sort by

199 publications mentioning hsa-mir-137 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-137. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 467
To determine whether endogenous miR-137 is able to regulate Shank2 expression, we carried out luciferase assays and Western blot experiments in mouse primary hippocampal neurons after inhibition of miR-137 with a targeted miRCURY LNA™ Power microRNA inhibitor or treatment with a microRNA inhibitor control. [score:11]
Conversely, miR-137 inhibition increased Shank2 protein expression, indicating that miR-137 regulates SHANK2 expression by repressing protein translation rather than inducing mRNA degradation. [score:10]
We analyzed the number of validated target genes that were differentially expressed in SCZ individuals and revealed a lower frequency compared with the respective miR-137 targets (Additional file  1: Table S6, differentially expressed targets: let-7a 14%, miR-21-5p 11%, miR-93-5p 14%, miR-451a 0%, and miR-675-5p 0%). [score:10]
Inhibiting effective protein translation is a known mechanism for local fine tuning of gene expression at postsynaptic sites and is in line with previously reported direct miR-137 targets, including Ephrin B2 (EFNB2) and the AMPA receptor subunit GluA1 (GRIA1) [35, 36]. [score:10]
All study-wide significant miR-137 target genes had modest fold changes with a mean of 1.09 and a range of 1.049–1.135 (inverting downregulated expression ratios). [score:8]
miR-124 precursor expression was not different between SCZ and control individuals and the differentially expressed miR-137 target genes may only slightly be co-regulated by miR-124 and miR-128. [score:8]
miR-137 regulates the expression of multiple glutamatergic synapse proteins; therefore, subtle regulation of SHANK2 expression by miR-137 is likely to be physiologically relevant. [score:7]
Most miR-137 targets have been investigated in cancer cell lines and only 13 miR-137 target genes (including SHANK2) have been confirmed in neuronal cells; therefore, some of the confirmed targets may not be miR-137 targets in the brain. [score:7]
miR-137 was also overexpressed or inhibited in hippocampal neurons, and Shank2 expression was analyzed by quantitative real-time PCR and Western blot. [score:7]
The analysis of miR-137 expression in 21 different human tissue samples revealed high expression in the central nervous system and marginal expression in other tested organs (Additional file  1: Figure S3). [score:7]
For the inhibitor experiments, the primary mouse hippocampal neurons were treated with 25 nM miR-137 or power inhibitor control (miRCURY LNA™ Power microRNA hsa-miR-137 4101446-111 or negative control B 199007-111 inhibitor 5′-Fluorescein-labeled, Exiqon, Vedbaek, Denmark) added drop-wise to the cells on DIV5. [score:7]
This indicated that miR-137 specifically binds the target site, as mutation of the seed region in the miR-137 binding site eliminated the robust downregulatory effect of miR-137. [score:7]
miR-137 acts cooperatively and synergistically with miR-124 and miR-128 [7, 33, 34]; therefore, changes in the expression of these two microRNAs may interfere with the expression of miR-137 target genes. [score:7]
Next, we focused on the miR-137 signaling network and analyzed the expression of 69 known miR-137 target genes (68 validated targets from previously published studies summarized in 1: Table S4 and SHANK2). [score:7]
In contrast, miR-137 overexpression or inhibition did not affect dendritic spine morphology, whereas miR-137 inhibition only led to a reduced spine density [36]. [score:7]
Furthermore, evidence was obtained that miR-137 target genes are differentially expressed between healthy controls and SCZ patients offering additional support for the involvement of miR-137 and its target genes in the pathogenesis of neuropsychiatric disorders. [score:7]
To analyze the expression levels of the validated miR-137 target genes and miR-137 precursor, we selected the average expression levels, the log [2]-fold change and the P values for the respective genes published on https://synapse. [score:7]
Next, we treated cells with a miR-137 inhibitor or control inhibitor on DIV5, shortly before miR-137 reaches its highest endogenous expression levels. [score:7]
In the DLPFC, SHANK2 and miR-137 are both expressed [27, 31] and we aimed to identify whether miR-137, SHANK2, and other known miR-137 targets are differentially expressed in the DLPFC of SCZ individuals compared to controls. [score:6]
We discovered that physiological levels of miR-137 regulate SHANK2 expression, most likely by repressing translation of SHANK2 protein rather than inducing mRNA degradation. [score:6]
miR-137 directly targets the SHANK2 3′UTRIn silico analysis (TargetScanHuman Release 7.1 [26]) of all three SHANK genes identified a single, highly conserved binding site for miR-137 (MIMAT0000429) in the 3′UTR of SHANK2 (ENST00000449833.2, Additional file  1: Figure S2A), suggesting that this microRNA has the potential to bind SHANK2 mRNA. [score:6]
This difference might be due to a more subtle regulatory effect of miR-137 on Shank2 protein expression compared to an RNAi -mediated knockdown as microRNAs are “fine-tuners” of protein expression. [score:6]
SHANK2 microRNA miR-137 Schizophrenia Autism Intellectual disability microRNAs are small non-coding, single-stranded RNA molecules that regulate gene expression by binding to the 3′UTRs of their target mRNAs through base pairing of their 6–8-nucleotide long seed region. [score:6]
Inhibition of miR-137 significantly increased endogenous Shank2 protein expression by 24% compared with control inhibitor (* P = 0.016, two-way ANOVA) (Fig.   2c). [score:6]
It is important to note that expression of miR-137 target genes is not regulated by miR-137 alone, but by multiple factors, e. g., other microRNAs, epigenetic mechanisms, subcellular localization, synaptic activity, medication, or other environmental factors. [score:6]
