the miR-223 targets are pro-inflammatory, indicating that miR-223 may be an anti-inflammatory microRNA. [score:3]
The micrONTM miRNA mimics and inhibitors to miR-223 and the negative control #22 were obtained from RiboBio (Guangzhou, China). [score:3]
In colonic mucosa of CD patients, the expression of miR-223 was 4.87-fold higher than that in the normal subjects (P <0.001, Fig.   5d). [score:3]
org), we identified miR-223 as a putative candidate microRNA that targets the 3’-UTR of CLDN8 (Fig.   5a, left panel). [score:3]
Abundance of miR-223 in the mimic- and inhibitor -treated cells. [score:3]
Collectively, these data suggest that miR-223 interacts with the IL23/Th17 pathway and the target gene -CLDN8 in IBD (Fig.   7e). [score:3]
Two colonic epithelial cell lines (NCM640 and Caco-2) were treated with IL23 for 72 h. The expression of miR-223 and CLDN8 were assessed by Q-PCR. [score:3]
In experimental colitis, we found that the therapy that target the IL23/miR-223 pathway could decrease weight loss and improve histological appearance, histological score and MPO activity, and the integrity of the intestinal epithelial barrier. [score:3]
b MiR-223 mimics downregulate CLDN8 in colonic epithelial cells. [score:3]
In contrast, miR-223 inhibitors increased the TEER by 35.4 % (Fig.   5f). [score:3]
Interestingly, by searching miR-223 targets (http://mirtarbase. [score:3]
c The anti-IL23P19 therapy reduces the expression of miR-223. [score:3]
a IL23 controls the expression of miR-223 in NCM460 and Caco-2 cells. [score:3]
Fig. 5Identification of miR223 in targeting CLDN8 in colonic epithelial cells. [score:3]
MiR-223 targets CLDN8 in the IL23 pathway. [score:2]
In addition, we identify miR-223 as a novel mediator of the crosstalk between the IL23 signal pathway and CLDN8 in the development of IBD. [score:2]
On the other hand, when cells were transfected with miR-223 inhibitor, the mRNA transcript and protein level of CLDN8 were elevated compared with control -transfected cells (Fig.   5c, left panel: quantitative PCR; right panel: western blot). [score:2]
Hybridization was carried out overnight at 55 °C using hybridization buffer supplemented with denatured FITC-labeled Locked Nucleic Acid (LNA) probes (1:200, Exiqon) directed against miR-223. [score:2]
MiR-223 antagomirs therapy by direct intracolonic delivery. [score:2]
Compared to the control, the expression miR-223 was increased by 3.6-fold in NCM460 cells (P <0.05, Fig.   7a). [score:2]
These data indicate that endogenous CLDN8 is negatively regulated by miR-223 in colonic epithelial cells. [score:2]
Importantly, we demonstrate that knockdown of miR-223 restores CLDN8 levels in mice with colitis and that it mitigates progression of colitis. [score:2]
The TEER assay was then used to verify the effects of miR-223 mimics and inhibitors on the tightness of junctions between colonic cells. [score:2]
Therapy of TNBS -induced colitis by miR-223 antagomir. [score:1]
The miR-223 antagomir was a 22-mer with the sequence 5’- UGUCAGUUUGUCAAAUACCCCA-3’, while the negative control sequence was a 21-mer with the sequence 5’-CAGTACTTTTGTGTAGTACAA-3’. [score:1]
Given the importance of miR-223 in IBD, we further examined if the microRNA was also controlled by the IL23 pathway. [score:1]
By reducing miR-223 with the antagomir, we observed a parallel increase of CLDN8 in the colitis mo del (Fig.   7d). [score:1]
However, miR-223 did not cause significant changes in the transcript containing the mutant 3’-UTR of CLDN8. [score:1]
It should be emphasized that many other miRNAs, in addition to miR-223, may also be involved in the IL-23/Th17 pathway. [score:1]
Fluorescence in situ hybridization (FISH) In situ hybridization for miR-223 and CLDN8 was performed on paraffin sections of biopsies. [score:1]
Fig. 6Therapeutic treatment of miR-223 antagomirs in TNBS -induced colitis mice. [score:1]
Using the TNBS -induced colitis animal mo del, we for the first time have identified miR-223 as a critical component of the IL23 inflammatory cascade in IBD. [score:1]
e Fluorescence in situ hybridization of miR-223 and immunostaining of CLDN8 in human IBD tissues and normal tissues (magnification × 200). [score:1]
These results indicate that miR-223 affects the tightness of junctions between colonic cells. [score:1]
To further confirm the role of miR-223 in IBD, we tested the potential of miR-223 antagomir treatment in mice with TNBS -induced colitis. [score:1]
Quite recently, Polytarchou et al. also showed that miR-223 was one of the 12 circulating microRNAs that differentiate patients with UC from control subjects [42]. [score:1]
There was a clear correlation between miR-223 and CLDN8 in colonic tissues of the IBD patients (Fig.   5e). [score:1]
A Recovery of body weight in mice with colitis by miR-223 antagomirs. [score:1]
In our colitis mo del, however, we found that miR-223 is a pro-inflammatory miRNA. [score:1]
Fig. 7Interaction among IL23, miR223 and CLDN8. [score:1]
The miR-RB-REPORT-mutated vector was generated corresponding to the predicted binding sites on the CLDN8 3’-UTR for miR-223. [score:1]
Similarly, in the colonic mucosa of UC patients, miR-223 was 2.9-fold higher than that seen in normal colonic mucosa (P <0.001). [score:1]
e The proposed IL23/miR-223/ CLDN8 pathway. [score:1]
Later, they also found that 26 miRNAs, including miR-223, were altered in colon biopsies of CD and UC patients [41]. [score:1]
f MiR-223 regulates TEER. [score:1]
Therapeutic treatment of miR-223 antagomir in mice with TNBS -induced colitis. [score:1]
Thus, disrupting this IL23/miR-223/ CLDN8 interaction may provide novel therapeutic strategies for the management of IBD. [score:1]
a Recovery of body weight in mice with colitis by miR-223 antagomirs. [score:1]
A Dose -dependent study of miR-223 antagomir. [score:1]
Similar pro-inflammatory role of miR-223 has been reported in other mo dels [46– 49]. [score:1]
Crosstalk between IL23, MiR-223, and CLDN8 in the development of IBD. [score:1]
In situ hybridization for miR-223 and CLDN8 was performed on paraffin sections of biopsies. [score:1]
B MiR-223 antagomirs therapy reduces the histological score. [score:1]
D Effects on MPO activity by miR-223 antagomirs. [score:1]
Our study characterizes a new mechanistic pathway in IBD, in which miR-223 interacts with the IL23 pathway by targeting CLDN8. [score:1]
Thus, miR-223 antagomir can ameliorate progression of colitis. [score:1]
[1 to 20 of 89 sentences]
12
[+] score: 189
Other miRNAs from this paper: hsa-mir-223
miR-223 overexpression down-regulates interleukin-6 (IL-6) and IL-1β expression in TLR-activated macrophages [16]. [score:8]
In the study, miR-223 expression of the stroke patients with LA or SA showed similar up-regulation. [score:6]
miR-223 expression was up-regulated in the 1 day and 3 days groups following stroke occurrence compared to the control [Figure  2A, 1 day vs. [score:5]
During differentiation or tumor progression, miR-223 suppresses cell proliferation by targeting insulin-like growth factor-1 receptor (IGF1R) [17]. [score:5]
B. miR-223 was significantly up-regulated in patients with LA and SA strokes. [score:4]
microRNA-223, which were negatively correlated with NIHSS scores (r = −0.531, p < 0.01) and infarct volume (r = −0.265, p = 0.039), was significantly up-regulated in large artery and small artery strokes. [score:4]
Moreover, microRNA-223 in blood and brain were positively correlated (r = 0.834, p < 0.05), and they were up-regulated significantly in mice that underwent middle cerebral artery occlusion (p < 0.05). [score:4]
Some known transcriptional factors including NFI-A and C/EBPα regulate miR-223 expression [14]. [score:4]
In vitro studies have demonstrated that miR-223 could specifically regulate IGF1R expression [17]. [score:4]
In hepatic ischemia/reperfusion injury, miR-223 is greatly up-regulated and positively correlates with serum markers of ischemic injury [18]. [score:4]
The expression levels and the time course of blood miR-223 in acute ischemic stroke patients. [score:3]
IGF-1 levels changed with miR-223 levels in the 1 day, 2 days and 3 days groups after ischemia (Figure  4A) and miR-223 expression was positively associated with IGF-1 levels (Figure  4C, r = 0.205, p = 0.022). [score:3]
We did not find the significant difference of the expression levels of miR-223 (data not shown here). [score:3]
Besides, to obtain a temporal expression profile of miR-223 in patients, it is perfect for the extraction of basal samples from the same patients at 24, 48 and 72 hours. [score:3]
We believe that miR-223 has great potential as a novel therapeutic target for ischemic stroke. [score:3]
miR-223 was significantly up-regulated in both brain and blood samples compared to that of the sham in MCAO mice (Figure  3A, brain, MCAO vs. [score:3]
Another study of miR-223 expression proved that miR-223 was greatly increased in the blood of young stroke patients aged 18–49 years [23]. [score:3]
There was no significant correlation between miR-223 expression and IGF1R (Figure  4B, r = −0.023, p = 0.795) and IL-6 (Figure  4D, r = −0.058, p = 0.522). [score:3]
Figure 2 The time course of miR-223 expression and the correlation analysis between miR-223 and clinical information. [score:3]
The Y axis showed the miR-223 expression levels by log2 change. [score:3]
r = −0.265, p = 0.039. miR-223 expression levels of LA or SA stroke patients were significantly increased [Figure  2B, LA vs. [score:3]
A. Bar graphs showed the expression of miR-223 in brain tissue and blood of MCAO mice at 1 day. [score:3]
NIHSS scores had a negative correlation with miR-223 expression in our study, implying the potential neuroprotective role of miR-223 in stroke. [score:3]
Our findings suggested IGF-1 might be a new target of miR-223. [score:3]
Box plots exhibited the time course of miR-223 expression in stroke patients. [score:3]
In our study, we found the similar changes of miR-223 expression in the blood of acute ischemic stroke patients and that the brain miR-223 level positively correlated with blood miR-223 level in ischemic mice. [score:3]
The correlation between miR-223 and potential target genes. [score:3]
In the study, IGF-1 level changed with miR-223 levels in the 1 day, 2 days and 3 days groups after ischemia, suggesting the modulation of miR-223 on IGF-1 expression. [score:3]
miR-223 expression levels were negatively associated with NIHSS scores (Figure  2C, r = −0.531, p < 0.01) and infarct volume (Figure  2D, r = −0.265, p = 0.039). [score:3]
A. miR-223 was highly expressed in 1 day and 3 days stroke patients. [score:3]
The severity of stroke and the infarct volume of stroke patients were negatively associated with miR-223 expression. [score:3]
miR-223 relative expression was normalized to the endogenous control U6 expression in triplicate and was calculated by the 2 [-Δct] method. [score:3]
Studies demonstrated that miR-223 is mainly expressed in bone marrow and plays an important role in granulopoiesis [15]. [score:3]
IL-6 could induce the decrease of miR-223 expression after lipopolysaccharide stimulation in macrophages [16]. [score:3]
To eliminate unmatched factor impaction (hypertension, diabetes and hyperlipidemia) on miR-223 expression levels between two groups, a logistic regression was performed. [score:3]
The Y axis indicated miR-223 expression levels by log2 change. [score:3]
In this study, we demonstrated that miR-223 was hyper-expressed in the circulating blood of acute ischemic stroke patients. [score:3]
Maybe this is a relative broad time range for the expression of miR-223. [score:3]
In the central nervous system miR-223 is also highly present and is neuroprotective by targeting GluR2 and NR2B subunits of the glutamate receptor [19]. [score:3]
However, miR-223 showed opposite expression patterns in LA or SA stroke within 6–18 months [23]. [score:3]
Box plots showed the expression of blood miR-223 in patients and control. [score:3]
Box plots exhibited the miR-223 expression level among different subtypes. [score:3]
Great attention has been paid to miR-223 because it can regulate cell cycle, tumor invasiveness, haematopoietic differentiation and immune cell function [13]. [score:2]
To explore the regulatory mechanism of miR-223 in the ischemic pathological process, we also studied the down-stream insulin-like growth factor-1 (IGF-1), IGF1R and IL-6 changes in stroke patients. [score:2]
Our results suggest that microRNA-223 is associated with acute ischemic stroke and possibly plays a role in stroke through up -regulating growth factor such as insulin-like growth factor-1 gene. [score:2]
The study reported circulating miR-223 based markers for acute ischemic stroke occurrence, subtypes and infarct volume. [score:1]
Figure 3 Blood and brain miR-223 levels were elevated and they have a positive correlation in mice. [score:1]
Brain and blood miR-223 in ischemic mice. [score:1]
Previous animals’ experiments demonstrated that miR-223 level was significantly elevated at 24 and 72 hour reperfusion in rat transient MCAO [25] and at 3 and 24 hours in ischemic preconditioning [26]. [score:1]
D. The scatterplot showed miR-223 levels have a negative correlation with infarct volume of stroke patients. [score:1]
It was plausible to assume that miR-223 takes part in the early inflammatory reaction after stoke through other pathways. [score:1]
Further studies with larger sample sizes are needed to assess the clinical application of miR-223 signatures. [score:1]
Brain miR-223 and blood miR-223 level were significantly elevated and have a positive correlation in MCAO mice. [score:1]
The relationship between the microRNA-223 level and NIHSS scores, TOAST subtypes, and infarct volume was analyzed respectively. [score:1]
However, we did not find a similar correlation between miR-223 and IGF1R in the blood of patients with acute ischemia. [score:1]
D. The scatterplot showed miR-223 was not associated with IL-6 after ischemia. [score:1]
Here we investigated the roles and possible targets of circulating microRNA-223 in human ischemic stroke within the first 72 hours. [score:1]
miR-223 is located in the X chromosome. [score:1]
A positive correlation between the blood miR-223 and the brain miR-223 levels was analyzed by Spearman’s correlation analysis (Figure  3B, r = 0.834, p < 0.05). [score:1]
Whether miR-223 associated with the severe stroke needs to be further studied. [score:1]
The influence of miR-223 levels on a categorical variable was assessed by logistic regression analysis using forward stepwise selection procedures after adjusting for those variables with a proven biological relevance for stoke mobidity to avoid the possibility of finding some spurious associations. [score:1]
The mean NIHSS in our studies is relative low, suggesting miR-223 is sensitive for mild stroke. [score:1]
The plasma level of IGF-1 has a positive correlation to miR-223 level. [score:1]
The plasma level of insulin-like growth factor-1 was positively associated with that of microRNA-223 (r = 0.205, p = 0.022). [score:1]
The results of logistic regression suggested that the level of blood miR-223 was a stroke risk factor (p = 0.011, adjusted odd ratio = 1.002, 95% CI: 1.000-1.004). [score:1]
Figure 1 Blood miR-223 levels were significantly increased in acute ischemic stroke. [score:1]
The relationship between circulating microRNA-223 and pathogenesis of acute ischemic stroke is unknown. [score:1]
We then assessed the relationship between the alteration of circulating miR-223 levels and the NIHSS scores, subtypes and infarct volume of acute stroke patients. [score:1]
ECA: External carotid artery; IGF-1: Insulin-like growth factor-1; IGF1R: Insulin-like growth factor-1 receptor; IL-1β: interlukin-1β; IL-6: Interlukin-6; ICA: Internal carotid artery; MCAO: middle cerebral artery occlusion; miR-223: microRNA-223; NIHSS: National Institutes of Health Stroke Scale; TOAST: Trial of Org 10172 in acute stroke treatment criteria. [score:1]
The result suggested that miR-223 is involved in the process of ischemia and hypoxia and implied that blood miR-223 represents the changes of miR-223 in brain response to ischemic stroke. [score:1]
C. The scatterplot showed miR-223 levels were negatively associated with NIHSS scores. [score:1]
Here, we analyzed changes of miR-223 levels in acute ischemic stroke patients and animal ischemia mo del. [score:1]
B. The scatter plot demonstrated the positive correlation between blood miR-223 and brain miR-223 at 1 day after ischemia. [score:1]
The changes of miR-223 levels for stroke diagnosis and their relationship with clinical confound factors need to be explored. [score:1]
Figure 4 The relationship between miR-223 and IGF1R, IGF-1 and IL-6. A. Line chart exhibited the changes of miR-223, IGF-1, IGF1R and IL-6 within 72 hours. [score:1]
To develop a novel technique quickly detect the changes of miR-223 will greatly help to the diagnosis of stroke. [score:1]
miR-223 levels were greatly increased in patients with LA and SA stroke. [score:1]
But we did not find a correlation between miR-223 and IL-6 levels in vivo. [score:1]
microRNA-223 was detected by real-time polymerase chain reactions. [score:1]
Increasing evidences suggest miR-223 plays a vital role in modulating inflammatory reactions [15]. [score:1]
The relationship between miR-223 and TOAST subtypes, NIHSS scores and infarct volume. [score:1]
B. The scatterplot showed miR-223 was not associated with IGF1R after ischemia. [score:1]
C. The scatterplot demonstrated miR-223 was positively correlated to IGF-1. r = 0.205, p = 0.022. [score:1]
However, the function of miR-223 associated with acute ischemic brain injury (less than 72 hours) remains unknown. [score:1]
[1 to 20 of 84 sentences]
13
[+] score: 168
In addition, the forced expression of miR-223 was found to downregulate Sca-1 in the LLC cells, as well as a simultaneous decrease of the cells in the G [0]/G [1] phase and the induction of the inhibition of anchorage-independent growth. [score:8]
Notably, the LLC cells ectopically expressing miR-223 were identified to exhibit a significantly inhibited anchorage-independent growth ability, as demonstrated by the decrease in colony numbers and sizes (Fig. 1C), indicating that upregulation of miR-223 reduces the tumorigenicity of lung cancer cells in vitro. [score:8]
Overexpression of miR-223 in LLC cells induces G [2]/M phase arrest and reduces Sca-1 protein expressionPropidium iodide staining of miR-223 -overexpressing LLC cells revealed an increase in the G [2]/M cell populations (13.3±0.85 vs. [score:7]
These observations, together with the results of the present study, are consistent with a mo del in which miR-223 induces G [2]/M arrest via the downregulation of IGF-1R and CDK2 by co -targeting their 3′UTR regions. [score:6]
Upregulation of miRNA-223 suppresses proliferation and tumorigenicity of LLC cells. [score:6]
Ectopic expression of miRNA-223 inhibits LLC invasion. [score:5]
Next, to examine whether miR-223 affects IGF-1R and CDK2 expression in LLC, the mRNA and protein expression levels of IGF-1R and CDK2 were analyzed using qPCR and western blot analysis. [score:5]
Overexpression of miR-223 in LLC cells induces G [2]/M phase arrest and reduces Sca-1 protein expression. [score:5]
miR-223 expression in LLC inhibits tumor growth in vivo. [score:5]
Subsequent to 48 h, the expression of IGF-1R and CDK2 mRNA in the miR-223 -expressing group was reduced by ∼17- and 25-fold of the control vector group, respectively (Fig. 5C). [score:5]
For the target validation and cell signaling analysis, the mmu-miRNA-223 expression vector and an empty pGenesil-1.1 (Wuhan Genesil Biotechnology Co Ltd. [score:5]
In the present study, IGF-1R expression and its phosphorylation levels in LLC were investigated and found to be markedly reduced, while cell proliferation was inhibited, following miR-223 overexpression. [score:5]
However, the mechanism by which miR-223 functions in the development of NSCLC remains largely unknown and, to date, no miR-223 targets have been reported in NSCLC. [score:4]
In addition, IGF-1R and CDK2 were demonstrated to represent two significant targets for miR-223, crucial for mediating the miR-223-regulated malignant phenotype of LLC cells. [score:4]
miR-223 has been reported to be markedly downregulated in the lungs of rats exposed to environmental cigarette smoke for 28 days (18). [score:4]
Using a CCK-8 assay, the overexpression of miR-223 (223 -mimic) was observed to markedly reduce the growth rate of the LLC cells compared with that of the non -targeting miRNA mimic -transfected cells (mimic-control; Fig. 1B). [score:3]
Previous studies have reported a number of significant miR-223 targets associated with malignancy, including insulin-like growth factor-1 receptor (IGF-1R) (13), myocyte enhancer factor 2C (14), stathmin 1 (15), artemin (16) and FOXO1A (17). [score:3]
In conclusion, these observations demonstrate that IGF-1R is the functional target of miR-223. [score:3]
Notably, the percentage of Sca-1 -positive cells (Sca-1 is a well-known marker in murine stem cells) was reduced from 39.25±2.36 to 17.47±2.70% in the miR-223 -overexpressing group (P<0.01; Fig. 3B). [score:3]
Propidium iodide staining of miR-223 -overexpressing LLC cells revealed an increase in the G [2]/M cell populations (13.3±0.85 vs. [score:3]
In the current study, miR-223 was revealed to function as a tumor suppressor in lung cancer. [score:3]
The effects of miRNA-223 expression on LLC proliferation were assessed using Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan). [score:3]
Next, linear scratch wounds were created on the confluent monolayer using a pipette tip and the cells were transfected with 50 nM miR-223 mimics or 50 nM non -targeting miRNA mimics (control). [score:3]
The luciferase activities of the IGF-1R 3′UTR, CDK2 3′UTR and miR-223 complementary sequence-containing constructs were found to be further repressed in cells overexpressing miR-223 (Fig. 5B). [score:3]
In agreement with these results, we hypothesize that miR-223 induces an aberrant self-renewal capacity in LLC cells, at least in part, via the inhibition of AKT and ERK activity. [score:3]
Following transfection with miRNA-223 or non -targeting miRNA mimics, MMP9 protein levels in the culture supernatants were quantified using an ELISA kit according to the manufacturer’s instructions (R&D Systems, Minneapolis, MN, USA). [score:3]
The current study is the first study to demonstrate that miR-223 may be involved in lung cancer stem cell self-renewal and to show that miR-223 functions as a tumor suppressor in lung cancer cells at multiple steps of tumorigenesis and progression. [score:3]