A two-sided Χ [2] test with Yates correction was used to compare the expression of validated target genes of miR-137 and five control microRNAs. [score:5]
Only 23% of the analyzed miR-137 target genes were differentially expressed on the mRNA level between SCZ and control individuals. [score:5]
The SHANK genes and the schizophrenia -associated microRNA-137 show convergence on several levels, as they are both expressed at the synapse, influence neuronal development, and have a strong link to neurodevelopmental and neuropsychiatric disorders like intellectual disability, autism, and schizophrenia. [score:5]
The majority of differentially expressed miR-137 target genes (12/16) were only modestly elevated in SCZ individuals, suggesting that small effects of single genes accumulate in the DLPFC, presumably leading to a general impairment of miR-137 signaling. [score:5]
The numbers of differentially expressed target genes were significantly different between miR-137 and the five pooled controls (P = 0.031, Χ [2] test, two-sided, Yates correction, Additional file  1: Table S6). [score:5]
Additionally, expression levels of experimentally validated miR-137 target genes were analyzed in the dorsolateral prefrontal cortex (DLPFC) of schizophrenia and control individuals using the RNA-Seq data from the CommonMind Consortium. [score:5]
Eight target genes that were not differentially expressed in SCZ and control individuals overlapped between miR137 and the five controls and were excluded from analysis. [score:5]
The miR-137 power inhibitor sequesters both the human hsa-miR-137 and mouse mmu-miR-137, thereby preventing it from binding to its targets. [score:5]
miR-137 was highly expressed in the fetal brain, and expression remained strong in the adult hippocampus, thalamus, and striatum. [score:5]
We analyzed miR-124 and miR-128, which act cooperatively with miR-137, and obtained no evidence that these two microRNAs influence the differential expression of miR-137 targets. [score:5]
To further investigate the link between miR-137 and SCZ, we analyzed the expression of miR-137 precursor and known miR-137 target genes in postmortem DLPFC samples of SCZ individuals using the CommonMind gene expression data resource [25]. [score:5]
We overexpressed miR-137 and negative control miRNA mimics in mouse hippocampal neurons to determine the effect on endogenous Shank2 expression. [score:5]
miR-137 also has subtle effects on the protein expression of its other targets [36]. [score:5]
Expression of miR-137 precursor and validated miR-137 target genes in the DLPFC of SCZ and control individuals. [score:5]
Expression of SHANK2 mRNA was not different in the DLPFC of SCZ and control individuals, which may mean that SHANK2 is not a relevant miR-137 target in the context of SCZ. [score:5]
Our study was limited to miR-137 precursor expression analysis as no data of mature miR-137 expression was available. [score:5]
Bar plots show mean ± SEM; *** P < 0.001, * P < 0.05 two-way ANOVA; b, c, and e (n = 5 experiments)Alterations in the microRNA machinery have been described in various cancers [29]; therefore, we further analyzed the regulatory effect of miR-137 on Shank2 expression in mouse primary hippocampal neurons. [score:4]
To investigate possible co-regulation with miR-137, we looked for additional binding sites in the 3′UTR of differentially expressed miR-137 target genes (Table  1). [score:4]
Therefore, we conclude that changes in mRNA expression do not reveal the full regulatory potential of miR-137. [score:4]
miR-137 directly targets the SHANK2 3′UTR. [score:4]
Our network analysis revealed that many validated miR-137 target genes are linked to developmental, neurological, and psychiatric disorders, particularly SCZ. [score:4]
We concluded that miR-137 directly and specifically targets the predicted binding site in the 3′UTR of SHANK2 in the SH-SY5Y cells and primary hippocampal neurons. [score:4]
This indicates that regulation of miR-137 expression varies in different cell types. [score:4]
Bar plots show mean ± SEM; *** P < 0.001, * P < 0.05 two-way ANOVA; b, c, and e (n = 5 experiments) Alterations in the microRNA machinery have been described in various cancers [29]; therefore, we further analyzed the regulatory effect of miR-137 on Shank2 expression in mouse primary hippocampal neurons. [score:4]
Differential expression of 23% (16/69) of known miR-137 target genes was detected in the DLPFC of schizophrenia individuals compared with controls. [score:4]
SHANK genes converge with miR-137 on several levels: (i) both are expressed at the synapse, (ii) both influence dendrite and spine formation in glutamatergic neurons [8, 21], and (iii) both have a strong link to neurodevelopmental and neuropsychiatric disorders like ID, ASD, and SCZ [18, 22, 23]. [score:4]
Endogenous miR-137 was sequestered by the inhibitor; therefore, the regulatory effect on the SHANK2 3′UTR was lost and luciferase activity was increased. [score:4]
miR-137 directly targets the 3′UTR of SHANK2 in a site-specific manner. [score:4]
To find out if the miR-137 signaling network is altered in schizophrenia, we compared miR-137 precursor and miR-137 target gene expression in the DLPFC of schizophrenia and control individuals using the CommonMind Consortium RNA sequencing data. [score:4]
miR-137 regulates the expression of several proteins that function at glutamatergic synapses, e. g., EFNB2, GluA1, and Mib1 and thereby influences neuronal maturation and signal transduction [8, 35, 36]. [score:4]
The majority of differentially expressed miR-137 target genes (12/16) showed elevated mRNA levels in SCZ individuals compared with controls. [score:4]
However, we and others have identified neuronal miR-137 target genes which were regulated on protein [35, 36] and not on mRNA level. [score:4]
SHANK2 and AMPA receptors are both regulated by miR-137 and are important for synaptic maturation and plasticity; therefore, this control by miR-137 may have synergistic effects on synaptic regulation. [score:3]
No difference in miR-137 precursor expression was found between SCZ and control individuals. [score:3]
The control inhibitor does not influence miR-137 and was used to control for unspecific effects of the treatment. [score:3]
This compiled evidence raised the question if the SHANKs might be targets of miR-137. [score:3]
Putative miR-137 targets are enriched in SCZ risk loci [18], suggesting that convergent pathways connected by this microRNA contribute to SCZ etiology. [score:3]
Analyzing miR-137 expression in specific cortical layers, cell types, or even cell compartments might reveal distinct local alterations in the DLPFC of SCZ patients. [score:3]
org/resources/sfari-gene#refs, accessed May 2017) are predicted or confirmed miR-137 targets (Additional file  1: Table S1). [score:3]
To determine the effect of miR-137 on endogenous Shank2 expression real-time quantitative PCR (RT-qPCR) was performed. [score:3]
miR-137 expression levels were analyzed with the same method using 21 different human tissue RNA samples (specified in Additional file  1: Table S3). [score:3]
Fig. 2 a Expression profile of miR-137 in mouse primary hippocampal cultures over 11 days in vitro (DIV). [score:3]
First, we analyzed the endogenous miR-137 expression profile in primary hippocampal neurons. [score:3]
Reduced levels of precursor and mature miR-137 concurrently with significantly increased levels of downstream target genes (MITF, EZH2, and KLF4) were determined in lymphoblastoid cells isolated from two patients with this 1q21.3 micro deletion [6]. [score:3]
Finally, we performed a functional network analysis of validated miR-137 targets (Table  2). [score:3]
Validated targets of miR-137 were collected from miRTarBase (http://mirtarbase. [score:3]
Based on our experimental results, we speculate that reduced miR-137 expression may also increase SHANK2 levels in these patients, which may contribute to the ID and ASD phenotype seen in these patients. [score:3]
Overexpression of miR-137 in mouse primary hippocampal neurons significantly lowered endogenous Shank2 protein levels without detectable influence on mRNA levels. [score:3]
These neurons express Shank2 and Mir137, and the miR-137 binding site is conserved in the mouse Shank2 3′UTR (Additional file  1: Figure S2B). [score:3]
Finally, we analyzed the consequences of endogenous miR-137 inhibition on Shank2 protein levels by. [score:3]
We identified a direct regulatory link between microRNA-137 and SHANK2, which is of importance for a spectrum of disorders including ID, ASD, and SCZ. [score:3]
RNA sequencing data for the miR-137 target genes HCRT, SLC6A3, and SNAI1 was not available in the CommonMind dataset. [score:3]
We examined the data for miR-137 precursor expression and found that it did not differ between SCZ and control individuals (MIR137HG, ENSG00000231269, P = 0.699). [score:3]
Selection of experimentally validated miR-137 targets and network analysis. [score:3]
Analysis of the 3′UTR of the differentially expressed miR-137 genes in the DLPFC between SCZ and control individuals for additional putative miR-124 and miR-128 binding sites. [score:3]
The validated miR-137 target genes (including SHANK2) were ranked according to their point-wise P values from the CommonMind analysis, and the Benjamini-Hochberg method was used to correct for multiple testing with a false discovery rate of 10% (Additional file  1: Table S5). [score:3]
Four miR-137 target genes (RORA, CPLX1, TCF4, SIRT1) even show significant differences on the whole-transcriptome level, according to data provided by the CommonMind Consortium [25]. [score:3]
Our study provides evidence that a direct regulatory link exists between miR-137 and SHANK2 and supports the finding that miR-137 signaling might be altered in schizophrenia. [score:3]
Taken together, these findings indicate that deregulation of miR-137 is the key to various psychiatric and neurodevelopmental disorders. [score:3]
To determine the effect of miR-137 on Shank2 protein expression, cellular protein was isolated using RIPA buffer from cell cultures on DIV10, and the lysates were run on Novex™WedgeWell™4–12% Tris-Glycine Gels (Thermo Fisher Scientific) and then blotted onto a PVDF membrane (Immobilon-FL, Millipore, Billerica, Massachusetts, USA) as recommended by the manufacturer. [score:3]
miR-137 overexpression did not alter endogenous Shank2 mRNA levels in hippocampal neurons (Fig.   1d). [score:3]
Beside the regulation of postsynaptic genes, miR-137 has also been shown to regulate presynaptic genes and presynaptic neurotransmitter release [38]. [score:3]
This suggests that SHANK genes might be targets of miR-137. [score:3]
The data for miR-137 precursor but not mature miR-137 expression levels were available in this data set. [score:3]
Different postsynaptic proteins are probably regulated by miR-137 at the same time, which may increase the intensity of the neuronal response. [score:2]
Homozygous knockout of Mir137 is embryonically lethal in mice, indicating that embryonic development is dependent on at least one functional allele [9]. [score:2]
Genetic alterations of MIR137 have been associated with neurodevelopmental disorders. [score:2]
Luciferase reporter assays were performed by overexpressing wild type and mutated SHANK2-3′UTR and miR-137 in human neuroblastoma cells and mouse primary hippocampal neurons. [score:2]
We showed a regulatory influence of miR-137 on SHANK2 expression in mouse hippocampal neurons, whereas the relevance in other brain regions and in human neurons warrants future investigation. [score:2]
miR-137 regulates Shank2 protein levels. [score:2]
However, Western blotting revealed a 29% reduction of Shank2 protein (*** P = 0.00003, two-way ANOVA) after miR-137 overexpression in hippocampal neurons compared with the negative control miRNA mimics (Fig.   1e). [score:2]
This emphasizes the importance of miR-137 in early developmental processes. [score:2]