The Sca-1 expression in the tumor tissue from the miR-223 mimic -transfected cells was significantly lower than that of the control mimic -transfected cells, as demonstrated by immunofluorescence staining (Fig. 4B). [score:3]
The reduced serum expression of miR-223 was found to be associated with cancer-specific mortality in stage IA/B patients (19). [score:3]
The present results indicated that miR-223-decreased MMP9 activity was mediated by the suppression of phospho-ERK1/2 or phospho-Akt. [score:3]
Group 1 (223 -mimic) was injected with LLC cells transfected with miR-223 mimics and group 2 (mimic-control) was injected with LLC cells transfected with non -targeting miRNA mimics. [score:3]
At 24 h post-transfection with miRNA-223 or non -targeting miRNA mimics, a cell suspension of 5×10 [4] cells in 100 μl DMEM with 0.5% FBS was added to the upper chamber. [score:3]
To determine the consequences of the interference of IGF-1R expression by miR-223, the expression of IGF-1R, Akt, ERK and their active forms (p-IGF-1R, p-Akt and p-ERK) was measured. [score:3]
miR-223 has also been found to also target the CDK2 3′UTR. [score:3]
These observations indicated that miR-223 inhibits invasion in LLC cells. [score:3]
At 48 h post-transfection with miRNA-223 or non -targeting miRNA mimics, dissociated LLC cells were stained with PE-conjugated (PE) rat anti-mouse Sca-1 and the corresponding isotype controls (1:100; BD Pharmingen, San Diago, CA, USA). [score:3]
For the functional analysis, miR-223 and non -targeting miRNA mimics (Thermo Fisher Scientific, Inc. [score:3]
The MMP9 levels in the supernatant of miR-223 -overexpressing cells (214.16±28.18 pg/ml) were reduced compared with that of the mimic-controls (1,139.14±50.13 pg/ml; P<0.01; Fig. 2C). [score:2]
These results indicate that IGF-1R and CDK-2 are post-transcriptionally regulated by miR-223 in LLC cells. [score:2]
miR-223 regulates IGF-1R and CDK2 levels by binding to the 3′UTR. [score:2]
To investigate the biological role of miR-223 expression in the development and progression of lung cancer, LLC cells were transfected with miR-223 mimics and the effect on cellular proliferation was assessed. [score:2]
At four weeks post-injection, the mice administered with miR-223 mimics had formed markedly smaller tumors than the mimic-control group (Fig. 4A). [score:1]
The results also indicate that miR-223 may fine-tune the activity of the IGF-1R pathway. [score:1]
Following transfection, the miR-223 levels were increased in the LLC cells, indicating that the increase was due to miR-223 transfection (Fig. 1A). [score:1]
miR-223 also caused a significant reduction in the IGF-1R and CDK2 protein levels (Fig. 5D). [score:1]
Therefore, in the present study, the effects of miR-223 transfection in the LLC cell line were evaluated to determine whether miR-223 functions as a tumor suppressor of lung cancer. [score:1]
The tumor volume subsequent to sacrifice in mice injected with miR-223 mimic -transfected cells was 2,034.30±983.99 mm [3], whereas the tumor volume in mice injected with the control mimic -transfected cells was 5,860.20±692.58 mm [3]. [score:1]
These results indicate that the IGF-1R -mediated downstream signaling pathway was also affected by miR-223. [score:1]
The present study primarily focused on whether the IGF-1R -mediated downstream signaling pathway is affected by miR-223. [score:1]
miR-223 is a highly conserved miRNA and is crucial for triggering the myeloid differentiation of progenitor cells (11) and for maintaining granulocyte function (12). [score:1]
To examine invasion, the LLC cells were transfected with miR-223 or control mimics and reseeded on top of the insert. [score:1]
Bioinformatic analyses revealed that the IGF-1R 3′UTR contained two putative miR-223 binding sites for miR-223 and CDK2 contained one putative miR-223 binding site for miR-223 (Fig. 5A). [score:1]
The 3′-UTR and miR-223 complementary sequence (TGGGGTATTTGACAAACT GACA) were separately cloned into the pMIR-REPORT plasmid (Life Technologies), according to the manufacturer’s instructions. [score:1]
[1 to 20 of 53 sentences]
14
[+] score: 167
We believe it is likely that upregulation of miR-223 in human obesity has a net suppressive effect on the inflammatory cascade in visceral adipose tissue macrophages representing a compensatory adaptation to the inflammatory disease. [score:8]
TLR4 signaling is known to be involved in the etiology of meta-flammation and LPS stimulation of TLR4 is known to downregulate miR-223 expression during macrophage polarization [5]. [score:6]
We hypothesized a link between macrophage miR-223 expression and TLR4 signaling -mediated changes in FBXW7 expression, which have not been previously reported. [score:5]
However, we believe that the miR-223 levels we report are largely due to the VAT macrophage population because it has been clearly shown that miR-223 is most abundantly expressed in myeloid-derived cells, though other cell and tissue types do express miR-223 at lower levels [13, 14]. [score:5]
Interestingly, Haneklaus et al. found that overexpression of miR-223 prevented the accumulation of NLRP3 protein and inhibited IL-1β production by the inflammosome. [score:5]
We found that co-transfection of a miR-223 mimic with the hFBXW7 3’-URT (WT UTR) plasmid decreased luciferase expression / function to a significant degree, demonstrating that miR-223 mimics can repress a surrogate of human FBXW7 expression. [score:5]
We found that miR-223 was significantly upregulated in the liver and adipose of obese mice compared to lean wild type C57BL/6 control mice; expression was normalized to snoRNA234 in murine samples (Fig 4A). [score:5]
Our data suggests a miR-223-FBXW7-TLR4 regulatory axis, with macrophage miR-223 levels likely modulating the inflammatory response to LPS via effects on FBXW7 and TLR4 expression. [score:4]
Based on these findings and bioinformatics predictions we hypothesized that miR-223 expression in VAT macrophages regulated both pro- and anti-inflammatory pathways including the E3 ubiquitin ligase FBXW7. [score:4]
The authors attributed their result to miR-223 -mediated suppression of Pknox1 function, a positive regulator of macrophage activation. [score:4]
However, our study demonstrates that miR-223 levels potently regulating macrophage FBXW7, a key suppressor of TLR4. [score:4]
Further, we showed that miR-223 upregulation in the VAT was specific to the SVF. [score:4]
These data suggest that miR-223 plays a significant role in both pro and anti-inflammatory pathways in mature macrophages and that further elucidation of the intricacies of this regulation is important to inflammatory diseases. [score:4]
We found that miR-15b, -451, -486, and -223 were significantly upregulated in the SVF, with miR-223 being the most dramatically increased in the obese group (Fig 2A). [score:4]
Our data showing miR-223 -mediated repression of FBXW7 in macrophages as well as the downregulation of miR-223 upon LPS stimulation strongly support a role for miR-223 in the interplay between FBXW7 and TLR4. [score:4]
miR-223 was significantly upregulated in whole adipose in cohort 2 (Fig 2B). [score:4]
Expression of miR-223 is regulated by several transcription factors, including transcription factor PU. [score:4]
miR-223 targets the protein ubiquitination pathway. [score:3]
miR-223 mimic reduces TLR4 expression in macrophages stimulated with LPS. [score:3]
MicroRNA-223 regulates cyclin E activity by modulating expression of F-box and WD-40 domain protein 7. J Biol Chem. [score:3]
0165962.g003 Fig 3Pathway analysis of miR-223 gene targets using IPA [®] software by Ingenuity Systems (Qiagen). [score:3]
In order to identify an appropriate gene target for miR-223, we utilized 11 separate tools for maximal predictive power (DIANA-microT (http://www. [score:3]
To our knowledge, this is the first study to report that miR-223 affects NOS2 levels and provides an additional mechanism by which miR-223 expression in macrophages modulates an activated phenotype. [score:3]
Ablation of miR-223 resulted in enhanced IFNγ/LPS -induced NOS2 expression. [score:3]
Ingenuity pathway analysis (IPA) was used to sort potential targets of miR-223 by canonical pathways potentially relevant to diabetes, cellular energy utilization, and inflammation (Fig 3). [score:3]
Pathway analysis of miR-223 gene targets using IPA [®] software by Ingenuity Systems (Qiagen). [score:3]
miR-223 suppresses macrophage activation via inducible nitric oxide synthase. [score:3]
Murine obesity demonstrated increased miR-223 expression and repressed FBXW7 levels. [score:3]
NO also functions in vasodilation, thus miR-223 expression in obesity may have implication in cardiovascular changes associated with macrophage inflammation (foam cells, atherogenesis) [25]. [score:3]
Our data, combined with these previous reports, suggest that miR-223 expression changes in the liver may further modulate an FBXW7-SREBP1 connection. [score:3]
FBXW7 has previously been shown to be a target of miR-223 [11], however the FBXW7-miR-223 axis in macrophage inflammation has not been reported. [score:3]
Our data shows that miR-223 null macrophages express significantly higher levels of inducible nitric oxide synthase (NOS2) (Fig 5C). [score:3]
miR-223 mimic reduces TLR4 expression in LPS-stimulated macrophages. [score:3]
We see that removal of miR-223 increases both TLR4 and FBXW7 levels, though unstimulated knockout macrophages have a higher normalized TLR4/FBXW7 ratio, indicating an enhanced ability to respond to LPS. [score:2]
0165962.g006 Fig 6 (A) WT BMM have about 21,000-fold greater expression of miR-223 by TaqMan probe -based qPCR compared to miR223 KO BMMs. [score:2]
Zhuang et al. showed that miR-223 whole body knockout mice developed worsened insulin resistance with high fat diet feeding and diet -induced obesity [23]. [score:2]
The pMIR-REPORT-hFBXW7-WT construct was mutated at 4 miR-223 seed / binding sites using the Stratagene Quikchange Lightning Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) according to manufacturer instructions. [score:2]
Our study suggests that a miR-223-FBXW7-TLR4 axis plays a strong role in the macrophage inflammatory phenotype, with ablation of miR-223 regulating multiple pathways including Toll-like receptor 4 (TLR4), STAT3, and inducible nitric oxide synthase (NOS2) signaling. [score:2]
miR-223 is known to play a conserved role in the development and homeostasis of myeloid and granulocyte differentiation. [score:2]
miR-223 regulates the production of nucleotide -binding oligomerization domain-like receptor protein 3 (NLRP3) and IL-1β [21]. [score:2]
IFNγ and/or LPS activation of mBMMs and RAW264.7 cells resulted in a 50% decrease in miR-223 levels (Fig 5A & 5B), indicating that TLR4 signaling regulates miR-223 transcription or pri-miRNA maturation. [score:2]
We believe that the role of miR-223 in meta-flammation is multifactorial and involves regulation of FBXW7, TLR4, STAT signaling, and nitric oxide (NO) production in macrophages. [score:2]
Colonies were screened for quadruple miR-223 mutations and validated by sequencing. [score:2]
miR-223 null macrophages have enhanced inflammatory signaling and increased FBXW7 levels. [score:1]
Dual stimulation with IFNγ and LPS resulted in a significant, but modest decrease in miR-223 null macrophages, significantly contrasted by the dramatic decrease of FBXW7 in WT macrophages. [score:1]
miR223 KO BMMs electroporated with miR-223 mimic (500nM) had levels about 10-fold higher than WT BMMs (Fig 6A and 6B). [score:1]
Optimizing transfection in primary macrophages is challenging and our goal was to replete the miR223 KO BMMs to a level reasonably comparable to WT (within a physiologic range). [score:1]
10 [6] HeLa cells (ATCC) were co -transfected with pMIR-REPORT-hFBXW7-WT or pMIR-REPORT-hFBXW7-quadruple mutant (MUT), miR-223 mimic—50nM (mirVana [™] by Life Technologies), and β-gal transfection control plasmid using an Eppendorf Multiporator [™]. [score:1]
miR223 KO BMMs were grown until confluent (day 7), scraped in warm 1X PBS, before the appropriate number of cells were aliquoted, spun and resuspended in Eppendorf hypo-osmotic buffer at 10 [6] cells/ml. [score:1]
miR-223 was not altered in the adipocyte fraction or in PBMCs (Fig 2D). [score:1]
hsa-miR-223 levels in circulating human blood monocytes isolated with Ficoll-Paque Plus (GE Healthcare). [score:1]
“WT UTR” indicates a vector containing un-mutated hFBXW7 3’-UTR and “Mutated UTR” indicates a vector containing hFBXW7 3’-UTR that has been mutated at all four miR-223 seed sequences. [score:1]
In order to assess the significance of miR-223 as a broadly conserved pathophysiologic change, we isolated RNA from the adipose, liver and muscle of ob/ob mice at approximately 20 weeks of age. [score:1]
Peripheral human blood monocytes miR-223 levels were no different between lean and obese groups, supporting our interpretation that the obesity -associated miR-223 induction is specific to changes in tissue macrophage phenotype. [score:1]
miR-223 was the second most correlated with BMI. [score:1]
After 10 minutes in the hypo-osmotic buffer, cells were electroporated (Eppendorf Multiporator [™]) at 1200V, 50μs in the presence of 500nM of miR-223 mimic or mimic control oligo. [score:1]
Thus, we believe that the miR-223-FBXW7 axis in macrophage inflammation is an important mechanism in balancing TLR4 -mediated inflammation in macrophages and is relevant to metaflammation. [score:1]
“+miR-223” indicates co-transfection of miR-223 mimic. [score:1]
pSTAT3 and total STAT3 levels in miR-223 null macrophages were clearly elevated over WT, as were levels of NOS2, indicating an enhanced inflammatory response to LPS and IFNγ/LPS. [score:1]
0165962.g004 Fig 4(A) mmu-miR-223 levels were significantly increased in the whole adipose and liver tissues, but not in skeletal muscle. [score:1]
WT and miR-223 [-/-] mice were obtained from Jackson Laboratories. [score:1]
Primary mouse macrophage transfection with miR-223 mimic and oligo control. [score:1]
In order to better understand the interplay between miR-223, FBXW7 and macrophage inflammatory signaling, we compared primary bone marrow derived macrophages (mBMMs) from wild type and miR-223 whole body knockout mice. [score:1]
[1 to 20 of 63 sentences]
15
[+] score: 157
MiRNA-223 overexpression upregulated [Ca [2+]] [i] and further promoted ox-LDL -induced upregulation of [Ca [2+]] [i] in a dose-and time -dependent manner (Fig. 2D). [score:8]
Ox-LDL regulates miR-223 expression by directly targeting its 3′ UTR. [score:7]
In this study, we showed that miRNA-223 and Cav1.2 protein expression are upregulated during AF conditions (Figs 1 and 2). [score:6]
CACNA1C gene as the miR-223 targetWe next delineated the target gene of miR-223 which plays a key role in AF and the associated electrical remo deling process. [score:5]
Three miRNAs (miRNA-21, miRNA-133, and miRNA-223) were identified by qRT-PCR showing significant upregulation of miRNA-223 by more than 50%. [score:4]
Our computational prediction and experimental results indicate that miRNA-223 regulates L-type Ca [2+] channel under specific disease conditions. [score:4]
Our results suggest that upregulation of miRNA-223 by ox-LDL is activated by the increase of [Ca [2+]] [i] in myocyte cells. [score:4]
In the first approach, we generated Tg mouse line (AMO/Tg) expressing miRNA-223 antisense to genetically knockdown the endogenous miRNA-223. [score:4]
Ox-LDL induced the transcription of miRNA-223 (Figure S2) and thereby promoted the Cav1.2 expression by activating ROS and regulating the Ca [2+]-release. [score:4]
Regulation of Cav1.2 protein expression by miR-223. [score:4]
Upregulation of Cav1.2 protein levels was also observed in miR-223/Tg rats (Fig. 4D). [score:4]
MiRNA-223 is consistently increased in AF patients and animal AF mo dels, and AF-related miRNA-223 upregulation is likely due to enhancement of miRNA-223 transcription by ox-LDL. [score:4]
Transfection of miR-223 (10 nmol/L) with constructs carrying different target fragments caused enhancement of luciferase activity (Fig. 4A). [score:3]
The ability of antagomiR-223 to rescue miRNA-223-Tg mice from the AF phenotype and associated atrial remo deling properties, suggests miRNA-223’s potential as a target for molecular conversion of AF to a sinus rhythm (Fig. 3). [score:3]
To further understand the relationship between the miRNA-223 and ox-LDL, we determined the role of miR-223 expression in H9c2 cells upon ox-LDL treatment. [score:3]
Ox-LDL induces increased of Ca [2+] channel protein and miRNA-223 expression. [score:3]
Our results from luciferase assay showed that CACNA1C is a direct target of miR-223 (Fig. 4A). [score:3]
Importantly, we found that myocytes from AF patients and the canine AF mo del show increased miRNA-223 expression, accompanied by greater I [Ca, L] amplitudes. [score:3]
MiR-223 induced higher than 50% in CACNA1C transcript levels and significant upregulation of Cav1.2 protein levels was observed in AF patients (Fig. 4E). [score:3]
We next delineated the target gene of miR-223 which plays a key role in AF and the associated electrical remo deling process. [score:3]
CACNA1C/Cav1.2 as the target gene for miR-223. [score:3]
Taken together, these results suggest that ox-LDL induces the expression of Cav1.2 via miR-223. [score:3]
Ox-LDL induces the Ca [2+] channel protein and miRNA-223 expression. [score:3]
Ox-LDL induces the Ca [2+] channel protein and miRNA-223 expressionIn cultured H9c2 cells, ox-LDL treatment produced an activated phenotype of elongated myocardial cells (Fig. 2A). [score:3]
Here, we showed that ox-LDL exposure increases both miR-223 and Cav1.2 expression. [score:3]
We demonstrated that miRNA-223 targets CACNA1C to enhance I [Ca,L] and shorten the action potential duration in atrial myocytes (Fig. 4). [score:3]
Western blot analysis showed markedly increase of Cav1.2 protein levels in the myocardial cells of the Tg mice with miRNA-223 overexpression. [score:3]
Based on computational analysis, we also identified putative binding sites in the 3′-untranslated regions (3′ UTR) of IGF-1R, which might bind the miR-223 seed sequence (Supplement Figure 4). [score:3]
Moreover, ox-LDL increased miRNA-223 expression by approximately 4-fold (Fig. 2B,C). [score:3]
CACNA1C gene as the miR-223 target. [score:3]
Thus, miRNA-223 may be used as a novel biomarker for diagnosing AF vulnerability and early phase AF of rheumatic heart disease. [score:3]
Western blot showing the effect of miR-223 (n = 10) and antisense miR-223 (AMO-223; n = 10) on Cav1.2 protein expression in H9c2 rat atrial cells. [score:3]
Adenovirus vector without miRNA-223 (adv-miR-free) knockdown in WT mice was used as the NC (Fig. 3C). [score:2]
To determine CACNA1C as the cognate target of miR-223, we cloned the fragments containing CACNA1C-miR-223 binding sites into the 3′ UTR of the luciferase gene for luciferase reporter activity assay. [score:2]
In the second approach, we injected anti-miRNA-223 into wild type mice to knockdown the endogenous miRNA-223. [score:2]
We then determined that if the AF is regulated by miRNA-223. [score:2]
How to cite this article: He, F. et al. Oxidized Low-density Lipoprotein (ox-LDL) Cholesterol Induces the Expression of MiRNA-223 and L-type Calcium Channel Protein in Atrial Fibrillation. [score:2]
Our computational analysis suggested that miR-223 regulates the CACNA1C gene as it contains multiple sequence motifs complementary to the “seed site” of miR-223 in its 3′ UTR and coding regions (Fig. 2 in the online-only Data Supplement). [score:2]
We have discovered that miRNA-223 regulates the CACNA1C gene and its encoded L-type Ca [2+] channels. [score:2]
It is possible that these actions result from the regulation of distinct apoptotic and constriction factors by miR-223 repress IGF-1R. [score:2]
Levels of miRNA-21 and miRNA-133 remained no change in the AF group (Fig. 3E) while the miRNA-223 level reciprocally decreased by 2-fold in the miRNA-223 knockdown mice (Fig. 3F). [score:2]
We confirmed the relationship between miRNA-223 and ox-LDL changes in a dose-and time -dependent manner (Fig. 2B,C). [score:1]
Normalization of miRNA-223 levels may be a novel strategy for converting AF to a sinus rhythm in the clinical setting. [score:1]
Studies using confocal microscopy has identified a role for miR-223 in L-type calcium channel activity 21 32, because the L-type calcium channel is the principal Ca [2+] entry pathway in myocytes 33. [score:1]
Our results implicate the role of miR-223 in AF pathophysiology and pathogenesis. [score:1]
In addition, miRNA-223 triggered >3-fold I [Ca,L] amplitudes and a tendency towards higher diastolic [Ca [2+]] [i] in AF patients than controls. [score:1]
A “dose-response” relationship between miRNA-223 and ox-LDL levels was observed. [score:1]
3′ UTR of miR-223 mRNA contains two highly conserved binding sites (from positions 35–57 and 1743–1765) (Supplement Figure 2). [score:1]
Ctl; (B) Western blot analysis of Cav1.2 and Cav β1 proteins in atrial tissues from miR-223 Tg and WT mice. [score:1]
Ctl, mock -treated with ox-LDL; AMO, antisense oligonucleotides against miR-223; NC, negative control. [score:1]
We also observed that miR-223 decreased myocardial constriction and induced myocardial cell apoptosis. [score:1]
Ox-LDL results in almost immediate activation of miR-223, which is the major cellular pathway to ox-LDL production. [score:1]
The involvement of miRNA-223 during AF. [score:1]
Another major strength of our study is that our results implicate that miR-223 in the attenuation of AF remo deling relates to Ca [2+]-handling abnormalities. [score:1]
The induction of CACNA1C by mi-223 was further verified by western blotting in neonatal mouse atrial myocytes transfected with miR-223 (Fig. 4B). [score:1]
The level of miR-223 was previously shown to be increased in animals and humans with AF exposed to ox-LDL, which promoted myocardial cell apoptosis 26. [score:1]
Moreover, Ca [2+] flux in cultured myocytes is accelerated by miR-223. [score:1]
Moreover, miRNA-223 increases the L-type Ca [2+] channel proteins supports a [Ca [2+]] [i] -dependent mechanism in Ca [2+] current activation by ox-LDL 35 36. [score:1]
confirmed that miRNA-223 levels were two times higher in the AF group than the non-AF group. [score:1]
To test this hypothesis, two miRNA-223 loss-of-function approaches were adopted. [score:1]