miR-137 inhibition increased the relative luciferase activity for the SHANK2 wt reporter construct by 70% (* P = 0.044, two-way ANOVA) compared with the control (Fig.   2b). [score:2]
b Luciferase assay in primary mouse hippocampal neurons treated with hsa-miR-137 or control power inhibitors at DIV5. [score:2]
miR-137 target genes are enriched among ASD risk genes (29%, CI 18.6–41.8%) compared with the random frequency (2.9%, predicted in the miRDB database [14]; CI 2.7–3.2%, 525/17860) (P ≤ 0.000001, Fisher’s exact test, two-sided). [score:2]
Fig. 1 a Alignment of miR-137 with the human SHANK2-3′UTR (NM_012309) wild type and mutated seed sequence. [score:1]
The rare chromosomal micro deletion 1p21.3 encompassing MIR137 and DPYD was identified in individuals with intellectual disability (ID), comorbid with autism spectrum disorder (ASD), and obesity [6, 10, 11]. [score:1]
b Luciferase activity using the wild type (wt) and mutated (mut) 3′UTR of SHANK2 co -transfected with hsa-miR-137 mimic or control miRNA in the SH-SY5Y cells. [score:1]
In silico analysis revealed a putative binding site for microRNA-137 (miR-137) in the SHANK2 3′UTR, while this was not the case for SHANK1 and SHANK3. [score:1]
microRNA-137 (miR-137) is enriched in the human and mouse brain [5], especially in cortical regions and in the hippocampus [6]. [score:1]
The SH-SY5Y cells were seeded in antibiotic-free medium and transfected after 24 h with 200 ng of empty psiCHECK™-2 vector and wild type or mutated SHANK2 3′UTR constructs with 12 nM miR-137 or control mimics (mirVana® miRNA hsa-miR-137 mimic MIMAT0000429 and Pre-miR™ miRNA Precursor Molecules Negative Control #2, AM17111, Thermo Fisher Scientific, Darmstadt, Germany) in technical triplicates using Lipofectamine®2000 (Thermo Fisher Scientific, Darmstadt, Germany). [score:1]
Previous studies have shown no difference in the levels of precursor and mature miR-137 between SCZ and control individuals [31, 41, 42]. [score:1]
This is supported by the finding that altered miR-137 levels impact synaptic function and neuronal network formation in the mouse hippocampus [36]. [score:1]
A heterozygous micro deletion on 1q21.3 encompassing the genes MIR137 and DPYD was previously described in ID and ASD patients [6, 10, 11]. [score:1]
The amount of miR-137 mimics had to be optimized for each cell type separately. [score:1]
This indicated that the miR-137 signaling network might be altered in the DLPFC of SCZ individuals. [score:1]
In contrast, no difference was observed between miR-137 and negative control miRNA for the mutated 3′UTR. [score:1]
miR-137 expression has been investigated in fibroblasts and fibroblast-derived neurons isolated from individuals homozygous for four schizophrenia -associated SNPs at the MIR137 locus. [score:1]
Human neuroblastoma cells (SH-SY5Y) were transfected with a dual luciferase reporter plasmid (psiCHECK™-2) containing either the wild type (wt) SHANK2 3′UTR sequence or a miR-137 binding site-mutated 3′UTR (mut) together with either miR-137 or negative control miRNA mimics (Fig.   1a). [score:1]
Furthermore, the MIR137 gene has been reported as a schizophrenia (SCZ) susceptibility locus because the common SNP rs1625579, located in an intron of MIR137, was associated with SCZ in several studies [15– 18]. [score:1]
Hippocampal cultures were transfected with the optimized hsa-miR-137 mimic concentration of 300 nM and negative miRNA control on DIV5 using the AD1 4D-Nucleofector™ Y Unit system (Lonza, Basel, Switzerland) according to manufacturer’s instructions. [score:1]
Primary mouse hippocampal neurons were transfected with either hsa-miR-137 or control miRNA. [score:1]
Luciferase reporter constructs were transfected at DIV6, and luciferase activity was measured after 48 h. c Western blot with lysate from primary mouse hippocampal neurons treated with hsa-miR-137 or control power inhibitor at DIV5 and protein was harvested after 5 days. [score:1]
was performed with miRCURY LNA™ microRNA PCR ExiLENT SYBR® Green PCR sets for hsa-miR-137, U6, and spike-in (Exiqon), measuring the endogenous miR-137 expression profile in primary hippocampal neurons over a time period of 11 DIV. [score:1]
e Western blot of primary mouse hippocampal neurons 5 days posttransfection with hsa-miR-137 or control miRNA. [score:1]
miR-137 has been linked to various disorders including ID, ASD, and SCZ [6, 10, 11, 18]. [score:1]
Morphological effects caused by altered Shank2 levels in hippocampal neurons do not correlate to the morphological changes found when miR-137 levels are altered. [score:1]
[1 to 20 of 122 sentences]
2
[+] score: 417
These results suggest that enforcing the expression of miR-137 can effectively inhibit tumor growth that may result from the inhibition of target gene expression and induction of apoptosis. [score:11]
Using the xenograft animal mo del, we demonstrated that the enforced expression of miR-137 can inhibit tumor growth, and the expression of Aurora-A in miR-137 -expressing tumor tissues is repressed (Figure 6 and Supplementary Figure S10). [score:9]
The growth of the tumors is shown as A. (C) Western blot analysis showed the expression level of Aurora-A in tumor samples from B. (D) Immunohistochemistry analysis showed the expression of Annexin V in tumor tissues obtained from B. Loss of miR-137 expression can predict the predisposition of colorectal carcinogenesisOur previous results showed that the expression level of miR-137 is decreased not only in colorectal cancer tissues but also in colon polyps (Table 1, Figure 1 and Supplementary Figure S1C). [score:9]
Figure 7Loss of miR-137 expression may serve as a potential biomarker in colon polyps to predict the predisposition of colorectal carcinogenesis and the potential to be a target for cancer therapy or prevention(A) The expression level of miR-137 was determined in human colon polyps diagnosed as hyperplastic (n = 20) or adenoma (n = 40). [score:7]
The growth of the tumors is shown as A. (C) Western blot analysis showed the expression level of Aurora-A in tumor samples from B. (D) Immunohistochemistry analysis showed the expression of Annexin V in tumor tissues obtained from B. Our previous results showed that the expression level of miR-137 is decreased not only in colorectal cancer tissues but also in colon polyps (Table 1, Figure 1 and Supplementary Figure S1C). [score:7]
The silenced expression of miR-137 in the early stage of carcinogenesis may contribute to the neoplastic growth through the action of Aurora-A, whereas in the late stage of carcinogenesis, the loss of miR-137 expression can promote cancer cell metastasis by the increased expression of CDC42. [score:7]
Our result provides the clinical significance of miR-137 in the early stage of colorectal cancer development by directly inhibiting Aurora-A and PTGS2 expression. [score:7]
The growth of the tumors is shown as A. (C) Western blot analysis showed the expression level of Aurora-A in tumor samples from B. (D) Immunohistochemistry analysis showed the expression of Annexin V in tumor tissues obtained from B. (A) A total of 1 × 10 [6] vector- or miR-137-stably expressing HCT116 cells was subcutaneously injected into NOD-SCID mice, and then the mice were supplied with IPTG water. [score:7]
Figure 5The overexpression of Aurora-A rescues the effect of miR-137 -induced G2/M accumulation and apoptosis(A– B) Vector control (V) or miR-137 (M) stably expressed HCT116 cells were treated with IPTG for 48 h to determine the expression level of Aurora-A mRNA (A, left) and protein (A, left). [score:7]
Downregulation of miR-137 was found in many cancers, such as melanoma, head and neck carcinoma, breast cancer, gastric cancer and CRC, by inhibiting cancer cell proliferation, metastasis and invasion [16, 26– 29]. [score:6]
Inducing the expression of miR-137 impairs the tumor growth ability in vivoTo investigate the effect of overexpressed miR-137 in tumor progression, miR-137 stable expression cells were used to perform in vivo xenograft animal experiments. [score:5]
It was previously indicated that the overexpression of miR-137 can induce cell cycle G1 arrest in gastric cancer cells through targeting Cdc42 [15]. [score:5]
Interestingly, ectopic expression of GFP-Aurora-A can rescue miR-137 -induced proliferative inhibition and cell apoptosis (Figure 5D–5E). [score:5]
mir-137 specifically targets PTGS2, CDK6, CDC42 and Aurora-A. Overexpression of Aurora-A and PTGS2 occurs in colon polyps and has a reverse correlation with miR-137 in both colon polyps and colorectal cancer tissue. [score:5]
The expression level of miR-137 and its target genes Aurora-A, PTGS2, CDK6, and CDC42 was determined by TaqMan Q-PCR. [score:5]
When colorectal cancer cells were treated with 5-aza-2′-deoxycytidine (5-aza-C), a methyl transferase inhibitor, the expression of miR-137 was induced (Supplementary Figure S2B). [score:5]
These results strongly suggest that the loss of miR-137 expression may promote the neoplastic processing through the impaired ability in Aurora-A inhibition and also imply that miR-137 has the potential to be a therapeutic miRNA. [score:5]
Several reports indicated that miR-137 negatively regulates the progression of CRC through directly targeting the oncogenes, such as Musashi-1, paxillin, FMNL2 and Cdc42 [16– 19]. [score:5]
Given the effect of Aurora-A inhibition in inducing cell apoptosis, we analyzed the effect of miR-137 expression in apoptosis. [score:5]
Furthermore, the expression of Aurora-A and PTGS2 was also decreased in miR-137 -overexpressing cancer cell lines (Figure 3E). [score:5]
Figure 1The expression of miR-137 is decreased in human colorectal cancer tissues and colon polypsThe expression level of miR-137 in 29 paired colorectal cancer tissues (T) and adjacent normal tissues (N) (A) or 65 paired colon polyps (P) and adjacent normal tissues (N) (B) was analyzed by TaqMan Q-PCR. [score:5]
The luciferase reporter assay using the 3′-UTR of Aurora-A or PTGS2 mRNAs indicated that the overexpression of miR-137 can down-regulate Aurora-A and PTGS2 (Figure 3B). [score:5]
By RT-qPCR, the expression of Aurora-A, PTGS2, CDK6 and CDC42 was decreased in miR-137 -overexpressing HCT116 and SW480 cells (Figure 3A). [score:5]
After the addition of IPTG, the expression of miR-137 was induced (Supplementary Figure S6) and Aurora-A expression was decreased (Figure 5A). [score:5]
Importantly, the overexpression of Aurora-A in miR-137 -expressing cells can reverse those effects (Figure 5D and 5E). [score:5]
miR-137 targets several important genes that are involved in the tumorigenesis of colorectal cancerTo investigate the effects of miR-137 in colorectal tumorigenesis, we searched its targeting genes through miRanda and TargetScan, confirmed by miRTarBase (Supplementary Figure S4A). [score:5]
Figure 6The stable expression of miR-137 represses the tumor formation ability(A) A total of 1 × 10 [6] vector- or miR-137-stably expressing HCT116 cells was subcutaneously injected into NOD-SCID mice, and then the mice were supplied with IPTG water. [score:5]
Figure 4The expression of miR-137 is negatively correlated with Aurora-A mRNA in human colorectal cancer tissues and colon polypsTotal RNA purified from tumorous tissues of CRC (T) (A, N = 29) or colon polyps (P) (B, N = 65) was collected to determine the expression levels of Aurora-A mRNA by TaqMan Q-PCR. [score:5]
The expression of PTGS2, CDK6 and CDC42 was also decreased in miR-137 -expressing stable cells (Supplementary Figure S7). [score:5]
Consistently, when HCT116 cells were treated with 5-aza-C, the expression of Aurora-A was decreased and that of cleavage PARP and caspase-3 was increased, which are the phenomena similar to overexpressed miR-137 (Supplementary Figure S9). [score:5]
The expression of miR-137 and Aurora-A mRNA in tumors collected from IPTG -treated or untreated mice was determined by RT-qPCR (Supplementary Figure S10A and S10B); the protein expression level of Aurora-A was decreased in tumor tissues from mice supplied with IPTG water (Figure 6C and Supplementary Figure S10C). [score:5]