Similar effect of miR-223 on CACNA1C transcription was also found in miR-223/Tg mice and cultured neonatal rat atrial myocytes. [score:1]
In brief, Rno– miRNA-223 precursor DNA (5′-GGATCCgACCCCGTCCCCCCGTCCTCCC CGAGTCCCTCTTTCGTAGATGTCGG GGACCGGGAGAGACGG GAAGGCAGGGGACAGGGGTTTAttttttAAGCTT-3′) was synthesized (GenScript, Shanghai, China) and inserted into the adenovirus shuttle plasmid pDC316-EGFP-U6 (Microbix Biosystems Inc. [score:1]
[1 to 20 of 62 sentences]
16
[+] score: 148
Other miRNAs from this paper: mmu-mir-320
Major findings of the present study include: 1) miR-223 -null MSCs did not improve myocardial function and survival rate when they were injected into septic mice; 2) blockade of exosome generation in vitro with GW4869 impaired MSC -induced suppression of inflammation in macrophages and offset MSC-elicited protective effects in cardiomyocytes upon LPS challenge; 3) miR-223-absent exosomes derived from KO-MSCs aggravated sepsis -induced heart failure, inflammatory response, and mortality through the exosomal transfer of Sema3A and Stat3 to the myocardium; and 4) miR-223-present exosomes derived from WT-MSCs attenuated sepsis-trigged myocardial depression through the exosomal transfer of miR-223 to recipient cells and consequently, down-regulated the expression of Sema3A and Stat3, leading to the reduction of inflammatory response and cell death (Fig. 8). [score:8]
As a result, the miR-223 targets (i. e., Sema3A and Stat3) were down-regulated, leading to the inhibition of inflammatory response in macrophages and attenuation of cardiomyocyte death during sepsis (Fig. 8). [score:8]
Put together, these results indicate that WT-exosomes could deliver miR-223 to the myocardium and consequently, inhibit the expression of Sema3A and Stat3, two bona fide targets of miR-223; whereas miR-223- KO exosomes could deliver Sema3A and Stat3 proteins to the myocardium. [score:7]
Importantly, the miR-223 expression could be down-regulated by LPS in macrophages, leading to an increased secretion of IL-6 and IL-1β 29. [score:6]
These results suggest: 1) immune-regulatory mechanisms of MSCs in sepsis may take effect through paracrine factors rather than direct cell contact; and 2) endogenous miR-223 may be critical, at least in part, for MSC-elicited immuno-suppression. [score:5]
To test this hypothesis, we firstly determined the expression levels of Sema3A and Stat3, two major inflammatory targets of miR-223, in MSCs collected from miR-223- KO mice and WT (miR-223 [+/+]) mice. [score:5]
Haneklaus et al. revealed that overexpression of miR-223 in THP-1 cells (a human acute monocytic leukemia cell line) prevents accumulation of NLRP3 protein and inhibits IL-1β production from the inflammasome 40. [score:5]
Likewise, apart from Sema3A, miR-223-5p (also named as miR-223*) is predicted to target TRAF family member -associated NF-kappa B activator (TANK), tumor necrosis factor receptor superfamily member 21 [TNFRSF21, also known as death receptor 6 (DR6)], and interferon regulatory factor 4 (IRF4), etc (see database available at www. [score:4]
Most importantly, diverse targets of miR-223 (5p and 3p) appear to function in concert to regulate inflammatory response during sepsis. [score:4]
Taken together, these data suggest that absence of miR-223 is not able to change the size of exosomes released from MSCs, but could impair the beneficial effects of MSC-derived exosomes on inhibition of macrophage inflammatory response and cardiomycoyte death during sepsis. [score:3]
These data suggest that: 1) MSC-derived exosomes can be used in place of intact stem cells to inhibit sepsis -induced inflammatory response; and 2) MSC-exosome -induced anti-inflammatory effects are dependent on miR-223, at least in part. [score:3]
Next, we asked whether MSC-derived exosomes had immune-suppressive effects, similar to MSCs in vivo, and if so, whether miR-223 is required for such effects. [score:3]
Loss of miR-223 in MSCs negates MSC -induced inhibitory effects on CLP-triggered systemic inflammatory response. [score:3]
Collectively, these data suggest that MSC -mediated cardio-protection in sepsis may be dependent on the expression of endogenous miR-223. [score:3]
Loss of miR-223 in MSCs impairs the inhibitory effects on systemic inflammation elicited by WT-MSCs. [score:3]
Put together, these data suggest that the immune -inhibitory property of MSCs is associated with miR-223. [score:3]
We also validated that the expression of both strands (miR-223-5p and miR-223-3p) was deficient in MSCs collected from miR-223- KO mice (Fig. 1I). [score:3]
WT-MSCs suppress LPS -induced cytokine release from macrophages to a greater degree than miR-223- KO MSCs. [score:3]
A work mo del elucidating that miR-223 contributes to MSC-elicited protective effects against sepsis through the exosome -mediated transfer of miR-223 to other types of cells (i. e. macrophages and cardiomyocytes), leading to attenuation of inflammatory response and inhibition of cell death in recipient cells. [score:3]
WT-MSC exosomes suppress LPS -induced pro-inflammatory cytokine release from macrophages and protect cardiomyocytes against LPS injury, whereas miR-223- KO exosomes exhibits opposite effects. [score:3]
We selected Sema3A and Stat3 for this study, because both are consistently validated to be bona fide targets of miR-223 in macrophages and cardiomyocytes 22 29. [score:3]
Therefore, all the observations consistently implicate alteration of miR-223 as a critical factor for the pathogenesis of inflammation-related disease, especially during the process of septic shock. [score:3]
In the present study, we provide novel evidence showing that miR-223 may be required for MSC-elicited inhibition of inflammatory response in sepsis. [score:3]
MiR-223- KO MSCs were phenotypically similar to WTs, and expressed mesenchymal markers (i. e. CD29 and Sca-1), but not hematopoietic markers (i. e. CD34) (Fig. 1A–H). [score:2]
MiR-223 is critical for MSC -mediated inhibitory effects on the cytokine production in macrophages upon LPS challenge. [score:2]
Mating pairs of miR-223 knockout mice on the background of C57BL/6 (male: miR-223 [−/y] and female: miR-223 [−/−]) and wild-type C57BL/6 mice were purchased from Jackson Laboratory (Indianapolis, IN). [score:2]
For example, Dorhoi et al. recently showed that miR-223 controls susceptibility to tuberculosis by regulating lung neutrophil recruitment 39. [score:2]
Our study suggests that miR-223-bearing exosomes may have a great therapeutic potential for the treatment of sepsis. [score:1]
It may be easy to interpret that miR-223 -null stem cells may not only secret “harmful” exosomes but also release some beneficial factors. [score:1]
Our findings for the first time suggest that MSC -induced protective effects on sepsis may be largely dependent on exosomal miR-223. [score:1]
We therefore speculated that the presence or absence of miR-223 in MSCs might affect cellular levels of Sema3A and Stat3, which were consequently incorporated into exosomes at different concentrations. [score:1]
By contrast, KO-exosome -treated hearts did not show the increased levels of miR-223 (5p and 3p) (Fig. 7K). [score:1]
Exosomes derived from WT-MSCs attenuate cardiac dysfunction and improve animal survival in polymicrobial sepsis, whereas exosomes released from miR-223- KO MSCs yield opposite effects. [score:1]
The effects of WT-exosomes and miR-223- KO exosomes on CLP -induced inflammatory response, cardiac dysfunction and animal mortality. [score:1]
On the contrary, exosomes released from miR-223-absent MSCs contain higher levels of Sema3A and Stat3, which might be delivered to macrophages and cardiomyocytes, leading to promotion of macrophage inflammation and cardiomyocyte death in sepsis. [score:1]
Notably, we utilized sucrose gradient ultracentrifugation to further purify exosomes from culture supernatants of MSCs, as described previously 28, and also confirmed that miR-223 was included in exosomes derived WT-MSCs rather than KO-MSCs (Supplemental Fig. S1). [score:1]
We next determined whether miR-223 affects MSC -induced cardio-protection in sepsis. [score:1]
Absent of miR-223 impairs MSC -induced protection against sepsis-triggered cardiac injury. [score:1]
Notably, miR-223- KO MSCs did not significantly attenuate the secretion of these pro-inflammatory factors in macrophages upon LPS challenge (Fig. 3B–D). [score:1]
Accordingly, hearts collected from miR-223- KO-exosome -treated mice displayed higher levels of Sema3A and Stat3 than PBS -injected samples (Fig. 7I,J). [score:1]
This suggests that miR-223 may be essential for MSC-elicited beneficial effects on survival during polymicrobial sepsis. [score:1]
Using a particle size analyzer, we observed that the size of exosomes released from WT-MSCs (WT-Exo) ranged between 10–100 nm with an average of 34.68 nm, which was similar to that of miR-223- KO MSC-derived exosomes (KO-Exo: 35.52 nm) (Fig. 5A,B). [score:1]
As such, unlike the purified exosomes displaying promotion of sepsis-triggered inflammation, miR-223 -null MSCs did not exaggerate sepsis -induced injury. [score:1]
miR-223- KO exosomes can deliver Sema3A and Stat3, whereas WT-exosomes can deliver miR-223 to the myocardium in vivo. [score:1]
Our prior work also demonstrated that miR-223 was the most decreased miRNA in heart tissues collected from severe septic mice, and miR-223- KO mice were sensitive to sepsis -induced injury 22. [score:1]
It has been shown that: 1) miR-223 is highly enriched in not only bone marrow stem cells but also their released exosomes (Fig. 5D and Ref. [score:1]
Taken together, these observations suggest that MSC-released exosomes may have therapeutic effects on sepsis -induced heart failure and mortality, which is associated with exosomal miR-223. [score:1]
In summary, our findings presented here for the first time demonstrate that: 1) cardio-protective effects of MSCs in sepsis are associated with exosomal miR-223; and 2) ablation of miR-223 in MSCs can reprogram protein contents of exosomes, which yields detrimental effects on recipient cells. [score:1]
It is important to note here, our results presented in this study showed that the effects of miR-223 -null MSCs and their released exosomes on the inflammatory response were different. [score:1]
WT-exosomes transfer miR-223, whereas KO-exosomes transport Stat3 and Sema3A proteins, to the myocardium in vivo. [score:1]
However, unlike the CLP mice treated with miR-223- KO MSCs (Fig. 1K–M), exosomes derived from miR-223- KO MSCs aggravated cardiac dysfunction in septic mice, comparable to those CLP mice treated with control medium ((Fig. 6E,F, n = 8–11). [score:1]
Injection of WT-exosomes attenuates CLP -induced systemic inflammatory response, whereas treatment with miR-223- KO exosomes displays opposite effects. [score:1]
As for how miR-223 contributes to MSC -induced protective effects, it could be mediated by exosomes, a group of nano-vesicles actively released from MSCs. [score:1]
Hence, our study timely provides the first evidence showing that MSCs are able to reprogram macrophages and cardiomyocytes during sepsis via the exosome -mediated transfer of miR-223. [score:1]
Remarkably, the reduction of EF% and FS% was attenuated in WT-exosome -treated CLP mice (n = 11); whereas it was aggravated in CLP mice administrated with miR-223- KO exosomes (n = 11) (^ p < 0.05 vs. [score:1]
To address whether miR-223 contributes to MSC -induced protection in sepsis, we harvested MSCs from bone marrow of female miR-223 KO (miR-223 [−/−]) mice. [score:1]
Administration of miR-223- KO MSCs does not improve animal survival and cardiac function in CLP -induced sepsis mo del. [score:1]
In this study, we showed that WT-MSCs could secret miR-223-enriched exosomes, which were subsequently taken up by recipient cells (i. e., macrophages and cardiomyocytes). [score:1]
Of importance, we observed that exosomes released from miR-223- KO MSCs contained higher levels of Sema3A (2.1-fold) and Stat3 (2.8-fold) than WT-exosomes (Fig. 7D,E, p < 0.05). [score:1]
By contrast, all mice treated with miR-223- KO exosomes died at 28 h post-CLP (Fig. 6G). [score:1]
To understand the functional significance of miR-223 in MSC -mediated protection against sepsis injury, miR-223- KO MSCs and controls were administered intravenously to male WT mice at 1 h post-CLP surgery. [score:1]
We next tried to figure out the possible mechanisms underlying the beneficial effects of WT-exosomes and detrimental effects of miR-223- KO-exosomes in sepsis. [score:1]
Remarkably, miR-223-containing exosomes (WT-exosomes) protected cardiomyocytes against LPS -induced cell death/apoptosis, evidenced by higher degree of cell survival and lower degree of cellular DNA fragmentation in WT-exosome -treated cardiomyocytes than those exposed to medium controls (Fig. 5H–J). [score:1]
This might be attributed to WT-exosome -mediated delivery of miR-223 to the heart. [score:1]
WT-exosomes transfer miR-223, whereas KO-exosomes transport Stat3 and Sema3A proteins, to the myocardium in vivoWe next tried to figure out the possible mechanisms underlying the beneficial effects of WT-exosomes and detrimental effects of miR-223- KO-exosomes in sepsis. [score:1]
By contrast, no difference in either EF% or FS% was identified between the miR-223- KO MSC- and the vehicle -treated groups (Fig. 1K–M). [score:1]
Nonetheless, we believe that our study may suggest that therapeutic effects of MSCs on sepsis are, at least in part, dependent on the axis of miR-223-Sema3A/Stat3 mediated by exosomes. [score:1]
Therefore, MSC -induced anti-inflammatory effects may be largely through exosomal transfer of miR-223 to multiple tissues/organs during sepsis. [score:1]
These data implicate that ablation of miR-223 in stem cells is able to reprogram the protein contents of exosomes. [score:1]
The dissimilarity in functional consequence may be ascribed to other beneficial factors released from miR-223 -null MSCs in addition to these detrimental exosomes. [score:1]
Nonetheless, the data present in this study raise a novel hypothesis that miR-223-containing exosomes derived from MSCs may represent a new effective therapeutic approach for the treatment of sepsis -induced multiple organ failure. [score:1]
How to cite this article: Wang, X. et al. Exosomal miR-223 Contributes to Mesenchymal Stem Cell-Elicited Cardioprotection in Polymicrobial Sepsis. [score:1]
It is worthy to note here that the miR-223 gene is located at X-chromosome 37. [score:1]
[1 to 20 of 73 sentences]
17
[+] score: 117
In addition, our results showed that miR-223 was primarily located in the Kupffer cells, but its expression levels were significantly up-regulated in hepatocytes, hepatic stellate cells and Kupffer cells after infection. [score:6]
We found miR-223 was primarily located in the Kupffer cells, and the expression level of miR-223 was significantly up-regulated in all these three types of resident liver cells post-infection, which suggests that the elevated serum miR-223 is derived from the infected liver. [score:6]
Relative miR-223 expression in comparison with uninfected hepatocytes was determined by qPCR (A), and the miR-223 expression levels of hepatocytes, HSCs and Kupffer cells after infection were analyzed (B). [score:5]
Bioinformatics analyses (TargetScan analysis [28] and Gene ontology analysis [29]) revealed a potential role of miR-223 in transcription regulator activity, transcription factor activity and DNA binding (Figure  4C). [score:4]
To identify miRNAs that reflected the schistosome infections and PZQ chemotherapy, six miRNA candidates (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) were selected for analysis in serum that were commonly deregulated in human liver diseases. [score:4]
However, a significant elevated expression level of miR-223 was detected in not only the Kuppfer cells, but also hepatocytes and HSCs after infection (Figure  4B). [score:3]
Therefore, we analyzed the expression level of miR-223 in serum of other hosts of schistosomes, including rabbits, buffalos and humans. [score:3]
Using a mouse mo del of schistosomiasis japonica, we found that the expression level of serum miR-223 was significantly elevated after infection, yet returned to near normal levels after treatment with the anti-helminth drug PZQ. [score:3]
We also conducted a separate experiment to determine the expression level of serum miR-223 in the progression of mouse schistosomiasis. [score:3]
All the rabbits were sacrificed at 56 days after infection to quantify the miR-223 expression level in the sera. [score:3]
We isolated the primary resident livers cells, including hepatocytes, hepatic stellate cells (HSCs) and Kupffer cells, to quantify the expression level of miR-223. [score:3]
Using a mouse mo del of Schistosoma japonicum infection, we found that the expression level of serum miR-223 was significantly elevated after infection, but returned to near normal levels after the treatment with praziquantel (PZQ). [score:3]
Therefore, we analyzed the expression level of miR-223 in serum of other host species of schistosome, including rabbits, buffalos and humans. [score:3]
Figure 4 Expression level of miR-223 in resident liver cells. [score:3]
Expression level of circulating miR-223 in the progression of schistosomiasis. [score:3]
Hydroxyproline content of liver samples (A) and miR-223 expression level of serum samples (B) from the four groups were determined, respectively. [score:3]
Next, we analyzed the expression level of serum miR-223 in the progression of mouse schistosomiasis. [score:3]
Expression levels of serum miR-223 (B), miR-122 (C), miR-34a (D), miR-199a-5p (E) miR-199a-3p (F), and miR-146b (G) were detected in the three groups of mice. [score:3]
Expression level of circulating miR-223 in human and other animal mo dels with schistosomiasis. [score:3]
The expression levels of miR-34a, miR-223, miR-122, miR-146b, miR-199a-5p, miR-199a-3p were determined using the SYBR Green Master Mix kit (TaKaRa, Dalian, China). [score:3]
Figure 2 Correlation between serum miR-223 expression level and liver hydroxyproline content in the infected mice. [score:3]
Considering the Kupffer cells are essential for the development of schistosomiasis -induced inflammation and fibrosis [38], our data implied that miR-223 could play an important role in the pathogenesis and progression of schistosomiasis japonica via regulating the function of Kupffer cells. [score:3]
As shown in Figure  3, the miR-223 expression level was obviously elevated in the serum of infected rabbit, buffalo and human, which validated the results of the miR-223 obtained from the mouse mo del of human schistosomiasis. [score:3]
In this study, we isolated the primary hepatocytes, HSCs and Kupffer cells from the infected and uninfected livers to quantify the expression level of miR-223. [score:3]
It is true that the elevated level of the serum miR-223 was associated with schistosomiasis, but it may not be specifically associated with the disease because the elevated level of the miR-223 was also observed in chronic hepatitis [18]. [score:3]
Figure 3 Expression level of the serum miR-223 in rabbit, buffalo and human with schistosomiasis. [score:3]
Expression level of miR-223 in resident liver cells and its potential function. [score:3]
Importantly, bioinformatics analyses showed that miR-223 potentially functions in transcription regulator activity, transcription factor activity and DNA binding. [score:2]
This suggested that miR-223 could regulate the transcription of some important genes in the Kupffer cells to modulate their function. [score:2]
Bioinformatics analyses revealed a potential functional role of miR-223 in transcription regulator activity, transcription factor activity and DNA binding. [score:2]
Previous studies have also shown that circulating miRNA-146a and miR-223 were significantly reduced in septic patients [19], while serum miRNA-122 and miRNA-192 were elevated in a mouse mo del of drug -induced liver injury [20]. [score:1]
For example, serum miR-21, miR-122 and miR-223 are elevated in patients with hepatocellular carcinoma and chronic hepatitis and thus, have the potential to serve as novel biomarkers for liver injury [18]. [score:1]
In mouse hosts, quantitative PCR result revealed that circulating miR-223, miR-122 and miR-34a were significantly elevated after infection (Figure  1B-D). [score:1]
Only one serum miRNA in infected mice, however, decreased significantly after the PZQ treatment (miR-223, Figure  1B). [score:1]
We validated the elevated level of the circulating miR-223 in serum samples of other host species including rabbits, buffalos and humans. [score:1]
Importantly, the level of serum miR-223 reflected the extent of liver pathology post-infection. [score:1]
In addition, we observed that circulating miR-223 was also significantly elevated in other hosts infected with S. japonicum, including rabbits, buffalos and humans, validating the results of the murine mo del. [score:1]
These results indicate that miR-233 was a schistosomiasis -associated miRNA, and thus circulating miR-223 may serve as a new potential biomarker for the detection of schistosome infection and the assessment of the response to chemotherapy. [score:1]
Bioinformatics analyses were also conducted to assess the potential function of miR-223. [score:1]
Importantly, the level of serum miR-223 was significantly correlated with the hydroxyproline content in the liver tissue (r = 0.808, P < 0.001), which suggests that the level of serum miR-223 could reflect the extent of liver pathology after infection (Figure  2C). [score:1]
This study suggested that the circulating miR-223 could serve as a potential new biomarker for the detection of schistosome infection and the assessment of the response to chemotherapy. [score:1]
As expected, the level of circulating miR-223 increased significantly during the course of infection (Figure  2B). [score:1]
We analyzed the serum levels of six selected candidate miRNA molecules (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) from mice, rabbits, buffalos and humans infected with Schistosoma japonicum using qPCR. [score:1]
Moreover, the serum miR-223 level was significantly correlated with the liver egg burden (r = 0.603, P = 0.008, Figure  2F). [score:1]
For examples, serum miR-155 is the potential biomarker for B-cell lymphoma [30] but also for other cancers such as breast cancer [31], ovarian cancer [32], and pancreatic cancer [33]; Serum miR-92 is the potential biomarker for colon cancer [34], but also leukemia [35], and ovarian cancer [32]; Circulating miR-223 is the potential biomarker for chronic hepatitis [18], but also for schistosomiasis observed in this study. [score:1]