Loss of miR-137 expression may serve as a potential biomarker in colon polyps to predict the predisposition of colorectal carcinogenesis and the potential to be a target for cancer therapy or prevention. [score:5]
Overexpression of Aurora-A and PTGS2 occurs in colon polyps and has a reverse correlation with miR-137 in both colon polyps and colorectal cancer tissueOur previous results showed that the expression of miR-137 was decreased in human colorectal cancer tissues and colon polyps (Table 1 and Figure 1A–1B). [score:5]
Epigenetic silencing results in the loss of miR-137 expression in colorectal cancer cells and polypsWe first checked the expression status of miR-137 in human colorectal cancer cell lines and colorectal cancer tissues. [score:5]
We further checked the specificity of miR-137 in targeting Aurora-A and PTGS2 using two mutants of Aurora-A 3′-UTR (Figure 3C, Aurora-A 3′-UTR mt-1 and Aurora-A 3′-UTR mt-2), two mutants of PTGS2 3′-UTR (Figure 3D, PTGS2 3′-UTR mt-A and PTGS2 3′-UTR mt-B), and a seed region mutant of miR-137 that can complementarily target the Aurora-A 3′-UTR mt-1 and PTGS2 3′-UTR mt-A and mt-B (Figure 3C and 3D, hsa-miR-137 mt). [score:5]
However, in our study, the enforced expression of miR-137 in CRC cell lines induces obvious G2/M arrest and an increase in phosphor-histone H3/Serine 10, both of which result from the depressed expression of Aurora-A (Figure 5A, 5B, and Supplementary Figure S8). [score:5]
According to a previous report, the expression of miR-137 can be epigenetically regulated [13]. [score:4]
Our results showed that miR-137 is down-regulated in colon polyps, supporting the conclusion of the early silencing of miR-137 in colorectal adenoma. [score:4]
The expression of miR-137 is differentially reduced in different types of colon polyps, the early-stage of pre-cancerous lesions of CRC, with different potencies to CRC development. [score:4]
To detect the expression of miR-137, the cDNA was synthesized using the MicroRNA reverse transcription kit (TaqMan; Applied Biosystems), and the miR-137 and endogenous control U6 small nuclear RNA (snRNA) expression levels were analyzed using the TaqMan microRNA Assay kit (Applied Biosystems) according to the manufacturer's instructions. [score:4]
The luciferase reporter assay indicated that wild-type miR-137 can only inhibit the wild-type Aurora-A 3′UTR and PTGS2 3′-UTR but not the mutants of Aurora-A 3′-UTR or PTGS2 3′-UTR, whereas the miR-137 mt can specifically inhibit the Aurora-A 3′-UTR mt-1 (Figure 3C) and PTGS2 3′-UTR mt-A and mt-B (Figure 3D). [score:4]
MetaCore analysis showed that those potential miR-137 -targeted genes are involved in pathways which are involved in cancer development or malignancies (Supplementary Figure S4B). [score:4]
When checking the expression level in different types of polyps, we found that miR-137 was more decreased in villous polyps, which have a higher risk for CRC development, than in tubular polyps (Table 3 and Figure 7B). [score:4]
Loss of miR-137 expression can predict the predisposition of colorectal carcinogenesis. [score:3]
Figure 3 mir-137 specifically targets PTGS2, CDK6, CDC42 and Aurora-A(A) HCT116 and SW480 cells were transiently transfected with miR-137 or vector control. [score:3]
The overexpression of Aurora-A rescues the effect of miR-137 -induced G2/M accumulation and apoptosis. [score:3]
The results showed that miR-137 expression was lower in adenoma but not in the hyperplastic polyps (Table 2 and Figure 7A). [score:3]
The cells were treated with 62.5 μM of IPTG to induce the expression of miR-137. [score:3]
Our previous results showed that miR-137 is epigenetically silenced in cultured colorectal cancer cell lines, and treatment with 5-aza-C can induce its expression (Supplementary Figure S2 and Figure 2A). [score:3]
The enforced expression of miR-137 in CRC can repress the cell proliferation and induces cell apoptosis. [score:3]
Our results indicated that the expression of Aurora-A mRNA and miR-137 is inversely correlated in human colorectal cancer tissues and colon polyps (Figure 4C). [score:3]
The results showed that the methylation percentage of human colon mucosa is around 20%, and that of polyps and colorectal cancer tissues is around 40% to 50%, and the expression level of miR-137 is negatively correlated with the methylation status (Figure 2E). [score:3]
The expression of miR-137 is decreased in human colorectal cancer tissues and colon polyps. [score:3]
We first checked the expression status of miR-137 in human colorectal cancer cell lines and colorectal cancer tissues. [score:3]
miR-137 targets several important genes that are involved in the tumorigenesis of colorectal cancer. [score:3]
To investigate the effect of overexpressed miR-137 in tumor progression, miR-137 stable expression cells were used to perform in vivo xenograft animal experiments. [score:3]
Epigenetic silencing results in the loss of miR-137 expression in colorectal cancer cells and polyps. [score:3]
In total, 40 adenomatous polyps (include tubular and villous tubular adenomas) and 20 hyperplastic polyps were collected to analyze the association with the expression level of miR-137. [score:3]
By Q-PCR and ROC analysis, we found that the expression of PTGS2 is negatively correlated with miR-137 in human colorectal cancer tissues and polyps, as well as acts as a biomarker that can predict the tendency toward to CRC formation (Figures 4F and 7E). [score:3]
The expression level of miR-137 in HCT116, human polyps and colorectal cancer tissues was determined by Q-PCR accordingly (Figure 2B–2D). [score:3]
The cleavage of PARP and caspase-3 is increased in miR-137 -expressing cells (Supplementary Figure S8D). [score:3]
Therefore, we checked the correlation with the expression level of miR-137 in adenomatous polyps and hyperplastic polyps. [score:3]
Three nucleotides within the miR-137 seed sequence in the pMirTarget- Aurora-A-3′-UTR construct were mutated. [score:3]
The expression of miR-137 is negatively correlated with Aurora-A mRNA in human colorectal cancer tissues and colon polyps. [score:3]
Interestingly, we found that the expression of miR-137 was also decreased in colon polyps, the pre-cancerous lesions of CRC (Figure 1B and Supplementary Table S2). [score:3]
Figure 2 miR-137 is methylated in colorectal cancer cells(A) HCT116 and SW480 cells treated with (+) or without (−) 2.5 μM 5-aza-CdR for 1, 3, 5, and 7 days (D1, D3, D5 and D7) were harvested to determine the expression of miR-137. [score:3]
Association between miR-137, Aurora-A and PTGS2 expression with colorectal cancer (Tumor) and (polyp). [score:3]
Inducing the expression of miR-137 impairs the tumor growth ability in vivo. [score:3]
Flow cytometry showed that the overexpression of miR-137 leads to an increase in the G2/M population of HCT116 or SW480 cells (Supplementary Figure S8C). [score:3]
The tumorous tissues of CRC (T) and colon polyps (P) are the same as those in Figure 1. Table 1Association between miR-137, Aurora-A and PTGS2 expression with colorectal cancer (Tumor) and (polyp)Polyp (n = 64)Tumor (n = 29) p-value Age 0.839 30–50 y/o (n = 9) 9 (9.5%) 3 (3.2%) 51–80 y/o (n = 51) 56 (59.6%) 26 (27.7%) Gender 0.073 Male (n = 45) 48 (51.1%) 16 (17.0%) Female (n = 15) 17 (18.1%) 13 (13.8%) miR-137(mean log [10] = 2.79) 0.009 high (log [10] > 2.79) 39 (41.5%) 9 (9.6%) low (log [10] < 2.79) 26 (27.7%) 20 (21.3%) Aurora-A(mean log [10] = 4.64) < 0.0001 high (log [10] > 4.64) 23 (24.5%) 25 (26.6%) low (log [10] < 4.64) 42 (44.7%) 4 (4.3%) PTGS2(mean log [10] = 5.26) 0.797 high (log [10] > 5.26) 31 (33.0%) 13 (13.8%) low (log [10] < 5. 26) 34 (36.2%) 16 (17.0%) Bold values indicate statistically significant (Chi square). [score:3]
The expression level of miR-137 in 29 paired colorectal cancer tissues (T) and adjacent normal tissues (N) (A) or 65 paired colon polyps (P) and adjacent normal tissues (N) (B) was analyzed by TaqMan Q-PCR. [score:3]
The expression of miR-137 gradually decreases during the process of colorectal carcinogenesis. [score:3]
These results imply that the loss of miR-137 expression may occur in the early carcinogenesis of colorectal cancer. [score:3]
On the following day, the mice were fed 10 mM IPTG in the drinking water to induce miR-137 expression. [score:3]
The activities of caspase-3/7 and the sub-G1 population were augmented in miR-137 -expressing cells in a time -dependent manner (Supplementary Figure S8E). [score:3]
Additionally, the expression level and ROC analysis of Aurora-A mRNA and PTGS2 mRNA in adenomatous polyps and hyperplastic polyps showed a comparable result to that of miR-137 (Figure 7D–7E). [score:3]
In addition, miR-137 may cooperate with other miRNAs to inhibit the growth of CRC [20]. [score:3]
The 5-aza-C -induced expression of miR-137 in CRC cell lines is time dependent (Figure 2A). [score:3]
Association between miR-137, Aurora-A and PTGS2 expression with different types of colon polyp. [score:3]
In conclusion, our study indicates that the epigenetic silencing of miR-137 can occur as early as during neoplastic growth, and the loss of miR-137 expression can act a biomarker to predict the predisposition of CRC formation. [score:3]
Importantly, the expression level of miR-137 is gradually decreased in hyperplastic, tubular and villous polyps (Figure 7B and Table 3). [score:3]
The miR-137 expression level was gradually decreased from normal colon mucosa, polyps to colorectal cancer tissues (Supplementary Figure S1C). [score:3]
The tumorous tissues of CRC (T) and colon polyps (P) are the same as those in Figure 1. Table 1Association between miR-137, Aurora-A and PTGS2 expression with colorectal cancer (Tumor) and (polyp)Polyp (n = 64)Tumor (n = 29) p-value Age 0.839 30–50 y/o (n = 9) 9 (9.5%) 3 (3.2%) 51–80 y/o (n = 51) 56 (59.6%) 26 (27.7%) Gender 0.073 Male (n = 45) 48 (51.1%) 16 (17.0%) Female (n = 15) 17 (18.1%) 13 (13.8%) miR-137(mean log [10] = 2.79) 0.009 high (log [10] > 2.79) 39 (41.5%) 9 (9.6%) low (log [10] < 2.79) 26 (27.7%) 20 (21.3%) Aurora-A(mean log [10] = 4.64) < 0.0001 high (log [10] > 4.64) 23 (24.5%) 25 (26.6%) low (log [10] < 4.64) 42 (44.7%) 4 (4.3%) PTGS2(mean log [10] = 5.26) 0.797 high (log [10] > 5.26) 31 (33.0%) 13 (13.8%) low (log [10] < 5. 26) 34 (36.2%) 16 (17.0%) Bold values indicate statistically significant (Chi square). [score:3]
After the tumors reached approximately 100 mm [3], the mice were separated into two groups randomly and fed regular water or 10 mM IPTG in the drinking water to induce miR-137 expression. [score:3]
The expression of miR-137 was normalized to that of U6 snRNA. [score:3]
Association between miR-137, Aurora-A and PTGS2 expression with colon hyperplastic polyps and adenoma polyps. [score:3]
Our previous results showed that the expression of miR-137 was decreased in human colorectal cancer tissues and colon polyps (Table 1 and Figure 1A–1B). [score:3]
To investigate the effects of miR-137 in colorectal tumorigenesis, we searched its targeting genes through miRanda and TargetScan, confirmed by miRTarBase (Supplementary Figure S4A). [score:3]
miR-137 targets Aurora-A to arrest cell cycle progression and apoptosis. [score:3]
The expression of miR-137 and Aurora-A or PTGS2 was negatively correlated in both human colorectal cancer tissues and colon polyps (Figure 4E–4F). [score:3]
The stable expression of miR-137 represses the tumor formation ability. [score:3]
These results imply that miR-137, Aurora-A mRNA and PTGS2 mRNA have the potential to act as a biomarker to predict colorectal cancer development. [score:2]
During colorectal carcinogenesis, miR-137 is silenced through epigenetic regulation. [score:2]
The results showed that the expression of miR-137 was almost undetectable in all of the tested colorectal cancer cell lines (Supplementary Figure S1A) and decreased in human colorectal cancer (CRC) tissues compared with the paired adjacent normal mucosa (Figure 1A and Supplementary Table S1). [score:2]
These data suggest that miR-137 is epigenetically regulated during colorectal cancer progression as previously shown [13, 14]. [score:2]