To test this hypothesis, we selected six candidate serum miRNAs for analysis (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) in the murine mo del of human schistosomiasis and then performed validation in other host species including rabbits, buffalos and human patients infected with S. japonicum. [score:1]
Importantly, we found that the level of serum miR-223 reflected the extent of liver pathology post-infection. [score:1]
We found that miR-223 was primarily located in the Kuppfer cells of both infected and uninfected livers (Figure  4A). [score:1]
In addition to the association of the serum miR-223 with schistosomiasis, we also showed that the levels of the circulating miR-223 were significantly declined and returned to normality after treatment of the host with the anti-helminth drug, praziquantel. [score:1]
The potential role of miR-223 was analyzed by bioinformatics analyses (C). [score:1]
[1 to 20 of 50 sentences]
18
[+] score: 101
Other miRNAs from this paper: mmu-mir-133a-1, mmu-mir-146a, mmu-mir-150, mmu-mir-133a-2
These analyses revealed a significant upregulation in the lung, while expression of miR-223 was downregulated in kidney and unaffected from the induction of septic disease in the other organs, including liver, brain, heart, and muscle (Figure 1(d)). [score:11]
In summary, our analysis reveals that, in contrast to previous studies reporting a downregulation [11] or upregulation [12] of miR-223 in serum of patients with septic disease, miR-223 levels are only slightly altered in critical illness and sepsis, indicating that miR-223 measurements from serum are not suitable to detect sepsis. [score:7]
A specific deregulation of microRNA miR-223 was described in different disease states associated with a systemic inflammatory response such as bacterial infections or autoimmune diseases. [score:6]
While Wang et al. described higher levels of miR-223 in septic patients [12] and suggest a direct association between high miR-223 serum levels and patients' outcome [13], Wang et al. reported lower levels of miR-223 in the serum of patients with septic disease [11], thus highlighting the need for further studies clarifying the regulation of miR-223 during bacterial infection and sepsis. [score:5]
When we analyzed serum levels of miR-223 with respect to disease severity, we found significantly lower levels in patients with more severe disease according to higher APACHE-II scores (>10), compared to patients with lower APACHE-II scores (<10) (P = 0.043; Figure 2(b)). [score:4]
Although this may represent an epiphenomenon of these diseases, recent evidence suggests that miR-223 is actively involved in regulation of inflammatory processes by limiting the inflammation to prevent collateral damage and tissue injury [8]. [score:4]
Finally, miR-223 expression was analysed in different organs after induction of sepsis by CLP surgery to further determine potential mechanism regulating miR-223 serum levels in sepsis. [score:4]
Moreover, the expression of miR-223 itself is regulated by inflammatory pathways such as NF- κB or the TLR4 pathway, suggesting a deep integration of this miRNA in inflammatory signaling cascades driving inflammation and anti-infectious responses in general [8]. [score:4]
Moreover, in endotoxin-challenge mo dels, miR-223 [−/Y] mice demonstrated elevated tissue destruction, thus highlighting a potential role of miR-223 in the pathophysiology of septic diseases and providing evidence for analysis of miR-223 in serum of sepsis patients. [score:3]
To translate our findings from these animal mo dels to human pathogenesis, we analyzed miR-223 serum levels in a large, well-characterized cohort of 221 critically ill patients (with and without sepsis), demonstrating that serum levels of miR-223 do not reflect the presence of septic disease and are not associated with the clinical outcome of patients during intensive care unit treatment. [score:3]
Our data thus strongly argue against a potential use of miR-223 as a blood based biomarker for septic disease. [score:3]
miR-223 has recently been proposed as a novel serum biomarker for sepsis and septic shock disease in two different Asian populations of sepsis patients. [score:3]
Considering the complexity of septic disease in humans, we first analysed serum levels of miR-223 in different well-established mo dels of experimental polymicrobial sepsis in mice such as cecal ligation and puncture (CLP) surgery and lipopolysaccharide (LPS) injection. [score:3]
Based on the contradictory data on alterations of miR-223 serum levels in patients with sepsis we decided to first analyse miR-223 serum concentrations in highly standardized mouse mo dels of septic disease. [score:3]
3.1. miR-223 Serum Levels in Murine Mo dels of Septic Diseases. [score:3]
In line with this assumption various targets of the miR-223 belong to the superfamily of inflammatory genes such as granzyme B, IKK-alpha, and STAT3. [score:3]
In summary, miR-223 serum levels of critically ill and sepsis patients are not significantly regulated compared to healthy controls and are only modestly associated with disease severity or outcome. [score:3]
Of note, results from these studies were conflicting: on the one hand, it was demonstrated in a cohort of 116 patients (43 with mild sepsis and 73 with severe sepsis/septic shock) that elevated miR-223 levels are indicative of the presence of septic disease [12] and correlate with an impaired prognosis in these patients [13]. [score:3]
In contrast to the results from CLP procedure, we found elevated serum levels of miR-223 in mice after LPS treatment, which is in line with previous reports. [score:1]
An increased immune response towards infectious agents such as Candida albicans was shown in miR-223 mutant mice (miR-223 [−/Y]). [score:1]
Relative expression of miR-223 in serum and tissue was measured with quantitative real-time PCR (qPCR) as recently described [16]. [score:1]
Importantly, alterations in miR-223 serum levels were described in patients with sepsis, but have yet led to conflicting results. [score:1]
In these analyses, no significant differences in miR-223 levels between septic and nonseptic patients were evident (P = 0.529; Figure 3(a)). [score:1]
3.2. miR-223 Serum Levels in Critically Ill Patients and Healthy Controls. [score:1]
Elevated levels of miR-223 were suggested to discriminate between SIRS and sepsis patients with high sensitivity and specificity [11]. [score:1]
Beside others, it was shown that miR-223 is critically involved in the differentiation and maturation of key players of the innate immune response. [score:1]
To determine whether miR-223 serum levels might be indicative for patients' prognosis during and after ICU treatment, we first performed correlation analysis between miR-223 levels and classical markers of organ dysfunction. [score:1]
While miR-223 serum levels showed a significant correlation with decreased renal function (Table 3), no correlation with acute liver injury or an impaired liver synthesis capacity could be established. [score:1]
As determined by miRNA-specific qPCR, miR-223 levels were moderately, but significantly, elevated 8 h after injection of LPS (Figure 1(a)). [score:1]
Of note, besides sepsis, conflicting results of miR-223 serum levels have also been described in patients with HCC or chronic hepatitis B [23– 25], highlighting the need for further efforts in defining standards for sample preparation, data normalization, and data analysis in this setting. [score:1]
Of note, the fact that circulating miR-223 is independent of the presence of sepsis was further substantiated by correlation analyses revealing that serum miR-223 levels were not correlated to established markers of systemic inflammation and bacterial infection such as C-reactive protein (CRP), procalcitonin (PCT), interleukin-6 (IL-6), interleukin-10 (IL-10), or tumor necrosis factor (TNF) in critically ill patients (Table 3). [score:1]
However, despite the large number of samples analysed, we failed to demonstrate significant alterations in serum miR-223 concentrations in critical illness and sepsis. [score:1]
3.3. miR-223 Serum Levels Do Not Indicate Sepsis in Critically Ill Patients. [score:1]
Despite these negative correlation analyses and the fact that miR-223 serum levels did not significantly vary between critically ill patients and healthy controls or between septic and nonseptic patients, we next analyzed whether they might be useful in predicting mortality in critically ill patients. [score:1]
In the present study, we analysed miR-223 serum levels in a well-defined cohort of 223 critically ill patients. [score:1]
Of note, we found a trend towards lower levels of miR-223 in critical illness, which is in line with the data of Wang et al. [11] who also used spiked-in RNA for normalization. [score:1]
3.4. miR-223 Serum Concentrations Do Not Predict Survival in Critically Ill Patients. [score:1]
While we used spiked-in RNA (SV40) for normalization of miR-223 serum levels, Wang et al. used an internal reference gene, namely, snU6, for normalization in their studies [12, 13]. [score:1]
We next analyzed levels of circulating miR-223 in sera of 221 patients at admission to the ICU as well as in 75 healthy volunteers. [score:1]
In contrast, levels of circulating miR-223 remained unaffected at different time points after induction of sepsis by using the CLP mo del, which closely resembles human sepsis (Figures 1(b) and 1(c)). [score:1]
However, also this analysis revealed no differences in miR-223 serum concentration between the different subgroups, thus excluding the fact that potential alterations in miR-223 levels might only exist in a specific group of patients and be masked if these patients are merged with other patients (Figure 3(b), Table 2). [score:1]
In the present study we demonstrate that miR-223 levels remained unchanged in mice after CLP surgery, thus reflecting the situation in patients. [score:1]
Since miR-223 was shown to be involved in the pathophysiology of type 2 diabetes [8], we analyzed potential correlations between miR-223 serum levels and the presence of obesity or type 2 diabetes. [score:1]
Importantly, we found no significant differences in circulating miR-223 between patients with obesity or normal body weight (Figure 2(c)) and those with or without type 2 diabetes mellitus, respectively (Figure 2(d)). [score:1]
[1 to 20 of 44 sentences]
19
[+] score: 98
In addition, pair-wise analyses revealed 42 common targets for miR-182 and miR-142-3p, 34 common targets for miR-182 and miR-223, and 7 common targets for miR-142-3p and miR-223 (Table S1, Fig. 2A). [score:7]
Consequently, MCF-7 cells were transfected with pCMV-MIR182, pCMV-MIR223, and pCMV-MIR (=empty or scrumble vectors) to induce their overexpression and to analyze the protein expression of their targets, that is, IGF-1R, FOXO3A, and FOXO1A. [score:7]
In line with this, transfection -induced over -expression of mature miR-223 significantly inhibited IGF-1R and FOXO3A protein levels (P < 0.05), while milder effects on FOXO1A protein expression were observed (Fig. 4C and D). [score:7]
Estradiol regulates miR-182 and miR-223 expression and their identified targets leading to activation of insulin/IGF-1 signaling pathway in MCF-7 cells. [score:6]
The most noteworthy novel finding was that in skeletal muscle, HRT use associates with down-regulation of miR-182, miR-223, and miR-142-3p, which modulate the expression of central players in the insulin/IGF-1 pathway, namely IGF-1R and FOXO3A. [score:6]
First, the down-regulation of miR-182 and miR-223 in the HRT users accorded with the higher mRNA and protein expression of IGF-1R, which in all likelihood leads to higher activity of the following PI3K/Akt-pathway in HRT users compared to nonusers. [score:5]
Figure 6The effects of estrogen stimulation on the expression of miR-182, miR-223, and miR-142-3p and their targets in infant female quadriceps femoris-derived myoblasts. [score:5]
Figure 4The effects of miR-182 and miR-223 over -expression on protein expression of IGF-1R, FOXO3A, and FOXO1A in MCF-7 cells. [score:5]
Identification of common pathways targeted by miR-182, miR-223, and miR-142-3p was obtained using the DIANA-microT 3.0 target prediction program (http://diana. [score:5]
Figure 5MiR-182, miR-223, and miR-142-3p expression and their target mRNA and protein levels under estrogen stimulation in MCF-7 cells. [score:5]
We found out that diaphragm muscle cells of young male mouse showed down-regulation of both miR-182 and miR-223 under exposure to 100 n m estradiol for 24 h (Fig. 7A) concomitantly with increased AKT phosphorylation (P < 0.05) (Fig. 7B). [score:4]
Both miR-223 and miR-142-3p were down-regulated by 100 n m E [2], the difference being highly significant for miR-142-3p (Fig. 6A). [score:4]
We also demonstrated here that IGF-1R, FOXO1A, and FOXO3A are direct targets for miR-223 (Fig. 3B, C, D). [score:4]
Putative pathways affected by miR-182, miR-223, and miR-142-3p are reported in Table 2. Among the putative target pathways, we found the insulin/IGF1 pathway (Fig. 2B). [score:3]
In addition, the loss-of-function of miR-223 resulted in an evident increase in the protein expression of IGF-1R (Fig. 4E). [score:3]
The next day, the cells were transfected with pCMV-MIR182/223 and pCMV-MIR (OriGene) or mirVana™ miRNA inhibitors (Ambion, USA) hsa-miR-223 ID:MH12301 (miR-223 antagomir), anti-miR negative control #1 (Mock) (Fig 3). [score:3]
Table S1 Common targets for hsa-miR-142-3p (250 elements), hsa-miR-182 (841 elements) and hsa-miR-223 (202 elements). [score:3]
Validation by quantitative PCR (qPCR) confirmed that the expression levels of miR-182, miR-223, and miR-142-3p in the HRT users were approximately one-third of that of nonusers (P = 0.05, 0.001 and 0.003, respectively; Fig. 1C), while miR-142-5p and miR-451 were not significantly different between HRT users and their nonuser co-twins. [score:3]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
In the present study, we confirmed that estrogen-regulated miRNAs, that is, miR-182, miR-223 and miR-142-3p, exist in skeletal muscle of postmenopausal women. [score:2]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
MiR array data showed miR-142-3p, miR-142-5p, miR-223, miR-182, and miR-451 to be hypo-expressed in the HRT users compared to nonusers (Fig. 1B). [score:2]
P-CMV-MIR182, p-CMV-MIR223, and p-CMV-MIR (empty vector) plasmids were shipped from OriGene (OriGene Technologies Inc. [score:1]
Each pLUC vector was co -transfected into the HEK293T cells with a plasmid-encoding Renilla luciferase along with a plasmid-encoding miR-182 or miR-223 or the empty vector. [score:1]
MiR-223 and miR-182 modulate IGF-1R, FOXO1A, and FOXO3A protein levels. [score:1]
Specifically, miR-182 and miR-223 participate in the modulation of the insulin/IGF-1 pathway signaling. [score:1]
Furthermore, we confirmed that miR-223 also represses both IGF-1R and FOXO3A. [score:1]
[1 to 20 of 27 sentences]
20
[+] score: 86
It is important to note that only 9 miRNAs (miR-100-5p, miR-130a-5p, miR-146b-3p, miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p, miR-301a-3p, and miR-495-3p) were significantly upregulated or downregulated in both lungs infected with either wild type w81 or the mouse-adapted ma81 strain at all time points (Tables  1 and 2). [score:7]
Groups of mice (n = 25) were transfected with 30 ug of miRNA inhibitors (miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p) or an miRNA negative inhibitor control (miRNA negative inhibitor control #1; Bioneer Co. [score:7]
Previous studies on expression of miR-155 and miR-223-3p in relation to immune responses and viral infections [52, 55- 58] have reported that miR-155-3p expression may inhibit malignant growth and viral infections [51, 52, 54, 55]. [score:7]
Groups of 8 (done twice, total 16) or 9 (lung viral titration) C57BL/6 mice were inoculated intranasally with ma81 H5N2 avian influenza virus (5 MLD50) 24 hours after individual transfection of 30 μg miRNA inhibitors (miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p) or an miRNA negative inhibitor control (miRNA negative inhibitor control #1; Bioneer Co. [score:7]
The current study confirms highly upregulated expression of miR-223-3p during influenza A virus infections, which has previously been reported following infection with pathogenic 1918 pandemic H1N1 influenza in mouse lungs infected with H5N1 and in pig lungs infected with H1N2 [23, 26, 27, 48, 59]. [score:6]
Twenty-seven and 20 differentially expressed miRNAs identified to be commonly presented at 1 and 3 dpi were presented in Tables  3 and 4. Of these, only miR-100-5p, miR-130a-5p, miR-146b-3p, miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p, miR-301a-3p, and miR-495-3p were commonly upregulated at both 1 and 3 dpi. [score:6]
Thus, these results indicate that inhibition of miR-151-5p and miR-223-3p reduces influenza replication in the lungs, while the overexpression of these miRNAs in the lungs augments influenza infection. [score:5]
Although the specific miRNA inhibitors could not completely attenuate mortality or reduce viral replication, the miR-151-5p- and miR-223-3p -inhibitors reduced mortality of inoculated mice to 70% and substantially delayed death. [score:5]
In our study, while miR-155-3p and miR-223-3p were highly expressed following infection with both w81 and ma81, their expression was more than 2-fold greater in pathogenic ma81-infected lungs than in w81-infected lungs. [score:5]
It is noteworthy that only 9 miRNAs (miR-100-5p, miR-130a-5p, miR-146b-3p, miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p, miR-301a-3p, and miR-495-3p) were significantly upregulated in both lungs infected with either wild type w81 or the mouse-adapted ma81 strain at both time points. [score:4]
Among the 238 differentially expressed miRNAs, we selected 4 miRNAs with greater than 2-fold differences in expression levels in the lungs of mice that were infected with either w81 or ma81 compared to mock control infections for in-depth analyses (miRNAs are miR-151-5p, miR-223-3p, miR-147-3p, and miR-155-3p) (Table  5). [score:4]
These results indicate that overexpression of miR-223-3p is detrimental to the host during influenza infection. [score:3]
Notably, expression levels of miR-151-5p, miR-223-3p, miR-147-3p, and miR-155-3p were higher in the lungs of mice infected with the ma81 virus than those infected with the w81 virus. [score:3]
Thus, inhibition of miR-223-3p might reduce the pathogenicity of this influenza virus in the host during infection. [score:3]
Notably, expression levels of miR-147-3p, miR-151-5p, miR-155-3p, and miR-223-3p were higher in the lungs of mice infected with the ma81 virus than those infected with the w81 virus. [score:3]
Inhibition of miR-147-3p, miR-151-5p, miR-155-3p, and miR-223-3p confers viral pathogenesis in mice. [score:3]
There were 3, 4, and 4 immune- and cell death-related GO terms of molecular function were enriched for the miR-151-5p, miR-155-3p, and miR-223-3p, respectively. [score:1]
Although identification of the precise roles of miR-155-3p and miR-223-3p during influenza infection will require further study, based on the results of this study and several others, it is apparent that miR-155-3p and miR-223-3p contribute to pathogenicity [23, 26, 27, 48, 58]. [score:1]
Specifically, these miRNAs have been implicated in immune responses (miR-223-3p and miR-147-3p), viral infection (miR-155-3p), and cell migration (miR-151-5p) [50- 56]. [score:1]
Moreover, the mice treated with anti-miR-151-5p and anti-miR-223-3p began to gain weight starting at 6 dpi and rapidly recovered their body weight thereafter (Figure  6). [score:1]
These miRNAs include miR-151-5p, miR-223-3p, miR-147-3p, and miR-155-3p (Table  5). [score:1]
Multiple functions for miR-223-3p have been previously reported [56], and miR-223-3p is known to promote granulocytic differentiation [53, 56]. [score:1]
Approximately 37.5% (6 out of 16) and 25% (4 out of 16) of mice treated with anti-miR-151-5p and anti-miR-223-3p, respectively, survived until the end of the experiment, whereas all untreated control mice were dead by 7 dpi. [score:1]
In addition, 25% of mice treated with anti-miR-223-3p regained their body weight and survived lethal influenza infection (Figure  6). [score:1]
[1 to 20 of 24 sentences]
21
[+] score: 81
IGF-1R expression was elevated in miR-223 deficient mice that received miR-223 deficient platelet transfusions and this upregulation was abolished when WT platelets were infused into miR-223 deficient mice (Fig.   5A). [score:6]
Although miR-223 is highly expressed in platelets, other cell types also express miR-223 [7]. [score:5]
This study indicates that inhibition of platelet miR-223, or activation of its downstream target IGFR1, are potential therapeutic strategies for prevention of arterial thrombosis. [score:5]
Some studies have shown that levels of miR-223 in the plasma are reduced following inhibition of platelet function [1], while others have shown a correlation between low plasma miR-223 levels and high on-treatment platelet reactivity 2, 3. In addition to serving as a biomarker of platelet activation, miR-223 may directly affect platelet function [4]. [score:4]
Consistent with previous studies that have demonstrated hematopoietic miR-223 may be transferred to other cell types such as endothelial cells 8, 9, and affect properties of endothelial cells [14], we demonstrated that platelet-to-endothelial transfer of miR-223 regulates thrombosis and that this effect is related to changes in vascular IGF-1R expression. [score:4]
Whether these effects of miR-223 on IGF-1R expression are responsible for the regulatory effects on thrombosis are not clear, however treatment of mice with an IGF-1R antagonist neutralized the protective effect of miR-223 deficiency on thrombosis (Fig.   5B). [score:4]
To validate this platelet-to-endothelial miR-223 transfer in a more physiological setting, miR-223 expression was analyzed in the carotid arterial wall following injury from miR-223 deficient recipients that received WT platelet transfusions. [score:3]
For miR-223 expression, microRNA from bEnd. [score:3]
After washing bEnd3 cells and then isolating RNA, expression of miR-223 was increased in bEnd3 cells incubated with WT ECVs (Fig.   4A). [score:3]
Figure 4(A) Expression level of miR-223 in mouse brain endothelial cells (bEnd. [score:3]
Since IGF-1R is a miR-223 target and has shown to be involved in endothelial apoptosis [9], we measured IGF-1R expression in injured carotid artery segments of miR-223 deficient mice that received WT or miR-223 deficient platelets. [score:3]
This study indicates that hematopoietic miR-223 is a potent regulator of arterial thrombosis following endothelial injury. [score:2]
These data establish the hematopoietic pool of miR-223 as playing a regulatory role in carotid thrombosis following endothelial injury. [score:2]
Others have also shown platelet-released miR-223 promotes endothelial cell apoptosis via regulatory effects on IGF-1R [9]. [score:2]
When miR-223 deficient ECVs were transfused into miR-223 deficient mice, the time to occlusion was similar to miR-223 deficient mice in the absent of transfusion. [score:1]
Figure 1(A) Time to occlusive carotid thrombosis in wild-type (WT) and miR-223 −/ y mice (n = 10 mice per group). [score:1]
ECVs isolated from WT or miR-223 −/ y mice as above were added to bEnd. [score:1]
8 week-old male WT mice were used as recipients receiving bone marrow from WT or miR-223 −/ y male donors. [score:1]
Male miR-223 deficient (miR-223 [−/y]) mice on the C57BL6/J strain background were purchased from Jackson Laboratory (Bar Harbor, Maine) and crossed to wild-type (WT) C57BL6/J females. [score:1]
3) after co-culture with extracellular vesicles (ECVs) from WT or miR-223 −/ y mice (n = 4 wells per group). [score:1]
To narrow down the relevant cell type even further, platelet transfusion experiments were performed in attempts to determine whether the platelet miR-223 pool was mediating the effects on thrombosis. [score:1]
However, our in vivo studies do support a role for platelet miR-223 in arterial thrombosis. [score:1]
To study the transportation of miR-223 from ECVs to endothelial cells, bEnd. [score:1]
The mechanism by which miR-223 platelets affect thrombosis time is unclear. [score:1]
Figure 3Time to occlusive carotid thrombosis in wild-type (WT) and miR-223 −/ y mice after platelet (PLT) transfusion (n = 10 mice per group). [score:1]
Similarly, when miR-223 deficient platelets were transfused into miR-223 deficient recipients, the time to thrombosis was similar to miR-223 mice in the absence of transfusion. [score:1]
However, when WT MVs were transfused into miR-223 deficient mice, the protection conferred by miR-223 deficiency was abolished (Fig.   4C). [score:1]
111.300539 23283721 2. Zhang, Y. Y. et al. Decreased circulating microRNA-223 level predicts high on-treatment platelet reactivity in patients with troponin -negative non-ST elevation acute coronary syndrome. [score:1]
Figure 2Time to occlusive carotid thrombosis in wild-type (WT) mice receiving WT bone marrow (BM) or miR-223 −/ y BM (n = 10 mice per group). [score:1]
In agreement with a previous study [5], platelet aggregation in response to ADP, collagen, or thrombin was similar between WT and miR-223 deficient mice (Fig.   1B,C,D). [score:1]
At 10 weeks of age, WT or miR-223 −/ y mice were treated intraperitoneally with AG-1024 (2 mg/kg in PBS) overnight. [score:1]
For platelet transfusion experiments, suspended platelets from WT or miR-223 −/ y mice were diluted to a concentration of 1 × 10 [8] platelets in 150 ul PBS, and transfused via tail vein into recipient mice (WT or miR-223 −/ y mice). [score:1]
To determine whether ECVs isolated from platelets were sufficient to affect the thrombosis phenotype, we next examined the effect of ECV transfusion, isolated from WT or miR-223 deficient platelets, to recipient miR-223 deficient mice on arterial thrombosis. [score:1]
For example, platelet-secreted miR-223 has been shown to be released from platelets and transported to endothelial cells [8]. [score:1]
The time to occlusive thrombosis in WT mice receiving bone marrow from miR-223 deficient mice was markedly prolonged and similar to times observed in non-transplanted miR-223 deficient mice (Fig.   2). [score:1]
These findings suggest that platelets transfer miR-223 to sites of arterial injury. [score:1]
However, when WT platelets were transfused into miR-223 deficient recipients, the protection from thrombosis was lost and thrombosis times were similar to WT mice (Fig.   3). [score:1]
Even after removal of thrombus, miR-223 could be detected from the injured artery but not the contralateral non-injured carotid artery (Fig.   4B). [score:1]
To induce thrombosis, photochemical injury [16] was performed on carotid arteries from non-BMT mice (WT vs miR-223 −/ y) or BMT mice receiving WT or miR-223 −/ y bone marrow, Briefly, mice were anesthetized and secured in the supine position under a dissecting microscope (Nikon SMZ-2T, Mager Scientific, Inc. [score:1]
This study also supports a role for cell autonomous miR-223 in platelet formation as lack of miR-223 was associated with a modest, but significant reduction in platelet counts. [score:1]
Recently, however, miR-223 was found to have no effect on platelet activation, adhesion, or aggregation in vitro, as well as no effect on tail bleeding times in mice [5]. [score:1]
Heterozygous females were then crossed with WT males to generate litters in which half of the male offspring were miR-223 [−/y] and half were miR-223 [+/y] (WT). [score:1]
To determine whether platelet miR-223 could be transferred to endothelial cells, ECVs from WT or miR-223 deficient mice were incubated overnight with bEnd3 cells. [score:1]
A recent study indicated that miR-223 deficiency is not associated with differences in platelet function [5] and our studies confirm this. [score:1]
Since platelet aggregation studies were similar between miR-223 −/ y and WT mice, we pursued the possibility that miR-223 might be secreted from the platelet after carotid injury and affect an endothelial phenotype. [score:1]
ECVs (150 μl in PBS per mouse) were transfused via tail vein into recipient miR-223 −/ y mice. [score:1]
[1 to 20 of 46 sentences]
22
[+] score: 55
Recently, it has also been found that miR-223 blocks myeloid cell proliferation and is down-regulated in most sub-types of human AML including FLT3/ITD expressing cells via targeting the cell-cycle regulator E2F1 [72]. [score:9]
Several miRNAs including miR-16 and miR-223 were down-regulated after transformation whereas several miRNAs including miR-21 were up-regulated after transformation of FDC-P1 cells by expression of FLT3/ITD. [score:9]
Thus, it can be postulated that suppressing CEBPα may down-regulate miR-223 expression in FD-FLT3/ITD cells. [score:8]
To validate microarray data, we performed QPCR using TaqMan miRNA assays on these three miRNA and confirmed that miR-16 and miR-223 were suppressed, whilst miR-21 was up-regulated in FD-FLT3/ITD cells correlating strongly with data from the microarray experiments. [score:5]
We then confirmed that a selection of these including miR-16, miR-223, and miR-21 are differentially expressed in FLT3/ITD expressing cells. [score:5]
We confirmed miR-16 and miR-223 were down-regulated: greater than two-fold lower in FD-FLT3/ITD cells compared to control cells. [score:3]
It has been reported that CEBPα induces miR-223 expression [72], [73]. [score:3]
However, we cannot rule out another mechanism of miR-223 mediated leukemic transformation because miR-223 could also be targeting another putative molecule, in addition to E2F1. [score:3]
It has been reported that miR-223 regulates normal granulopoiesis [68]. [score:2]
MiR-223 is preferentially expressed in myeloid cells [13], triggers granulocytic differentiation [69], and plays a crucial role in maturation and maintaining granulocytic function [70]. [score:2]
Among these miRNAs, we selected miR-16, miR-21, and miR-223 to validate the microarray data by quantitative real-time RT-PCR (QPCR), showing a high degree of correlation. [score:1]
The three miRNAs (miR-16, miR-223, and miR-21) selected from Fig. 2 were analysed by QPCR on total RNA from FD-FLT3/ITD cells. [score:1]
We selected miR-16, miR-21 and miR-223 on the basis of published reports relevant to the leukaemic phenotype. [score:1]
We selected miR-16, miR-223 and miR-21 from the set of miRNAs for further analysis on the basis of relevancy to the leukemia phenotype and published literatures. [score:1]
0044546.g003 Figure 3The three miRNAs (miR-16, miR-223, and miR-21) selected from Fig. 2 were analysed by QPCR on total RNA from FD-FLT3/ITD cells. [score:1]
In addition, miR-223 blocks differentiation towards other blood cells such as erythrocytes [71]. [score:1]
[1 to 20 of 16 sentences]
23
[+] score: 50
This suggests that miR-223 contributes to immune suppression by regulating the inhibitory system of immune responses of immune suppressive cells, such as MDSCs. [score:8]
Seven of these 10 miRNAs were upregulated (miR-223, 146a, 15b, 23a, 27a, 34a and 451) and three were downregulated (miR-101a, 101b and 148a) compared with that observed in the syngeneic grafts. [score:6]
The development of colonic inflammation in IL-10 knockout mice was accompanied by the upregulation of miR-101, miR-223 and miR-146a. [score:6]
Moreover, it has been reported that miR-223 regulates the differentiation of myeloid-derived suppressor cells (MDSCs) 22 that contribute to cancer evasion from the immune system via their high potential for suppressing the immune response 23. [score:6]
In vitro exposure of colonic intraepithelial lymphocytes to IL-10 resulted in the downregulation of miR-101 and miR-223 54. [score:4]
The miR-223, miR-23a and miR-15b levels were downregulated in the sera of multiple sclerosis patients. [score:4]
Further, the expression levels of miR-223 and miR-23a were altered in PBMCs from multiple sclerosis patients 35. [score:3]
The overexpression of miR-223 in MDSCs is associated with slower tumor growth in mice with reconstituted subcutaneous tumors 22. [score:3]
Furthermore, miR-223 level is highly predictive of acute rejection and strongly linked to the intragraft expression of CD3 mRNA 25. [score:3]
As shown in Figure 5 and 6, positive associations between the expressions of seven miRNAs, miR-223, 23a, 15b, 27a, 146a, 34a and 451, and both the pathological findings (Fig. 5A) and liver function (Fig. 6A) were consistent with the level of inflammation. [score:3]
MiR-223 is overexpressed in peripheral blood nuclear cells in renal allografted patients with acute rejection compared to that observed in those without acute rejection 24. [score:1]
The level of miR-223 is significantly higher in liver allografts with acute rejection in rats 26. [score:1]
These previous studies highlight the important role of miR-223 in allograft rejection and the potential use of the miR-223 level as a biomarker of allograft rejection. [score:1]
The results suggest that miR-223, 146a, 451, 34a and 15b are strongly correlated with inflammation, while miR-101a and 101b are correlated with the induction or maintenance of tolerance. [score:1]
[1 to 20 of 14 sentences]
24
[+] score: 48
Moreover, CTX significantly changed the expressions of mmu-miR-106b* (down-regulation), mmu-miR-144 (down-regulation), mmu-miR-669k* (down-regulation), mmu-miR-142-3p (up-regulation), mmu-miR-210 (up-regulation) and mmu-miR-223 (up-regulation) in CD34 [+]SCA1 [+] BMHSCs (Figure 3G–3L). [score:21]
To sum up, SHSB granule might cure CTX -induced myelosuppression and increase WBCs via enhancing CD34 [+]SCA1 [+] BMHSCs proliferation (SHSB granule up-regulated the expressions of mmu-miR-106b*, mmu-miR-144 and mmu-miR-669k*, as well as down-regulated the expressions of mmu-miR-142-3p, mmu-miR-210 and mmu-miR-223 in CD34 [+]SCA1 [+] BMHSCs). [score:13]
On the contrary, mmu-miR-142-3p (Figure 3J), mmu-miR-210 (Figure 3K) and mmu-miR-223 (Figure 3L) in CD34 [+]SCA1 [+] BMHSCs were up-regulated after CTX treatment. [score:4]
Shuanghuang Shengbai might promote the proliferation of CD34 [+]SCA1 [+] bone marrow hematopoietic stem cells via up -regulating mmu-miR-106b*, mmu-miR-144, and mmu-miR-669k*, as well as down -regulating mmu-miR-142-3p, mmu-miR-210, and mmu-miR-223. [score:3]
Therefore, SHSB might enhance BMHSCs proliferation via up -regulating mmu-miR-106b*, mmu-miR-144 and mmu-miR-669k*, as well as down -regulating mmu-miR-142-3p, mmu-miR-210 and mmu-miR-223. [score:3]
MiR-223 is preferentially expressed in bone marrow [31], and it induces human granulopoiesis [32]. [score:2]
These results indicated that SHSB reversed the effects of CTX on microRNAs like mmu-miR-106b*, mmu-miR-144, mmu-miR-669k*, mmu-miR-142-3p, mmu-miR-210 and mmu-miR-223 in CD34 [+]SCA1 [+] BMHSCs. [score:1]
Moreover, miR-32*, miR-466i-5p, and mmu-miR-669c in SP [+] lung cancer stem cells were confirmed, as well as mmu-miR-106b*, mmu-miR-144, mmu-miR-669k*, mmu-miR-142-3p, mmu-miR-210, and mmu-miR-223 in CD34 [+]SCA1 [+] bone marrow hematopoietic stem cells. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 47
For instance, miR-449-5p exerts anti-IAV activities by inhibiting histone deacetylase and, therefore, inducing IFNβ expression (18), and inhibition of miR-223-3p (which was more highly expressed in the DBA/2J strain in our study) reduced mortality and delayed death of H5N2-infected mice (64). [score:9]
miR-223-3p dampens NLRP3 inflammasome activity (70) and can inhibit inflammation by targeting STAT3 (71). [score:5]
Expression of 75 miRNAs, including miRNAs of the miR-21, miR-223, miR-34, and miR-449 correlated with both HA mRNA expression and any of the hematological parameters. [score:5]
These are comprised of miRNAs with a lower (miR-34b-5p and miR-92b-3p) or higher (miR-467e-5p) expression in DBA/2J vs C57BL/6J mice throughout the time course and those that are more highly expressed at 48 or 120 hpi only (miR-223-3p and miR-21a-3p). [score:5]
Of note, one of these miRNAs (miR-18a-5p) (as well as miR-223-3p, whose expression in addition differed between the two mouse strains) is among three miRNAs that were recently identified as being commonly regulated in the response to IAV infection in all four species screened, i. e., humans, pig, chicken, and mouse (63). [score:4]
The RT-qPCR analysis confirmed the higher expression of miR-223-3p, miR-21a-3p, and miR-467e-5p in DBA/2J and the lower expression of miR-34b-5p and miR-92b-3p after infection, compared to C57BL/6J (Figure 8B). [score:4]
Of these, miR-223-3p (whose expression correlated the most strongly with granulocyte numbers) is known to play important roles in the differentiation of myeloid cells, including neutrophils (56). [score:3]
Absolute granulocyte numbers and miRNA expression correlated most significantly in both mouse strains (23 miRNAs with significant correlations; violet circles in Figure 3), with miR-223-3p, miR-142-3p, and miR-20b-5p correlating the most positively in both mouse strains ([ρ [DBA/2J] + ρ [C57BL/6J]]/2 > 0.7). [score:3]
When FC values were used, RT-qPCR detected changes in miR-21a-3p, miR-223-3p, and miR-34b-5p expression in the same direction as measured by RNAseq, whereas no significant regulation was observed for miR-467e-5p and miR-92b-3p (Figure 8A). [score:3]
Expression of subsets of miRNAs correlated significantly with peripheral blood granulocyte and monocyte numbers, particularly in DBA/2J mice; miR-223-3p, miR-142-3p, and miR-20b-5p correlated most positively with these cell types in both mouse strains. [score:3]
Indeed, changes in expression of several of these 20 miRNAs (miR-147-3p, miR-155-3p, miR-223-3p, as well as the miR-34 and miR-449 families) correlate with IAV virulence (14, 15, 17, 64). [score:3]
[1 to 20 of 11 sentences]
26
[+] score: 41
Table 1 The role of miRNAs in autoimmune diseases miRNA Predicted/Identified targets Function Related diseases miR-22 IRF8Enhances CD11c [+]CD11b [+]B220 [−] cDC generation at the expense of pDCs miR-142 IRF8Plays a pivotal role in the maintenance of CD4 [+] DCs miR-142-3p IL-6 Specifically inhibits IL-6 expression by moDC MS miR-21 IL-12p35, Wnt1 Negatively regulates the production of IL-12 by moDC; negatively regulate the development of moDC SLE, IBD, UC, MS miR-10a IL-12/IL-23p40 Suppress the production of IL-12 and IL-23 by moDC SLE miR-148/152 Calcium/Calmodulin- dependent protein kinase IIa Suppress the production of IL-12 and IL-6 SLE miR-23b Notch1, NF-κB Inhibits the production of IL-12 while promotes IL-10 production UC miR-155 SOCS1, SHIP1, TAB2 Positively regulates the production of several pro-inflammatory cytokines including IL-6, IL-23, IL-12, and TNF-α RA, IBD miR-146a IRAK1, TRAF6 Negatively regulates TLR4-NF-κB pathway in monocytes RA, SLE, IBD miR-34a JAG1 Negatively regulates the development of moDC MS miR-223 C/EBPβNegatively regulates LCs -mediated antigen-specific CD8 [+] T cell proliferation, production of inflammatory cytokine TNFα, IL-1β, and IL-23 by intestinal DCs. [score:25]
As DCs are important regulators for IBD, we examined miRNA expression specifically in intestinal DC subsets and found that the expression of miR-223 by intestinal DCs decreased continuously during the progression of colitis. [score:6]
Mechanistic study revealed that miR-223 play an important role in maintaining the homeostasis of intestinal macrophages and DCs by directly targeting C/EBPβ (Zhou et al., 2015). [score:4]
MiR-223 was found highly expressed in freshly isolated epidermal LCs, and lack of miR-223 significantly increased LCs -mediated antigen-specific CD8 [+] T cell proliferation in vivo and in vitro (Mi et al., 2013). [score:3]
Intestinal DCs in miR-223 deficient mice showed a more pro-inflammatory phenotype and a decreased number of CX3CR1 [+] regulatory macrophages was also observed in miR-223 deficient mice. [score:2]
By using the DSS -induced colitis mouse mo del, we demonstrated that miR-223 deficiency resulted in more severe symptoms. [score:1]
[1 to 20 of 6 sentences]
27
[+] score: 41
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-155, mmu-mir-146b
Furthermore, we also found that SFN caused downregulation of LPS -induced expression of miR-155 and upregulation of miR-223 expression inhibited by LPS. [score:13]
miR-155, miR-146a, and miR-223 are known as immune miRNAs in brain and their expression levels in brain are associated with brain injury and neurodegenerative diseases (35, 36). [score:5]
Furthermore, SFN pretreatment significantly attenuated increased levels of miR-155 by LPS and increased downregulated miR-223 by LPS in microglia (Figure 10A). [score:4]
This is the first demonstration that microglial miR-223 expression is regulated by SFN. [score:4]
We found that LPS treatment significantly increased miR-155, miR-146a, and miR-223 expression levels in N9 cells (Figure 10A). [score:3]
However, miR-223 expression did not change (Figure 10D). [score:3]
Figure 10Sulforaphane (SFN) modulated miR-155 and miR-223 expression in N9 cells. [score:3]
However, the recovering effect of SFN on miR-223 expression is Nrf2 -dependent. [score:3]
miR-223 is a posttranscriptional regulator of inflammasome related protein NLRP3 (54). [score:2]
N9 cells were treated with SFN (5 µM) prior to lipopolysaccharide (LPS, 100 ng/ml) treatment for 24 h. (A) miR-155, miR-146, and miR-223 levels were analyzed with qPCR. [score:1]
[1 to 20 of 10 sentences]
28
[+] score: 39
In contrast, directly associated disease and biological function pathways were identified for miR-223 and involved gene pathways mainly associated with kidney disease, cancer, immunological disease, and biological processes associated with cell death and survival (Fig 7B). [score:8]
In comparison, signature miR-223 was shown to have direct associations with several gene pathways using IPA and its dysregulation has been recently associated with human biological processes including: disease activity for psoriasis in peripheral blood mononuclear cells [52], biomarker for colorectal cancer screening using fecal blood samples [53], pathogenesis of acute ischemic stroke using peripheral blood samples [54], and biomarker of autosomal dominant polycystic kidney disease progression using urine samples [55]. [score:7]
Expression of target miRNA seed sequences (A) miR-690 and (B) miR-223 determined to be important in radiation combined skin burn injury pathways of female B6D2F1/J mice subjected to skin burn injury alone (BURN), whole-body ionizing irradiation alone (RI) or when combined with skin burn injury (CI) compared to experimental control mice (SHAM) at 30 days survival. [score:4]
The IPA-generated gene networks for the top 20 connections associated with miRNA seed sequences miR-690 and miR-223 is illustrated in Fig 7. Interestingly, directly associated disease or biological function pathways could not be identified for miR-690 suggesting it to be unique for RCBI. [score:4]
0134827.g005 Fig 5Expression of target miRNA seed sequences (A) miR-690 and (B) miR-223 determined to be important in radiation combined skin burn injury pathways of female B6D2F1/J mice subjected to skin burn injury alone (BURN), whole-body ionizing irradiation alone (RI) or when combined with skin burn injury (CI) compared to experimental control mice (SHAM) at 30 days survival. [score:4]
Our miRNA expression microarray and validation experiments, conducted on serum exosome samples, identified four miRNA seed sequences that corresponded significantly to RI mice (miR-34b-3p, miR-3082-5p, miR-130a and miR-1912), and two miRNA seed sequences that corresponded significantly to CI mice (miR-690 and miR-223). [score:3]
From the microarray analysis derived sequences, both the miRNA seed sequences specific to CI mice were successfully validated for differential expression using quantitative RT-PCR as shown in Fig 5 (miR-690 and miR-223). [score:3]
Furthermore, only two major miRNA seed sequences (miR-690 and miR-223) were validated to be differentially expressed for CI mice specifically (fold change ≥ 1.5, p<0.05). [score:3]
0134827.g007 Fig 7Illustrated IPA (Ingenuity Pathways Analysis) generated gene pathways associated with miRNA seed sequences (A) miR-690 and (B) miR-223. [score:1]
MicroRNA signatures such as miR-690 and miR-223 have been determined to act as potential molecular biomarkers for RCBI. [score:1]
Illustrated IPA (Ingenuity Pathways Analysis) generated gene pathways associated with miRNA seed sequences (A) miR-690 and (B) miR-223. [score:1]
[1 to 20 of 11 sentences]
29
[+] score: 38
Consistently, in mouse myeloid 32D cells, stable expression of RUNX1-MTG8 also leads to downregulation of miR-221 and miR-223 (Figure  5A). [score:6]
In the presence of factors that impair RUNX1 function/level, this delaying effect likely reinforces the effects of direct deregulation of RUNX1-regulated target genes (e. g. miR-223) involved in myeloid differentiation (Figure  8). [score:6]
Consistently, the U937 [miR-17], U937 [RUNX1-MTG8] and U937 [CBFB-MYH11] clones also displayed significant downregulation of RUNX1-regulated miRNAs involved in myeloid differentiation, such as miR-223 (Figure  3C) and miR-27a (Additional file 1: Figure S2, right) [13, 26]. [score:5]
The integrated information gathered from the two myeloid cell mo dels shows that RUNX1 regulates myeloid differentiation not only by direct transcriptional regulation of coding and non-coding myeloid differentiation functions (e. g. miR-223), but also by modulating KIT -induced proliferation via non-coding miRNAs (e. g. miR-221). [score:4]
In the presence of factors that impair the RUNX1-miRNA mechanism (e. g. CBF fusion proteins or miRNAs targeting RUNX1-3′UTR), the effect of KIT -mediated proliferation reinforces the effects of deregulation of miRNAs controlled by RUNX1 and involved in differentiation (e. g. miR-223), thus resulting in complete block of myeloid differentiation (right). [score:4]
We found that the effects of ectopic miR-17 expression mimic the biological effects induced by the RUNX1-MTG8 and CBFB-MYH11 fusion proteins by affecting the same core mechanism: the RUNX1-miR-221-KIT axis and miR-223. [score:3]
The first described non-coding RUNX1-target was miR-223, which is critical for the establishment of both granulocyte and monocyte lineages [12- 15]. [score:3]
In the latter case, the delay of GCSF -induced differentiation due to KIT proliferation is reinforced by the repression of RUNX1-regulated coding and non-coding (e. g. miR-223) differentiation functions (Figure  8). [score:2]
Intrigued by this observation, we tested whether other factors, capable of interfering with RUNX1-CBFB regulatory function, can also negatively affect the RUNX1-miR-221-KIT axis and miR-223 transcription. [score:2]
RUNX1-MTG8 binding to RUNX1 consensus sequences in the miR-223 promoter region induces miR-223 transcriptional repression and block of myeloid differentiation in t(8;21) leukemia cells [12]. [score:1]
Previously we reported that the RUNX1 consensus sequences of the miR-221 and miR-223 promoters, as well as the miR-221 and miR-223 seed sequences, are conserved between human and mouse [17]. [score:1]
Thus, both CBF-AML fusion proteins negatively affect both the RUNX1-miR-221-KIT axis and RUNX1-miR-223 transcription, leading to increased KIT -induced proliferation of undifferentiated myeloid cells. [score:1]
[1 to 20 of 12 sentences]
30
[+] score: 35
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
The comparison of the gene expressions of the exclusive targets and non-targets (mRNAs without target sites of the major miRNA or 5′-isomiR) before and after knocking out mmu-miR-223 showed that mmu-miR-223. [score:10]
Response of mRNAs after deleting mmu-miR-223 gene was determined by the fold change of mRNA expression between knockout (KO) and wild-type (WT) conditions (KO/WT). [score:4]
More interestingly, mmu-miR-223, in which 5′-isomiRs accumulate to a level comparable to the major form, is highly downregulated in tumor cells (17). [score:4]
The cumulative distributions of fold changes are plotted for the exclusive targets of mmu-miR-223. [score:3]
iso1 (77% versus 23%) and had a greater effect on target repression than mmu-miR-223. [score:3]
To investigate the functional impact of 5′-isomiRs on mRNA gene regulation, we first examined 5′ heterogeneity of miRNAs using sequencing data and then analysed data of microarray mRNA expression profiling with and without knocking out mmu-miR-223 in murine neutrophils (GSE22004) (21). [score:3]
iso1, reflected by a smaller P-value for the exclusive targets of miR-223 than that for miR-223. [score:3]
Microarray datasets of mmu-miR-223 and mmu-miR-142 knockout experiments (GSE22004, GSE42325, Supplementary Table S1B) were collected in recent studies (21, 46). [score:2]
mmu-miR-223 had a substantial amount of 5′-isomiRs (around 23%) from the 3p arm (Figure 4A), as determined by the sequencing data from murine neutrophils (GSM539851, GSM539852) (52). [score:1]
For instance, mmu-miR-223 was more abundant than mmu-miR-223. [score:1]
Figure 4. (A) The murine mmu-miR-223 hairpin and the most prominent 5′-isomiR. [score:1]
[1 to 20 of 11 sentences]
31
[+] score: 34
The expression of the myeloid-specific miRNA, miR-223, was intriguing for its rapid expressional alteration as early as 2-week post infection, and it was also the most dramatically up-regulated miRNA at 45 dpi. [score:8]
MiRNAs significantly dysregulated in the mid-phase of infection (dpi 30), such as mmu-miR-146b and mmu-miR-155, may relate to the regulation of hepatic inflammatory responses, whereas miRNAs exhibiting a peak expression in the late phase of infection (dpi 45), such as mmu-miR-223, mmu-miR-146a/b, mmu-miR-155, mmu-miR-34c, mmu-miR-199, and mmu-miR-134, may represent a molecular signature of the development of schistosomal hepatopathy. [score:6]
However, the expression of miR-223 in hepatocellular carcinoma has been found frequently repressed [39], indicating that one particular miRNA may play different roles in different hepatic diseases. [score:5]
However, several miRNAs, such as mmu-miR-146b, mmu-miR-155, mmu-miR-223, mmu-miR-142-3p, mmu-miR-15b, and mmu-miR-126-5p, were observed to be up-regulated significantly in the mid-phase of infection (30 dpi) (Table 2 and Figure 3). [score:4]
The remarkable upregulation of mmu-miR-223 in the late phase of S. japonicum infection may also fit this scenario, that is, mmu-miR-223 may prevent over-activation of granulocytes and consequently limit the magnitude of the immune responses. [score:4]
A previous study has shown that granulocytic differentiation is controlled by a regulatory circuit involving miR-223 and two transcriptional factors, NFI-A and C/EBPalpha [37]. [score:2]
More importantly, a loss-of-function analysis of miR-223 in murine mo del has revealed that this miRNA can negatively regulate progenitor proliferation and granulocyte differentiation and activation, and more evidences have been provided to support a mo del in which miR-223 acts as a fine-tuner of granulocyte production and the inflammatory response [38]. [score:2]
More importantly, miR-155, miR-146, and miR-223 have been suggested to regulate the inflammatory responses after the recognition of pathogens by the Toll-like receptors (TLRs) [30], [31]. [score:2]
It would be interesting to investigate whether the human homologues of miR-223 is also expressed in the same manner during S. japonicum infection, which may be of potential importance as a candidate of anti-pathology therapy. [score:1]
[1 to 20 of 9 sentences]
32
[+] score: 34
We found that 3 miRNAs (mmu-miR-125a-5p, mmu-miR-146a, and mmu-miR-141) were downregulated and another three (mmu-miR-188-5p, mmu-miR-223 and mmu-miR-22) were upregulated in UVB irradiated mice compared with untreated mice. [score:6]
In the present study, it is clear that mmu-miR-188-5p, mmu-miR-223 and mmu-miR-22 were upregulated after UVB irradiation. [score:4]
RhoB, a predicted target of miR-223, has been reported to protect human keratinocytes from UVB -induced apoptosis through epidermal growth factor receptor signaling [23], suggesting that miR-223 may play a role in regulating keratinocyte survival after UVB exposure. [score:4]
They also showed that Mef2c, a transcription factor that promotes myeloid progenitor proliferation, is a target of miR-223 [20]- [22]. [score:3]
We demonstrated that miR-223 was expressed in untreated mice skin, and markedly increased after UVB irradiation. [score:3]
These findings suggest that mmu-miR-223 is sensitive to UVB and may elicit a direct or indirect effect of UVB -induced inflammation. [score:3]
To confirm the microarray findings, we measured the expression levels of four miRNAs (mmu-miR-223, mmu-miR-141, mmu-miR-23a and mmu-miR-181b) that may be related to the regulation of cellular processes using qRT-PCR. [score:2]
Six miRNAs (mmu-miR-188-5p, mmu-miR-223, mmu-miR-22, mmu-miR-125a-5p, mmu-miR-146a and mmu-miR-141) were found to be differentially expressed in the control group compared with the UVB treatment group (P < 0.05, Table S1). [score:2]
Expression of mmu-miR-223 was increased by more than ten fold in UVB treated skin compared with the control. [score:2]
Fig. 3 The figure shows that mmu-miR-23a is highly expressed in the baicalin plus UVB group compared with the UVB group, and mmu-miR-223 is increased by more than ten fold in UVB treated skin compared with control. [score:1]
A: mmu-miR-223. [score:1]
Their data support a mo del in which miR-223 acts as a fine-tuner of granulocyte production and inflammatory response. [score:1]
Johnnidis et al. [20] found that miR-223 mutant mice have an expanded granulocytic compartment resulting from increases in the number of granulocyte progenitors. [score:1]
The figure shows that mmu-miR-23a is highly expressed in the baicalin plus UVB group compared with the UVB group, and mmu-miR-223 is increased by more than ten fold in UVB treated skin compared with control. [score:1]
[1 to 20 of 14 sentences]
33
[+] score: 33
At 40 weeks of age, the expression of miR-216, miR-217, miR-223, miR-141, miR-483-3p (p-value = 0.031), miR-195, Let-7b (p-value = 0.063) and miR-96 were significantly downregulated; on the other hand, the expression of miR-21, miR-205, miR-146b (p-value = 0.031), and miR-34c (p-value = 0.063) were upregulated in KC mice compared to the control animals (Figure 2C). [score:10]
The expression of miR-223, miR-483-3p (p-value = 0.01), 146b, 205 (p-value = 0.001), 221, 21 (p-value = 0.023), 195, 34c and miR-26a (p-value = 0.0078) were significantly upregulated, whereas the expression of miR-216, miR-141, miR-217, Let-7b (p-value = 0.001), and Let-150 (p-value = 0.01) were significantly downregulated in human PC tissues as compared to the cancer-adjacent normal tissues (Figure 3E). [score:10]
The expressions of miR-216 and miR-217 were also progressively reduced in KC mice, but the expressions of miR-21, miR-205, miR-146b, miR-34c, and miR-223 progressively increased (Figure 1A, 2A– 2D). [score:5]
We observed downregulation of miR-146b, miR-34c, and miR-223 at 10 weeks of age; however, their expression increased with the progression of PC in KC animals compared to control animals (Figure 2A– 2D). [score:5]
On the other hand, miR-146b, miR-34c, miR-223, miR-195 (p-value = 0.031) and miR-216 (p-value = 0.063) were downregulated in KC mice compared to control littermates. [score:3]
[1 to 20 of 5 sentences]
34
[+] score: 32
Previous studies have shown that miR-16 can suppress cell cycle progression by targeting multiple G1 cyclins (Bandi et al., 2009) and that miR-223 can indirectly regulate cyclin E (Xu et al., 2010). [score:7]
miRNA-223 promotes gastric cancer invasion and metastasis by targeting tumor suppressor EPB41L3. [score:5]
d. (B) Cell growth assay showing that ectopic expression of miRNAs does not affect cell proliferation in vitro with the exception of miR-223, which enhances the growth at days 2 and 3, and miR-146a, which suppresses cell growth at days 2 and 3. (C,D) Quantification of Matrigel assay demonstrating that miR-16, but not any of the other miRNAs, suppresses both migration and invasion, respectively. [score:5]
Similar analysis in mouse metastatic sarcomas revealed overlap for several downregulated miRNAs including miR-16, miR-103, miR-146a, miR-223, miR-342 and miR-511. [score:4]
By comparing the downregulated miRNAs in metastatic sarcomas from human and mouse, we found six miRNAs common to both: miR-16, miR-103, miR-146a, miR-223, miR-342 and miR-511 (Fig.  1D,E). [score:4]
Overexpression of these miRNAs had no significant effect on cell proliferation, with the exception of miR-223, which increased cell proliferation, and miR-146a, which decreased cell proliferation (Fig.  2B). [score:3]
MicroRNA-223 regulates cyclin E activity by modulating expression of F-box and WD-40 domain protein 7. J. Biol. [score:3]
Notably, some of these miRNAs, such as miR-146a and miR-223, have also been implicated in modulating metastasis in other tumor types (Hurst et al., 2009; Li et al., 2011). [score:1]
[1 to 20 of 8 sentences]
35
[+] score: 31
Prior to validating whether miR-583 and miR-143 contributed to targeted suppression of IL2Rγ expression, we analyzed the expression kinetics of miR-583 and miR-143, as well as the well-known miRNAs miR-223 and miR-150, during NK cell differentiation using real-time qPCR (Fig. 3b). [score:9]
Additionally, the downregulation of miR-223 in human mNK cells was previously reported to regulate GzmB translation [33]. [score:7]
Additionally, the downregulation of miR-223 in human mNK cells was previously reported to regulate GzmB translation during murine NK cell activation [33]. [score:7]
Our results were consistent with the microarray data presented in Fig. 2 showing that the expression of miR-583, miR-143 and miR-223 were decreased; however, the expression of miR-150 was increased during NK cell differentiation. [score:5]
The expression of miR-143, miR-223, miR-150 and miR-583 was analyzed by real-time qPCR. [score:3]
[1 to 20 of 5 sentences]
36
[+] score: 31
To confirm the time dependence of estrogen effect on miRNA expression in NZB/W [F1] mice, we analyzed the expression of miR-223 and miR-451, which were markedly upregulated by estrogen in wild-type B6 mice [42]. [score:8]
The expression of miR-223 and miR-451 in splenocytes was not increased with lupus manifestation in NZB/W [F1] mice (Figure S1) and the diversity in the expression level of select lupus -associated miRNAs in estrogen -treated mice with lymphoma development (Figure S2). [score:6]
Figure 5 Estrogen increased the expression of miR-223 and miR-451 expression in splenocytes from NZB/W [F1 ] mice. [score:5]
As expected, the expression levels of miR-223 and miR-451 were significantly upregulated in both 10-wk-old (Figure  5A) and 32-wk-old (Figure  5B) estrogen -treated mice when compared to age-matched intact or placebo -treated mice. [score:5]
Unlike lupus -associated miRNAs such as the miR-182 cluster that was highly increased in diseased, 36–40-wk-old NZB/W [F1] mice [34], miR-223 and miR-451 were not significantly increased in 36–40-wk-old female NZB/W [F1] mice when compared to pre-diseased NZB/W [F1] or NZW control (Additional file 1: Figure S1). [score:4]
The graphs show increased miR-223 and miR-451 expression in splenocytes from 10-wk-old (A) and 32-wk-old (B) estrogen -treated orchidectomized NZB/W [F1] mice when compared to either age-matched placebo control or intact control mice. [score:2]
This suggests that the remarkable increase of miR-223 and miR-451 in 32-wk-old estrogen -treated mice was attributable to estrogen effect, but not to lupus manifestation. [score:1]
[1 to 20 of 7 sentences]
37
[+] score: 30
Four differentially expressed miRNAs in the lung had functions in cell differentiation, protein expression and apoptosis, including promotion of muscle differentiation (miR-206), regulation of cholangiocyte expression factor (miR-98), targeting pro-apoptotic and antiapoptotic proteins (miR-494), myeloid lineage development and promoting granulocytic differentiation, and suppression of erythrocytic differentiation (miR-223). [score:13]
The number of target genes predicted for each differentially expressed miRNA varied from 4 (miR-223) to 490 (miR-346*), with an average of 168 for up-regulated miRNAs and 96 for down-regulated miRNAs (Figure 2A and B). [score:11]
Some miRNAs such as miR-223, were found to be highly expressed in the lungs of the Wistar rats, potentially acting as immune regulators of the host immune response. [score:4]
MiR-223 has been shown to be an essential modulator of myeloid and to mediate the development of the myeloid lineage. [score:1]
It was found that miR-494, miR-365 and miR-451 were present in liver, miR-206, miR-468 and miR-691 in spleen, and miR-223, miR-98 and miR-206 in lung. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 29
Other miRNAs from this paper: hsa-mir-223
Corroboration of gene expression profiles with predicted targets of miR-223, combined with molecular investigations, allowed us to identify chemokine (C-X-C motif) ligand 2 (CXCL2), chemokine (C-C motif) ligand 3 (CCL3), and interleukin 6 (IL-6) as novel targets of miR-223. [score:5]
Thus, in our mo del of experimental TB, the absence of miR-223 was responsible for uncontrolled expression of chemotactic mediators, CXCL2 and CCL3, and heightened neutrophil availability due to impaired granulopoiesis as a consequence of uncontrolled IL-6 expression. [score:5]
Lung gene expression profiling highlighted genes involved in neutrophil recruitment and the immune response as potential targets for miR-223. [score:5]
Additionally, miR-223 modulates cell activation by targeting NLR family pyrin (NLRP) containing domain 3 (NLRP3) inflammasome and I-kappa-B-kinase (IKK) alpha (IKK-α) (63, 64). [score:3]
Our biomarker analysis focusing on miR-223 in experimental TB of mice as well as reports by others reveal a profound correlation between disease susceptibility, TB pathology, and magnitude of the neutrophil responses. [score:3]
MiR-223 expression is induced during granulopoiesis (60), controlled by different myeloid transcription factors (61, 62), and reaches its highest level in mature neutrophils. [score:2]
These results add further knowledge to the role of miRs during TB and in particular suggest that miR-223 controls TB susceptibility by limiting neutrophil recruitment through regulation of pro-inflammatory chemokines. [score:2]
To address the biological role of miR-223 during TB, we employed the aerosol Mtb infection mo del of miR-223 mutant mice (60). [score:1]
Likewise, susceptible gene- deletion mutant strains, such as Card9 [−/−] and miR-223 [−/−] mice can be rescued by antibody -mediated neutrophil depletion (56, 72). [score:1]
miR-223 Fine-Tunes Inflammation in TB. [score:1]
We followed several candidate pathways and molecules that emerged from transcriptomics studies, including miR-223. [score:1]
[1 to 20 of 11 sentences]
39
[+] score: 28
Thus, EcN was able to significantly reduce the upregulated expressions of miR-155 and miR-223 and downregulate miR-150 expression in comparison with DSS-colitic mice (-37.7%, p < 0.05; Figure 5). [score:11]
Similarly, an upregulation of miR-223 occurs in inflammatory conditions; this miRNA is involved in the inflammosome complex modulation and in IL-1β production (Haneklaus et al., 2012). [score:4]
showed that three of them, miR-150, miR-155, and miR-223, were significantly upregulated (around twofold increase vs. [score:4]
In the present study, we selected five of the eleven changed miRNA, specifically miR-143, miR-150, miR-155, miR-223, and miR-375, and questioned whether their expression was altered following treatment of DSS-colitis mice with E. coli Nissle. [score:3]
Cutting edge: miR-223 and EBV miR-BART15 regulate the NLRP3 inflammasome and IL-1beta production. [score:2]
FIGURE 5Biochemical evaluation of the effects of Escherichia coli Nissle 1917 (EcN); the expression of (A) miR-150, (B) miR-155, (C) miR-223, (D) miR-143, and (E) miR-375 was quantified by real-time PCR. [score:1]
Circulating microRNAs, miR-21, miR-122 and miR-223 in patients with hepatocellular carcinoma or chronic hepatitis. [score:1]
Gene Sequence (5′-3′) Annealing temperature (°C) IL-1β FW:TGATGAGAATGACCTGTTCT 55 RV:CTTCTTCAAAGATGAAGGAA IL-12 FW:CCTGGGTGAGCCGACAGAAGC 60 RV:CCACTCCTGGAACCTAAGCAC TGF-β FW:GCTAATGGTGGACCGCAACAAC 60 RV:CACTGCTTCCCGAATGTCTGAC ICAM-1 FW:GAGGAGGTGAATGTATAAGTTATG 60 RV:GGATGTGGAGGAGCAGAG MUC-2 FW:GATAGGTGGCAGACAGGAGA 60 RV:GCTGACGAGTGGTTGGTGAATG MUC-3 FW:CGTGGTCAACTGCGAGAATGG 62 RV:CGGCTCTATCTCTACGCTCTCC ZO-1 FW:GGGGCCTACACTGATCAAGA 56 RV:TGGAGATGAGGCTTCTGCTT OCLN FW:ACGGACCCTGACCACTATGA 56 RV:TCAGCAGCAGCCATGTACTC GAPDH FW:CATTGACCTCAACTACATGG 60 RV:GTGAGCTTCCCGTTCAGC miR-143 UGAGAUGAAGCACUGUAGCUC 55 miR-150 UCUCCCAACCCUUGUACCAGUG 55 miR-155 UUAAUGCUAAUUGUGAUAGGGGU 55 miR-223 UGUCAGUUUGUCAAAUACCCCA 55 miR-375 UUUGUUCGUUCGGCUCGCGUGA 55 SNORD95 TATTGCACTTGTCCCGGCCTGT 55The miRNA from colonic samples was isolated after homogenizing the tissue in QIAzol [TM] (Qiagen, Hilden, Germany) using a Precellys [®]24 homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France). [score:1]
Gene Sequence (5′-3′) Annealing temperature (°C) IL-1β FW:TGATGAGAATGACCTGTTCT 55 RV:CTTCTTCAAAGATGAAGGAA IL-12 FW:CCTGGGTGAGCCGACAGAAGC 60 RV:CCACTCCTGGAACCTAAGCAC TGF-β FW:GCTAATGGTGGACCGCAACAAC 60 RV:CACTGCTTCCCGAATGTCTGAC ICAM-1 FW:GAGGAGGTGAATGTATAAGTTATG 60 RV:GGATGTGGAGGAGCAGAG MUC-2 FW:GATAGGTGGCAGACAGGAGA 60 RV:GCTGACGAGTGGTTGGTGAATG MUC-3 FW:CGTGGTCAACTGCGAGAATGG 62 RV:CGGCTCTATCTCTACGCTCTCC ZO-1 FW:GGGGCCTACACTGATCAAGA 56 RV:TGGAGATGAGGCTTCTGCTT OCLN FW:ACGGACCCTGACCACTATGA 56 RV:TCAGCAGCAGCCATGTACTC GAPDH FW:CATTGACCTCAACTACATGG 60 RV:GTGAGCTTCCCGTTCAGC miR-143 UGAGAUGAAGCACUGUAGCUC 55 miR-150 UCUCCCAACCCUUGUACCAGUG 55 miR-155 UUAAUGCUAAUUGUGAUAGGGGU 55 miR-223 UGUCAGUUUGUCAAAUACCCCA 55 miR-375 UUUGUUCGUUCGGCUCGCGUGA 55 SNORD95 TATTGCACTTGTCCCGGCCTGT 55 The miRNA from colonic samples was isolated after homogenizing the tissue in QIAzol [TM] (Qiagen, Hilden, Germany) using a Precellys [®]24 homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France). [score:1]
[1 to 20 of 9 sentences]
40
[+] score: 28
Among the differentially expressed miRNAs in lungs, most were correlated with immune system regulation, including miR-223 (regulation of the immune response), miR-1224 (regulation of tumor necrosis factor), miR-150 (differentiating stem cells towards megakaryocytes and control of B and T cell differentiation), miR-200a (regulation of immune response). [score:7]
Some differentially expressed miRNAs in liver had important functions, such as involvement in nutrient metabolism, including a cholesterol metabolism regulator (miR-122), a lipid metabolism regulator (miR-705), an adipocyte differentiation and regulation factor (miR-27a and miR-193), and erythrocyte differentiation (miR-223 and miR-451). [score:6]
Given that the main food resource of schistosomes is the erythrocyte of the host, the higher expression level of miR-223 and the lower expression level of miR-451 might affect the quality and quantity of the erythrocyte from M. fortis, which could in turn reduce the food resource of schistosome. [score:5]
The higher expression level of miR-223 in liver of M. fortis means a lower differentiation level of erythrocyte, given that miR-223 functions to suppress erythrocytic differentiation [38]. [score:5]
miR-223 was identified as a regulator [46] and can be dynamically regulated during T and B cell development, involved in immune response [47]. [score:4]
MiR-122, miR-451 and miR-494 were detected in liver, miR-494, miR-691 and miR-143 in spleen, and miR-223, miR-200a and miR-322 in lung. [score:1]
[1 to 20 of 6 sentences]
41
[+] score: 27
For example, Hlf was targeted by mmu-miR-18b-5p, mmu-miR-429-3p and mmu-miR-291a-3p; Cnot6 and Zfp91 were targeted by mmu-miR-206-3p and mmu-miR-291a-3p; Rbfox2 was targeted by mmu-miR-429-3p and mmu-miR-449c-5p; Aebp2 was targeted by mmu-miR-125a-3p, mmu-miR-223-3p and mmu-miR-496-3p; Nfya was targeted by mmu-miR-199a-5p, mmu-miR-216b-5p and mmu-miR-671-5p; Nucks1 was targeted by mmu-miR-142-3p, mmu-miR-146a-5p and mmu-miR-223-3p; Notch2 was targeted by mmu-miR-146a-5p and indirectly via Ascl1 by mmu-miR-1903. [score:16]
For example, mmu-miR-145-5p, which was strongly down-regulated in myopic retina (FC = -10.5, p = 8.87 × 10 [−09]), targeted 25 mRNAs (the largest number among all 21 miRNAs) (Table 2); while mmu-miR-429-3p (FC = 7.8, p = 2.05 × 10 [−03]), mmu-miR-143-3p (FC = -2.0, p = 1.43 × 10 [−03]), mmu-miR-223-3p (FC = -2.7, p = 4.84 × 10 [−04]) and mmu-miR-146a-5p (FC = -3.2, p = 2.70 × 10 [−05]) targeted 17, 17, 16 and 14 mRNAs respectively. [score:8]
MP1, MP2, MP3, MP4, MP5, MP6 and MP7 had a common core comprised of mmu-miR-1-3p, mmu-miR-145-5p, mmu-miR-18a-5p, mmu-miR-199a-5p, mmu-miR-200b-3p, mmu-miR-223-3p, mmu-miR-291a-3p, mmu-miR-34a-5p and their target mRNAs. [score:3]
[1 to 20 of 3 sentences]
42
[+] score: 26
mRNA targets that showed inversely correlated expression with miRNAs (Additional file 3) include previously validated miRNA/target pairs such as Mef2c with miR-223 [14], Bcl2 with miR-15 or miR-16 [38], Mybl2 with miR-29 or miR-30 family members [39], and Ezh2 with miR-26a [40]. [score:7]
This process is tightly controlled by changes in the expression of hundreds of transcription factors [12, 13], which are in turn regulated by a few highly expressed miRNAs, including miR-223 and miR-146a, both of which have been shown to promote granulopoiesis [14- 16]. [score:6]
For example, miR-106b and miR-194 were predicted to target the transcription factor gene, Mef2c, which is a confirmed target of miR-223 [14, 49]. [score:5]
Expression of miR-106b and miR-194 may act in concert with that of miR-223, which may explain a previous observation whereby granulopoiesis was not completely impaired in miR-223 null mice [14]. [score:3]
Amongst these are those differentially regulated in our study including miR-16, miR-19a, miR-26a, miR-26b, miR-139, miR-195 and miR-223. [score:2]
Previous studies have shown the involvement of several miRNAs in granulopoiesis including miR-223 [14], miR-34a [45], and miR-146a [16]. [score:1]
Total loss of miR-223 does not completely block granulopoiesis [14], suggesting that other miRNAs may also act in concert to maintain this process. [score:1]
Of these, we observed that several had been previously identified as key modulators of granulopoiesis in human and mouse, including miR-223, miR-16, and miR-29a [14, 35, 36]. [score:1]
[1 to 20 of 8 sentences]
43
[+] score: 25
For example, miR-223 is reported to be expressed in myeloid cells [7, 23]; miR-125 and 128 are highly expressed in the brain [13, 14]; and miR-16 is expressed in a wide variety of tissues [7, 14, 23] (see also heat map of expression in Figure 5a). [score:9]
Several expression patterns are evident: miR-146 is highest in Th1 cells and low in naïve T cells and Th2 cells; miRNAs 142s and 26a are expressed at higher levels in the precursor naïve T cells; miR-27a is equivalently expressed in both the precursor naïve T cells and the differentiated Th1 and Th2 cells; and miR-223 is very poorly expressed in all these T cell types. [score:9]
MiR-223 and miR-206 showed poor correlation between the arrays and the Northern blots: for miR-223, we detected a higher level of expression in pro-B in the arrays compared with what we detected on Northern blot, while for miR-206, the arrays showed high expression in pro-B and DN T that was undetectable by Northern blot. [score:4]
1-/- precursor cells and at three- to fourfold higher levels in fully differentiated BMMC; and miR-223, which is most highly expressed in the Pu. [score:3]
[1 to 20 of 4 sentences]
44
[+] score: 24
In particular, the following target proteins, involved in cell proliferation, were downregulated: DHFR targeted by miR24 [33], Cyclin D1 targeted by miR223 [34], and E2F-2 targeted by miR31 [35]. [score:12]
Moreover, the use of miRNA inhibitors against miR451, miR223, miR24, miR125b, and miR31 on HepG2 reduced the proapoptotic activity induced by MV-HLSC. [score:3]
HepG2 transfection with miR451, miR31, and miR223 mimics, which reproduce mature endogenous miRNAs, inhibited proliferation of HepG2 (Fig. 5B). [score:3]
This was more significant for miR451, miR223, and miR31. [score:1]
Silencing Dicer in HLSC resulted in the modulation of different miRNAs, with a significant reduction of the antitumor miR223, miR24, miR31, and miR122 [55] in MVs. [score:1]
Among miRNAs present in MV-HLSC [10], several ones were associated with potential antitumor activity, such as miR451, miR223, miR24, miR125b, miR31, miR214, and miR122. [score:1]
To evaluate whether single miRNAs with antitumor activity (miR451, miR223, miR24, miR125b, and miR31) were relevant for the proapoptotic effect of MV-HLSC, we transfected HepG2 with selected miRNA inhibitors (Fig. 5A). [score:1]
MVs released from DCR-Kd HLSC (MV DCR−), but not from CTR-A HLSC (MV CTR-A), showed a significant reduction of miR223, miR24, miR31, miR122, and miR214 as detected by qRT-PCR (Fig. 4B). [score:1]
Among miRNAs present in MV-HLSC, we detected several miRNAs with potential antitumor activity including miR451, miR223, miR24, miR125b miR31, and miR122 (Fig. 3A). [score:1]
[1 to 20 of 9 sentences]
45
[+] score: 24
Previous studies reported mir-223-3p has the most significant upregulation in ischemic cardiac microvascular endothelial cells (CMECs) compared with normal CMECs (Dai et al., 2014) and QSYQ promote ischemic cardiac angiogenesis by downregulating mir-223-3p expression in rats ischemic CMECs derived from rats myocardial infarction mo del (Dai et al., 2016). [score:8]
However, our results observed that no significant difference was found in the expression of mir-223-3p between sham + NS group and TAC + NS group and QSYQ has no significant effect on the expression of mir-223-3p in TAC mice. [score:5]
In addition, our results observed that no significant difference was found in the expression of microRNA-223-3p (mir-223-3p) between sham + NS group and TAC + NS group and QSYQ has no significant effect on the expression of mir-223-3p in TAC mice (see Supplementary Material online, Figure S2). [score:5]
Qi-Shen-Yi-Qi dripping pills promote angiogenesis of ischemic cardiac microvascular endothelial cells by regulating microRNA-223-3p expression. [score:4]
MicroRNA-223-3p inhibits the angiogenesis of ischemic cardiac microvascular endothelial cells via affecting RPS6KB1/hif-1a signal pathway. [score:2]
[1 to 20 of 5 sentences]
46
[+] score: 24
The box plot shows the most differentially expressed miRNAs miR-223 and miR-379 for the disease phenotype EBA. [score:5]
We found that miR-223 is upregulated in EBA skin in comparison to normal skin (Additional file 1: Figure S3). [score:4]
The expression levels of mmu-mir-223 were normalized against β-actin. [score:3]
Figure S3 qRT-PCR validation of miR-223 expression in EBA and normal murine skin. [score:3]
Specifically, we provide evidence that miRNA such as miR-223 and miR-379 may play critical role in disease progression and severity. [score:3]
To further validate this result we experimentally verified the expression of miR-223 in EBA skin by qRT-PCR. [score:3]
A cluster analysis identified miR-379 and miR-223 to be associated with EBA severity/onset, where miR-379 was observed to be associated to loci on chromosome 6. The murine advanced intercross line allowed us to identify the genetic loci regulating multiple miRNA in skin. [score:2]
P value = 0.044) and miR-223 (adj. [score:1]
[1 to 20 of 8 sentences]
47
[+] score: 24
To confirm the results obtained with RT-PCR and determine the distribution of miRNA expression in the inflamed mouse lung, we examined the expression of miRNA-223 using in situ hybridisation since this was the only miRNA that was significantly up-regulated at all time points. [score:8]
From Figure 4, it can be seen that miR-21, -25, -27b, -100, 140, -142-3p, -181c, 187, -194, -214 and -224 were significantly up-regulated at two time points whilst the level of miR-223 was significantly increased at 1, 3 and 6 h. Unlike the LPS -induced response in THP-1 cells and mouse macrophages, we failed to observe up-regulation of miRNA-146 or -155 [38, 39]. [score:7]
Figure 5LPS -induced changes in miRNA-223 expression in the mouse lung. [score:3]
From Figure 5, it can be seen that we observed a prominent increase in miRNA-223 expression in alveolar and bronchial epithelial cells at 3 h following exposure to aerosilised LPS. [score:3]
Lungs were removed from saline-challenged (A-D) and LPS-challenged (E-H) mice at 3 hrs post-challenge and tissue slices were examined by in situ hybridisation using either a miRNA-223-specific (A, B, E, F) or scrambled (C, G) LNA probe, or histologically following cresyl violet staining (D, H). [score:1]
Furthermore, we observed the migration of inflammatory cells into the bronchioles, most probably neutrophils, which are also stained for miRNA-223. [score:1]
Locked nucleic acid (LNA) probes (miR223 or miR-scrambled) were pre-incubated at 65°C for 5 min and immediately placed on ice. [score:1]
[1 to 20 of 7 sentences]
48
[+] score: 23
Moreover, the negative modulation of the inflammatory miR-223 and the up-regulation of miR-29, which controls collagen deposition, was consistent with the observed amelioration of the dystrophin phenotype due to the rescue of dystrophin expression by exon-skipping approach (Cacchiarelli et al., 2010). [score:6]
We did not observe significant change in miR-222 and miR-223 expression in mdx nor mdx/mIGF-1 mice (Figures 4A,B), suggesting that these two specific miRNAs were not modulated in the diaphragm of 4-week-old dystrophic mice and by the expression of mIGF-1. Figure 4 mIGF-1 modulates factors associated with the inflammatory response in dystrophic muscle. [score:5]
We did not observe significant change in miR-222 and miR-223 expression in mdx nor mdx/mIGF-1 mice (Figures 4A,B), suggesting that these two specific miRNAs were not modulated in the diaphragm of 4-week-old dystrophic mice and by the expression of mIGF-1. Figure 4 mIGF-1 modulates factors associated with the inflammatory response in dystrophic muscle. [score:5]
It has been reported that miR-222 and miR-223, classified as inflammatory miRNAs (Greco et al., 2009) were highly expressed in damaged areas of the ischemic muscle and adult mdx mice, whereas they were not induced in muscles of newborn mdx mice (Greco et al., 2009). [score:3]
The inflammatory miRNAs (miR-222 miR-223) had a similar level of expression between mdx and wild type mice. [score:3]
Dystrophic-signature miRNAs has been divided into three main classes: degenerative miRNAs (miR-1, miR-29c, and miR-135a), regeneration miRNAs (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), and inflammatory miRNAs (miR-222 and miR-223) (Greco et al., 2009). [score:1]
[1 to 20 of 6 sentences]
49
[+] score: 22
We did not observe any significant upregulation of miR-223 in quadriceps muscles from dy [3K]/dy [3K] or dy [2J]/dy [2J] mice at 3 and 6 weeks of age, respectively (Figure 2B). [score:4]
In this report, we also describe that miR-223 and miR-21 expression is positively associated with inflammation and fibrosis, respectively, in dy [3K]/dy [3K] and dy [2J]/dy [2J] muscle. [score:3]
Importantly, we show that miR-223 expression reflects the degree of immune cell infiltration in muscle from dy [3K]/dy [3K] mice and could therefore be involved in modulating the inflammatory response in MDC1A. [score:3]
miR-223 has been shown to be involved in granulocyte production and several studies report increased expression of miR-223 in dystrophic muscle (Eisenberg et al., 2007; Johnnidis et al., 2008). [score:3]
Hence, in this study, we have analyzed expression of six miRNAs (miR-1, miR-133a, miR-206, miR-21, miR-29c, and miR-223) in muscle and plasma from two different MDC1A mouse mo dels (dy [3K]/dy [3K] and dy [2J]/dy [2J]). [score:3]
Accordingly, we noticed a significant increase in miR-223 (immune cells) and miR-21 expression (fibrosis) in muscle from dy [3K]/dy [3K] mice compared with wild-type controls (Figure 4C). [score:2]
Regulation of progenitor cell proliferation and granulocyte function by microRNA-223. [score:2]
Moreover, miRNAs associated with specific features of muscular dystrophy such as infiltration of inflammatory cells (miR-223) and fibrogenesis (miR-21 and miR-29), are also altered in dystrophic muscles (Eisenberg et al., 2007; Greco et al., 2009). [score:1]
All oligonucleotide sequences were designed by and ordered from Exiqon with the following product numbers: hsa-miR-1, 204344; hsa-let-7a-5p, 204775; hsa-miR-16-5p, 204409; hsa-miR-21-5p, 204230; hsa-miR-29c-3p, 204729; hsa-miR-133a, 204788; hsa-miR-206, 204616; and hsa-miR-223-3p, 204256. [score:1]
[1 to 20 of 9 sentences]
50
[+] score: 22
Additionally, MIR223 has been shown to be epigenetically silenced by AML-ETO [4] and down-regulated in several blood cancers [5]. [score:4]
Although these studies collectively show that MIR223 is commonly silenced in leukemia, the contribution of MIR223 loss to disease pathogenesis is unclear. [score:3]
However, miRNA-223 is highly expressed in HSCs [7, 8] and its contribution to HSC function has not been rigorously assessed. [score:3]
A previous study of Mir223 deficient mice suggested that miRNA-223 negatively regulates myeloid progenitor proliferation [6]. [score:2]
While somatic point mutations [2] and copy number alterations [3] involving miRNA genes are uncommon in AML, we recently reported the hemizygous loss of the MIR223 gene in a male patient with therapy-related AML [3]. [score:2]
The pathways leading to myeloid expansion associated with activating mutations of tyrosine kinases genes and miR-223 loss are likely to be distinct. [score:2]
Collectively, these data show that miR-223 loss results in a modest expansion of myeloid progenitors without significant effects on HSCs. [score:1]
Moreover, the percentage of CD150 [+] KSL cells in the G0 phase of the cell cycle was similar to controls (Figs. 5C and 5D), suggesting that miR-223 is not required to maintain HSC quiescence. [score:1]
MiR-223 silencing is often seen in association with specific mutations, such as AML-ETO. [score:1]
Overall, these data suggest that loss of miRNA-223 results in a subtle increase in basal granulopoiesis in mice. [score:1]
Thus, Mir223 deficient HSCs have normal long-term repopulating activity, self-renewal capacity, and quiescence, showing that miR-223 is not required for HSC maintenance. [score:1]
Whether miR-223 loss cooperates with AML-ETO or other oncogenes to induce AML will require further study. [score:1]
[1 to 20 of 12 sentences]
51
[+] score: 20
As shown in Figures 3, 4, 5, 6, miR-1798 and miR-1699 influence the expression of CCND1 and CCNE2, respectively, while miR-223 and miR-1744 regulate expression of CDK1 and CDK3, respectively. [score:6]
In addition, our results indicate that several microRNAs (miRs), specifically miR-222, miR-223, miR-1626, miR-1699, miR-1744, miR-1787, miR-1798 and miR-1812 interact with sites in the 3′-UTR of the cell cycle genes and regulatory factors affecting cell cycle genes including CCND1, CCNE2, CDK1, CDK3, CDKN1A and CDKN1B to influence post-transcriptional regulation of its expression in laying hens. [score:5]
In addition, as shown in Figures 5 and 6, in the presence of miR-223 and miR- 1744, the intensity and percentage of GFP-CDK1 -expressing cells (17.2% in control vs. [score:3]
1.3% in miR-223) and GFP-CDK3 -expressing cells (16.1% in control vs. [score:3]
This analysis revealed putative binding sites for several chicken miRNAs (miR-1798 for CCND1; miR-1699 for CCNE2; miR-223 for CDK1; miR-1744 for CDK3; miR-1626 for CDKN1A; and miR-222, miR-1787 and miR-1812 for CDKN1B), but not for the other four genes of interest. [score:1]
[C and D] After co-transfection of pcDNA-eGFP-3′UTR for the CDK1 transcript and pcDNA-DsRed-miRNA for the miR-223, the fluorescence signals of GFP and DsRed were detected using FACS [C] and fluorescent microscopy [D]. [score:1]
[A] Diagram of miR-223 binding sites in the 3′-UTR of the CDK1gene. [score:1]
[1 to 20 of 7 sentences]
52
[+] score: 20
Bonferroni post hoc analysis showed that the difference in miR-155 reached statistical significance at day 1, 3 and 7 whereas, expression of miR-21 was significantly increased at 14 days after CCI (P = 0.035), but not at earlier time points, day 1, 3 and 7. The post hoc test did not reveal significance for miR-223 expression at these time points. [score:5]
Expression of miR-155 (UUAAUGCUAAUUGUGAUAGGGGU), miR-21(UAGCUUAUCAGACUGAUGUUGA), miR-223 (UGUCAGUUUGUCAAAUACCCCA) and miR-146 (UGAGAACUGAAUUCCAUGGGUU) was examined in hippocampi of the injured (ipsilateral) and the uninjured (contralateral) hemisphere from the same animals at 1, 3, 7 and 14 days after moderate CCI and in naïve controls (Figure 1D). [score:3]
Increasing the injury severity from moderate to severe, 0.5 mm and 1.0 mm depth respectively, revealed significantly increased expression of miR-155, miR-21 and miR-223 at 3 days post-injury (DPI) as determined by two-way ANOVA. [score:3]
Four of these miRNAs, miR-155, miR-21, miR-223 and miR-146 were differentially expressed in at least one miRNA profiling experiment performed in rodent mo dels of TBI (Lei et al., 2009; Re dell et al., 2009; Hu et al., 2012; Liu et al., 2014; Sun et al., 2014; Meissner et al., 2016). [score:3]
MicroRNA-223 is neuroprotective by targeting glutamate receptors. [score:2]
CCI significantly increased expression of miR-155, miR-21 and miR-223 in the ipsilateral compared to the contralateral hippocampus by two-way ANOVA. [score:2]
Inflammation -associated miRNAs miR-155, miR-21 and miR-223 were increased in the hippocampus after CCI. [score:1]
Among these are miR-155 (O’Connell et al., 2007), miR-21 (Löffler et al., 2007), miR-146 (Taganov et al., 2006), and miR-223 (Ceppi et al., 2009). [score:1]
[1 to 20 of 8 sentences]
53
[+] score: 19
In addition to this group of down-regulated miRs, CSCs can be distinguished from embryonic heart cells on the basis of seven up-regulated miRs: let-7a, let-7b, miR-24, miR-125b, miR-132, miR-149 and miR-223 (Fig. 2C). [score:7]
As expected, three members of the miR-17-92 family already identified in the clustering analysis were found to be significantly down-regulated in CSCs, together with miR-223, a well-known regulator of hematopoietic differentiation [32]– [34]. [score:5]
Comparative profiling of CSCs and embryonic heart cells identified the let-7 miR family members, let-7a, let-7b, miR-125a and miR-125b, as well as miR-223 as being upregulated in CSCs. [score:4]
In contrast, we observed that miR-223 is down regulated in CSCs in comparison to BMCs, in agreement with its established role as a regulator of hematopoyesis. [score:3]
[1 to 20 of 4 sentences]
54
[+] score: 19
In addition, inhibition of PI3K and IGF1 resulted in the induction of IL-6 secretion in miR-223‑expressing mast cells, which indicated that miR-223 reduces IL-6 secretion in mast cells by inhibiting the IGF1R/PI3K signaling pathway [47]. [score:7]
Wang, Q. et al. Down-regulation of microRNA-223 promotes degranulation via the PI3K/Akt pathway by targeting IGF-1R in mast cells. [score:6]
One study reported that the p-AKT and IGF1R levels increased following miR-223 down-regulation in mast cells. [score:4]
MiR-223 promotes degranulation via the PI3K/Akt pathway by targeting IGF-1R in mast cells [38]. [score:2]
[1 to 20 of 4 sentences]
55
[+] score: 19
TCGA data mining revealed aberrant MAFB amplification in CRCChromosome translocation in multiple myeloma results in aberrant MAFB expression [11, 20], and miR-223 suppresses nasopharyngeal carcinoma cell proliferation and migration by targeting MAFB [14]. [score:7]
Chromosome translocation in multiple myeloma results in aberrant MAFB expression [11, 20], and miR-223 suppresses nasopharyngeal carcinoma cell proliferation and migration by targeting MAFB [14]. [score:7]
Yang, et al. [14] found that miR-223 suppresses nasopharyngeal carcinoma cell proliferation and migration by targeting MAFB mRNA. [score:5]
[1 to 20 of 3 sentences]
56
[+] score: 17
For instance, miR-223 was reported to negatively regulate both the proliferation and activation of neutrophils by targeting myeloid Elf1-like factor 2C [18]; miR-125b and let-7 were down-regulated in response to lipopolysaccharide (LPS) stimulation in macrophages, in which the miR-125b regulated the immune response by targeting tumor necrosis factor (TNF)-α mRNA [19], whereas let-7 through a mechanism of targeting IL-6 mRNA [20]; miR-21 has also been found to be able to further negatively regulate LPS-activated TLR4 signaling by targeting the tumor suppressor gene, Programmed Cell Death 4 (PDCD4), which in turn decreased nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) activation and resulted in the production of anti-inflammatory cytokine IL-10 [21]. [score:17]
[1 to 20 of 1 sentences]
57
[+] score: 17
We also observed that the mRNA potentially targeted by mmu-miR-223 (Arid4b, Lpin2, see Figure 5) and mmu-miR-146b (Zfp451, Klf13 and Tcfcp2l1) did undergo a downregulation at ST. [score:6]
The expression of mmu-miR-483 and -672 was downregulated at ST as compared to the PBS -treated mice while the levels of mmu-miR-223 and -146b were increased. [score:5]
Transient transfection analysis for luciferase reporter expression with Arid4b, Il-6 or Lpin2 3′UTR in the presence of miR-223; with Gmnn, Nola2 or Ube2c 3′UTR in the presence of miR-483; with Dera or Nusap1 3′UTR in the presence of miR-574-5p; with Cd3g or Phb2 3′UTR in the presence of miR-672; and with Fst, Ctse or Cdca8 3′UTR in the presence of miR-690. [score:3]
The second miRNA significantly regulated, mmu-miR-223, was previously shown to play a significant role in pulmonary function alteration by exposition to cigarette smoke [31] or to LPS [33]. [score:2]
Among the 17 others miRNA-mRNA pairs that were evaluated (Figure 4E-H and Figure 5), significant inhibition was observed in 10 experimental conditions (miR-29c and Ctsk; miR-146b and Scube2; miR-483 and Nola2 or Ube2c; miR-672 and Phb2; miR-223 and Il6 or Lpin2 or Arid4b; miR-690 Fst or Ctse). [score:1]
[1 to 20 of 5 sentences]
58
[+] score: 16
Up-regulation of miR-223 has been reported in the lungs of mice infected with a highly pathogenic 1918 pandemic H1N1 influenza virus-infected lungs of mice [16], H5N1 virus-infected lungs of mice [19], and H1N2 virus-infected lungs of pigs [21]. [score:4]
Moreover, some differentially up-regulated microRNAs (such as miR-466h-5p, miR-135a-1*, miR-2137, miR-223, miR-139-5p, miR-29b-1*, and miR-7a) displayed earlier in PR8 infected lungs than in BJ501 infected lungs. [score:4]
Although this study generated a list of candidate microRNAs including miR-155 and miR-223 that potentially regulate influenza virus infections, additional studies are warranted to clarify the mechanisms behind how these candidate microRNAs mediate host–virus interactions during influenza virus infection. [score:2]
A group of microRNAs including miR-155 and miR-223 have been identified to potentially regulate influenza virus infection in our study. [score:2]
In our study, miR-155 and miR-223 were significantly induced by both the 2009 pandemic H1N1 virus and the PR8 virus. [score:1]
Thus, it is plausible to assume that the miR-155 and miR-223 may play an important role in the response to influenza virus infection. [score:1]
Nine microRNAs (miR-1, miR-1187, miR-133a, miR-133b, miR-155, miR-2137, miR-223, miR-30d and miR-574-3p) were selected for validation. [score:1]
miR-223 is also an important microRNA with multiple functions [37]. [score:1]
[1 to 20 of 8 sentences]
59
[+] score: 16
We recently identified miR-223 as one of the regulatory elements involved in controlling Roquin protein expression, and demonstrated that altering miR-223 expression affects Roquin expression [5]. [score:8]
A recent study from our laboratory demonstrated that Roquin curtails IL-17 synthesis, and that the miR-223 microRNA is involved in regulating Roquin expression [5]. [score:4]
Studies are currently underway to identify transcriptional factors that regulate the expression of Roquin, miR-223, and other Roquin -associated miRNAs. [score:4]
[1 to 20 of 3 sentences]
60
[+] score: 16
This coincides with the data presented here, as miR-223 is a known C/EBPα target gene; C/EBPα up-regulates miR-223 expression during granulocyte differentiation [19]. [score:8]
Liu, Q. et al. miR-223 suppresses differentiation of tumor -induced CD11b+Gr1+ myeloid-derived suppressor cells from bone marrow cells. [score:5]
A study determined that a micro -RNA, miR-223, suppresses accumulation of tumor -induced CD11b+Gr1 MDSCs [18]. [score:3]
[1 to 20 of 3 sentences]
61
[+] score: 16
Based on these results, antagomirs were created against the top-4 upregulated miRNAs in this colitis-transfer mo del (miR-142-5p, miR-146b, miR-203, and miR-223; experiment #2). [score:4]
[26] MiR-223, miR-146a and miR-142-5p were among miRNAs expressed in colon biopsies and saliva shown to differentiate CD from UC. [score:3]
Several miRNAs were induced in the colon during colitis development, most significantly miR-223, miR-142-5p, miR-146B and miR-203. [score:2]
[25]In IL-10 knockout mice, another experimental animal mo del of Th1 -mediated IBD, five out of the 11 miRNAs described in our current study (miR-223, miR-142-5p, miR-142-3p, miR-21 and miR-146a) were significantly elevated in severely inflamed colon. [score:2]
[25] In IL-10 knockout mice, another experimental animal mo del of Th1 -mediated IBD, five out of the 11 miRNAs described in our current study (miR-223, miR-142-5p, miR-142-3p, miR-21 and miR-146a) were significantly elevated in severely inflamed colon. [score:2]
MiR-223 is involved in granulocyte activation, and is overexpressed in naïve CD4+ T-lymphocytes in patients with rheumatoid arthritis. [score:2]
no cell transfer vehicle/PBS scrambled anti-miR-203 anti-miR-142-5p anti-miR-146banti-miR-223 X X XTo assess clinical impact of blocking selected miRNAs in transfer-colitic mice. [score:1]
[1 to 20 of 7 sentences]
62
[+] score: 13
MiRTrail identified several deregulated miRNAs that target deregulated mRNAs including miRNAs hsa-miR-23b and hsa-miR-223, which target the highest numbers of deregulated mRNAs and regulate the pathway "basal cell carcinoma". [score:9]
For this analysis, we decided to use the eight miRNAs having more than 80 dysregulated targets (miR-23b [50], miR-223, miR-193b [51], miR-424, miR-20a [52], miR-98, miR-891a, and miR-566), see Figure 2. We left the custom degree constraint at the default of 1 for the subsequent ORA. [score:4]
[1 to 20 of 2 sentences]
63
[+] score: 13
We have also observed considerable natural variation in the abundance of the proposed endogenous control miRNAs (miR-16 and miR-223) with these miRNAs showing variable expression across the time course samples, and between experimental groups (Figs. 5, 6 ). [score:3]
As expected, normalization to miR-16 and miR-223 produced similar expression ratios to the average Cq method. [score:3]
The effects of normalization to the average Cq, RNA spike control, miR-223 or miR-16 are shown for (E) miR-1, (F) miR-15b. [score:1]
Similarly, miR-31 and miR-223 also show spikes in the C57 samples at 14 and 16 weeks respectively. [score:1]
miR-223, was found to rank highly (5 [th] most stable). [score:1]
0089237.g004 Figure 4 Plot of raw Cq values from the time course study for cel-miR-39 against (A) miR-16, (B) miR-31, and (C) miR-223. [score:1]
All three endogenous miRNAs showed positive and highly significant correlations with the spike-in control (miR-16: r = 0.691 and P = 5×10 [−18], miR-31 r = 0.734 and P = 3.2×10 [−21], miR-223 r = 0.637 and P = 8.5×10 [−15]). [score:1]
These miRNAs were included because miR-16 is commonly used as a reference miRNA in cell and tissue studies [15], [24], miR-223 has been previously used as a normalizer by our group [15] and others [13], [25], and miR-31 has been recently been proposed as a novel normalizer [26]. [score:1]
Plot of raw Cq values from the time course study for cel-miR-39 against (A) miR-16, (B) miR-31, and (C) miR-223. [score:1]
[1 to 20 of 9 sentences]
64
[+] score: 13
For example, miR-223 in the profile 8 was up-regulated in the hepatic IR injury. [score:4]
miR-223 was up-regulated in the hepatic ischemia-reperfusion injury [18]. [score:4]
Consistently, a previous study showed an increased expression level of miR-223 in mouse liver with IR injury [18]. [score:3]
Association of MicroRNA-223 expression with hepatic ischemia/reperfusion injury in mice. [score:2]
[1 to 20 of 4 sentences]
65
[+] score: 12
It has been discovered that increased PGE2 in the tumor microenvironment leads to miR-223 down-regulation in MDSCs and subsequent up-regulation of its target myeloid enhancer factor 2 (Mef2c), which promote MDSC survival and accumulation in tumor site (93). [score:9]
MiR-223 is involved also in myeloid cell differentiation by targeting nuclear factor I (NFI)-A and inducing differentiation of immature myeloid cells into mature granulocytes (94). [score:2]
MiR-223 was the first miRNAs associated to MDSCs (93). [score:1]
[1 to 20 of 3 sentences]
66
[+] score: 12
Confirming the results of the gene profiling, mmu-miR-15b-5p and mmu-miR-223-3p were significantly upregulated during pneumonia, and mmu-miR-34b-5p and mmu-miR-126-3p were significantly downregulated. [score:7]
Consistent with data in the literature describing miR expression in neutrophils or granulocytes, miR-223 and miR-142 are highly expressed in neutrophils from un-infected lungs 13– 15. [score:5]
[1 to 20 of 2 sentences]
67
[+] score: 11
In particular, we identified 10 over-expressed miRNAs (miR-17-5p, miR-221-3p, miR-93-5p, miR-25-3p, miR-181b-5p, miR-106b-5p, miR-186-5p, miR-222-3p, miR-15b-5p, and miR-223-3p; Figure 2A) that are involved in the activation of major liver carcinogenesis-related gene expression networks, especially the TGF-β- and Wnt/β-catenin signaling pathways, the roles of which are well-established in hepatocarcinogenesis [14]. [score:5]
Among these 19 differentially expressed miRNAs in HCC (20 weeks), 10 of the miRNAs were significantly different from that in NASH-fibrotic livers (12 weeks), among which miR-221-3p, miR-222-3p, and miR-223-3p showed a progressive stage -dependent increase (Figure 2A). [score:3]
Among these miRNAs, the over -expression of ten miRNAs (miR-15b-5p, miR-17-5p, miR-25-3p, miR-93-5p, miR-106b-5p, miR-181b-5p, miR-186-5p, miR-221-3p, miR-222-3p, and miR-223-3p) was associated with the activation of major hepatocarcinogenesis-related pathways, including the TGF-β, Wnt/β-catenin, ERK1/2, mTOR, and EGF signaling. [score:3]
[1 to 20 of 3 sentences]
68
[+] score: 11
Interestingly, miR-223 expression is downregulated by tumor -associated factors and is a strong suppressor of Gr-1+/CD11b+cell differentiation. [score:8]
Liu et al. [34] recently found that naïve MDSCs express higher level of miR-223 than tumor -associated MDSCs. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
With exception of miR-33a, miR223, miR-9, miR-24, and miR-429, whose expression level was low in activated B cells, such Prdm1 -targeting miRNAs were significantly upregulated by HDI. [score:8]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
[1 to 20 of 2 sentences]
70
[+] score: 10
Of the 20 miRNAs downregulated in crypts, 8 showed a >4.0 fold difference (miR-142-5p, miR-16-5p, miR-22-3p, miR-194-3p, miR-33-5p, miR-223-3p, miR-32-5p, miR-140-5p; Fig. 4a1, blue spots), whereas, of the 15 miRNAs upregulated in crypts, 2 showed a >3.0 fold difference (miR-192-5p, miR-98-5p) (Fig. 4a2, blue spots). [score:7]
Specifically, 5 miRNAs (miR-223-3p, miR-326-3p, miR-26a-5p, miR-103-3p, miR-98-5p; Fig. 4a1 Blue spots vs Fig. 4b1: Red spots) showed expression profiles along the crypt-villus axis in PepT1 KO opposite to those in WT mice. [score:3]
[1 to 20 of 2 sentences]
71
[+] score: 9
Many of these upregulated miRNAs were known oncomiRs in breast cancer, such as miR-200, miR-141 and miR-223 [21– 23], Also, many of down-regulated miRNAs in MCF7 HER2 cells were tumor suppressors, such as miR-125b, miR-31 and miR-99a [24– 26]. [score:9]
[1 to 20 of 1 sentences]
72
[+] score: 9
Interestingly, miR-223 can be transferred from HDL particles to ECs to suppress ICAM-1 expression and EC activation (Tabet et al., 2014). [score:5]
HDL-transferred microRNA-223 regulates ICAM-1 expression in endothelial cells. [score:4]
[1 to 20 of 2 sentences]
73
[+] score: 9
Antagomir -mediated inhibition of miR-21-3p and miR-223 (increased expression following bacterial infection), or miR-376c (decreased expression), and miR-21 (control, no change in expression) had no effects on NTHi clearance by neutrophils in vitro (S11 Fig). [score:9]
[1 to 20 of 1 sentences]
74
[+] score: 9
Over -expression of miR-223 in ovarian cancer cell lines reduces proliferation and colony formation, also by targeting of IGF1R [30]. [score:5]
Our remaining miRNA candidates (miR-143-3p, miR-145-5p, miR-223-3p, and miR-605-5p) appear to be more specific to lung adenocarcinoma. [score:1]
Five of our eight EV miRNA candidates (miR-142-3p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p) were shown to be increased by hemolysis and were thus excluded from analysis. [score:1]
In the present study, using LAC cell lines, we identified several miRNAs (miR-142-3p, miR-143-3p, miR-145-5p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p, and miR-605-5p) that are selectively packaged into EVs and released into the tumor microenvironment. [score:1]
We found four of our eight miRNA candidates were also enriched within the EVs of HPL1Ds (miR-142-3p, miR-150-5p, miR-223-3p, and miR-451a); however, the extent of the enrichment observed in the tumor EVs was at least double that observed within the HPL1D EVs (Supplementary Figure 1). [score:1]
[1 to 20 of 5 sentences]
75
[+] score: 8
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For instance, a study analyzing miRNA expression profiles of ovarian adenocarcinomas demonstrated that two similarly expressed miRNAs (miR-9 and miR-223) regulate two independent targets of a common pathway involved in ovarian metastatis [38]. [score:8]
[1 to 20 of 1 sentences]
76
[+] score: 8
Apart from global modulation of miRNA biogenesis, mutant p53 also affects expression of miRNAs, principally by downregulating tumor-suppressive miRNAs – miR-130b in endometrial cancer (24), miR-27a in breast cancer cells (MDA-MB-468) (25), miR-223 in breast and colon cells (26), let-7i in breast cancer and DLD1 cells (colorectal cancer) (27), and miR-205 (28), and elevating oncogenic miRNAs: miR-128-2 (29) and miR-155 in breast cancer cells (30) to mediate its oncogenic functions. [score:8]
[1 to 20 of 1 sentences]
77
[+] score: 7
In mice, tumor -associated miRNAs were found to modulate the survival and longevity of DC (44), miR-223 was described to negatively regulate and miR-150 to positively regulate the cross-presenting abilities of LC (45, 46), the TGF-β associated miR-27a was reported to inhibit DC -mediated differentiation of Th1 and Th17 cells (47) and in an allergy setting miR-23b was shown to induce tolerogenic DC through inhibition of the Notch1/NF-κB pathway (48). [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
Upregulated miR-142-5p, miR-155, and miR-223 were strongly linked to intragraft levels of CD3 and CD20 mRNA, suggesting that the altered expression of miRNAs might be due to graft-infiltrating immune cells [44]. [score:6]
Intragraft levels of miR-142-5p, miR-155, miR-223, miR-10b, miR-30a-3p, and let-7c have been proposed to have diagnostic value for acute rejection, with miR-142-5p, miR-155, and miR-223 each predicting acute rejection with >90% sensitivity and specificity. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 7
The levels of six miRNAs were increased by more than 1.5-fold; the only downregulated miRNAs were miR-92a (1.3-fold) and miR-223 (1.4-fold)). [score:4]
Analysis by qRT-PCR confirmed the higher levels of miR-449a (fold six), miR-1 (2.6-fold), and miR-135b (60-fold) in this study (Fig. 1B) but not the suppression of miR-223 and miR-92a. [score:3]
[1 to 20 of 2 sentences]
80
[+] score: 7
[43] miR-223 and miR-370 can directly target FOXO1 and regulate endogenous FOXO1 protein expression and are also responsible for cancer cell proliferation. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
No differences in miRNA expression were found in kidneys of ischemic heart failure mice compared to control animals (S6 Table) and only small differences were observed between expression levels of miR-18a-5p, miR-30e-5p, miR-199a-3p and miR-223-3p in the LV of mice with ischemic heart failure compared to controls (S7 Table), however not reaching significance after Bonferroni correction for multiple testing. [score:3]
In addition to the cardiac specific miR-208a-3p and miR-499-5p, we found that the expression of let-7i-5p, miR-16-5p, miR-27a-3p, miR-199a-3p and miR-223-3p was significantly higher in the heart compared to the kidney, independent of the presence of ischemic heart failure (S4 Fig and S5 Table). [score:2]
In general, the rank order of the expression levels of the measured miRNAs was comparable in mice and rats, with the highest miRNA levels of miR-16-5p and miR-223-3p and the lowest levels of miR-199a-3p, miR-652-3p, miR-423-3p and miR-26b-5p (S1– S3 Figs). [score:1]
Indeed, the majority of miRNAs we previously identified in human plasma had similar sequences in both mice and rats, except for miR-223-3p (similar between humans and mice, different in rats) and miR-106a-5p (not present in rats and different in mice). [score:1]
[1 to 20 of 4 sentences]
82
[+] score: 7
For instance, He and co-workers demonstrated that miR-223 was significantly up-regulated in the serum of mice infected with S. japonicum and returned to near normal levels on praziquantel treatment [17], implying that up-regulated murine miR-223 may be a biomarker for Schistosoma infection. [score:7]
[1 to 20 of 1 sentences]
83
[+] score: 7
Mice with targeted deletions of the following putative tumor suppressor miRNAs did not show development of an overt malignancy: miR-145, miR-223, miR-133, and miR-206 (Park et al., 2010). [score:6]
Administration of antagomiRs in mice to block miR-10b and miR-223 resulted in significant antitumor activity against breast carcinoma and hepatocellular carcinoma respectively (Garzon et al., 2010). [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 6
MiR-335-3p, miR-223-3p, miR-340-5p, miR-298-5p and miR-224-5p had higher expression in SAT and VAT than in BAT (Supplementary Table 4). [score:3]
Inflammation and obesity associated miR-335 and miR-223 [22, 23] had higher expression in VAT than in BAT in HFD fed mice in our study. [score:3]
[1 to 20 of 2 sentences]
85
[+] score: 6
In myelopoiesis, miR-223 has been shown to regulate granulocyte development in both humans and mice [1], [2], while the clustered miRs 144 and 451 are important regulators of erythropoiesis [3]. [score:4]
This list includes miR-223, a known modulator of granulopoiesis [2]. [score:1]
This includes the clustered miR-144 and miR-451 as modulators of erythropoiesis, miR-223 as a modulator of granulopoiesis, and family members miR-125a/125b as modulators of hematopoietic stem cell proliferation and maintenance [2], [3], [7], [21]. [score:1]
[1 to 20 of 3 sentences]
86
[+] score: 6
FBXW7 was regulated by miR-223 and miR-27a and served as a tumor suppressor to inhibit tumor growth and progression [32- 36]. [score:6]
[1 to 20 of 1 sentences]
87
[+] score: 6
miR-223 targets FBXW7/hCdc4 expression at the post-transcriptional level and appears to regulate cellular apoptosis, proliferation, and invasion in gastric cancer [28]. [score:6]
[1 to 20 of 1 sentences]
88
[+] score: 6
In addition, miR-26a overexpression suppressed ox-LDL -induced apoptosis in HAECs, suggesting that, in addition to the established miRNAs (Let-7g 30, miR-29b 31, miR-21 32 33, miR-223 34), miR-26a is another key player in regulating cell apoptosis. [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 6
Only five miRNAs (mmu-miR-451, mmu-miR-223, mmu-miR-92a, mmu-miR-200c, and mmu-miR-873) were differentially expressed, implying that the majority of miRNA downregulation associated with obesity could be reversed by LFD treatment. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
Mir-223 has been found to be upregulated in PCa tissues [36], and the oncomiR miR-21, is associated with poor biochemical recurrence-free survival in PCa patients [37]. [score:4]
Wei Y MiR-223-3p targeting SEPT6 promotes the biological behavior of prostate cancerSci. [score:2]
[1 to 20 of 2 sentences]
91
[+] score: 6
miR-223 and miR-335 are specifically regulated by hyperglycemia, and are crucial regulator of inflammatory response and systemic insulin resistance [40– 42]. [score:3]
Zhuang G Meng C Guo X A novel regulator of macrophage activation: miR-223 in obesity -associated adipose tissue inflammationCirculation. [score:2]
In them, 7 miRNAs (miR-378d, miR-29c-3p, miR-20a-5p, miR-335-5p, miR-22-3p, miR-21a-5p and miR-223-3p) had been shown to be related with diabetes or glucose metabolism. [score:1]
[1 to 20 of 3 sentences]
92
[+] score: 6
Downstream target networks for upstream regulators of responsive mouse genes: (A) IL12 complex, (B) mir-223, and (C) STAT1. [score:4]
The activated upstream regulators include factors related to inflammatory responses (IL6, the NF B-activating kinase IKBKB, NLRP3 inflammasome, and mir-223), interferon signaling and action (IFNAR, IFNG, IFNα/IFNβ, STAT1, IRF3, IRF5, IRF7), and TLR signaling associated with innate immune responses (TLR3, TLR4, TLR9, TICAM1, DDX58, MYD88) (Figures  4, 5, and Additional file 2: Figures S4 and S5). [score:2]
[1 to 20 of 2 sentences]
93
[+] score: 5
Another study of primary cells from miRNA mutant mice showed that miR-155 in B cells and miR-223 in neutrophils cause significant target mRNA degradation, while miR-150 in B cells and miR-21 in neutrophils have absolutely no effect on their target mRNA abundance [14]. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
In this report and prior mouse studies and the expression pattern of 3 miRNAs (miR-199a-5p, 199b*, 125-5p) was found to be similar while the expression pattern of 11 miRNAs (miR-223, 221, 24, 877, 29b, 29a, 29c, 30c, 365, 148a, and 193) was partially consistent with fibrosis grade [16]. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
A report in HeLa cells demonstrated that miR-223 targets IGF-1R and suppresses cell proliferation by activation of the downstream PI3K/Akt/mTOR/p70S6K pathway 37. [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 5
Supporting in vitro and tissue level high expression of miR-17-5p, a clinical study proves serum levels of miR-17 along with miR-19a, miR-20a and miR-223 were significantly upregulated in CRC patients compared to controls [104]. [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
Recent studies have suggested important regulatory roles for miRNAs such as miR-21, miR-216, miR-217, miR-181b, miR-31b and miR-34a, which were confirmed to be upregulated in senescing HUVECs (Menghini et al., 2009), and miR-146, miR-142-3p, miR-223 and miR-29 family members, which were significantly increased in whole aortas of aged mice (Zhao et al., 2010). [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
We analyzed expression of miR-27b, miR-29b, miR-155, miR-124 and miR-223 in bone marrow-derived mouse macrophages differentiated in M0 (unstimulated), M1(LPS + IFN-γ) and M2(IL-4) conditions. [score:3]
miRNA expression was determined by Taqman Real-Time PCR using miR-27, miR-29b, miR-155, miR-223, miR-124 and sno-202 primer and probe sets (Life Technologies), according to manufacturer’s instructions. [score:2]
[1 to 20 of 2 sentences]
99
[+] score: 5
Conversely, there are miRs having the negative role in regulation of cell proliferation and are often down-regulated in cancer cells, such as let-7c, miR-10b, miR-15a, miR-31, miR-34, miR-145, miR-223 [7]. [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 5
For example, during SARS coronavirus infection process, miR-17 [∗], mir-574-5p, and miR-214, were up-regulated, and miR-98 and miR-223 were down regulated. [score:5]
[1 to 20 of 1 sentences]