MiR-137, a tumor suppressor gene, is epigenetically silenced in colorectal cancer [13– 15]. [score:2]
Western blot analysis and immunofluorescence assay showed that phosphorylated histone H3/S10, which is an indicator of mitotic cells and Aurora-A inhibition, is increased in IPTG -treated miR-137 stable cells (Figure 5A and 5B) or miR-137 transiently transfected cells (Supplementary Figures S8A and S8B). [score:2]
We checked the miR-137 genome and found that there are CpG islands spread throughout the promoter region and miR-137 transcript (Supplementary Figure S2A). [score:1]
In 2010, Balaguer F et al. reported that the epigenetic silencing of miR-137 is an early event in colorectal adenoma [13]. [score:1]
To determine the methylation level of miR-137, 7 CpG sites on miR-137 were used for pyrosequencing analysis (Supplementary Figure S3). [score:1]
Furthermore, the results from ROC analysis showed that the epigenetic silencing of miR-137 not only occurs in the early stage of the neoplastic pathway but also serves as a biomarker to predict the tendency toward to CRC formation (Figure 7C). [score:1]
Interestingly, the methylation percentage of miR-137 was increased from normal mucosa, tubular polyps to villous polyps (Supplementary Figure S11). [score:1]
The precursor miR-137 was cloned into an IPTG-inducible pLAS1w. [score:1]
Therefore, in addition to its role as a biomarker, miR-137 may serve as a therapeutic miRNA in CRC. [score:1]
The miR-137 mutant (miR-137 mt) which complements the Aurora-A 3′-UTR mt-1 and two PTGS2 3′-UTR mutants, mt-A and mt-B, of is shown below. [score:1]
miR-137 targets Aurora-A to arrest cell cycle progression and apoptosisDue to the facts that the other three genes, PTGS2, CDK6 and CDC42, have been reported [15, 22– 25], and the functional correlation between miR-137 and Aurora-A in the early stage of colorectal carcinogenesis is still unclear, here, we focused on the investigation of the miR-137- Aurora-A axis in colorectal carcinogenesis. [score:1]
Methylation-specific PCR (MSP) further confirmed the methylation status of miR-137 in the colorectal cancer cell line HCT116, human polyps and colorectal cancer tissues, whereas both 5-aza-C -treated cells and normal colon mucosa showed an un-methylated pattern of miR-137 (Figure 2B–2D). [score:1]
In this report, we identified miR-137 as a potential biomarker to predict the risk of colorectal carcinogenesis. [score:1]
ROC (receiver operating characteristic curve) analysis suggested that the loss of miR-137 expression in adenomatous polyps shows excellent discrimination for colorectal cancer formation (Figure 7C). [score:1]
The early loss of miR-137 has a higher risk of colorectal carcinogenesis. [score:1]
Furthermore, the methylation of miR-137 in human normal mucosa and polyp was quantified by pyrosequencing (Supplementary Figure S3). [score:1]
miR-137 is methylated in colorectal cancer cells. [score:1]
HCT116 stable clones with control vector or inducible miR-137 were subcutaneously injected (1 × 10 [6]) into the left or right flank of 5- to 6-week old female NOD-SCID mice (n = 6). [score:1]
The results showed that tumor growth is halted in IPTG -induced miR-137 stable cells but not the vector control cells (Figure 6A). [score:1]
Both the BrdU incorporation assay and cell proliferation assay indicated that the overexpression of miR-137 can halt the cell proliferation rate (Figure 5E). [score:1]
The primer sequences used to analyze miR-137 promoter methylation were designed using Methyl Primer Express Software v1.0 (Applied Biosystems) and were as follows: methylated alleles: 5′-GTAGCGGTAGCGGTAGTAGC-3′ and 5′- ACCG CTAATACTCTCCTCGA-3′; unmethylated alleles: 5′- GTAGTAGTGGTAGTGGTAGTAGT-3′ and 5′-CCTAC CACTAATACTCTCCTCAA-3′. [score:1]
To evaluate the effect of miR-137 in tumorigenesis, the IPTG -induced miR-137 HCT116 stable expression cell line was established. [score:1]
The decreased level of miR-137 showed no difference between the early stage and late stage of CRC (Supplementary Figure S1B). [score:1]
Furthermore, we propose the potential to consider miR-137 as a therapeutic miRNA in cancer therapy. [score:1]
In addition to Aurora-A, other potential targets of miR-137 were also characterized, including PTGS2, which also plays an important role in colorectal carcinogenesis [21]. [score:1]
The quantitative results of the methylated miR-137 are shown as percentages (%). [score:1]
Additionally, in another experiment, HCT116 stable clones with inducible miR-137 were subcutaneously injected (1 × 10 [6]) into the bilateral flank of 5- to 6-week old female NOD-SCID mice (n = 10). [score:1]
The same effects were observed in miR-137 transiently transfected HCT116 or SW480 cells. [score:1]
[1 to 20 of 123 sentences]
3
[+] score: 377
Other miRNAs from this paper: mmu-mir-137, mmu-mir-206, hsa-mir-206
To explore the mechanisms involved in suppressing tumour formation when miR-137 is over-expressed in MDA-MB-231 cells, we performed IHC to monitor cell proliferation, angiogenesis and expression of tumour suppressors. [score:9]
Mesenchymal expression of Gata3 was induced but epithelial expression was reduced by miR-137 over -expression (Figure 2F and 2H). [score:7]
Interestingly, ER1 is expressed in the mesenchyme surrounding the mammary bud at E12.5 [5] and is a target of miR-206, which is also expressed in the mesenchyme at E11.5 and E12.5 (earlier than miR-137) but not at E13.5 [35]. [score:7]
A recent study also reported that miR-137 impairs proliferation and migration of cells of a breast cancer cell line by targeting expression of the nuclear receptor estrogen-related receptor alpha (ERRα) [28], suggesting that miR-137 may suppress the formation of breast cancer. [score:7]
To determine whether miRNA-137 inhibits or simulates expression of genes involved in mammary gland formation, we applied miR-137 to cultured mouse flanks and examined expression of Gata3, T-box transcription factor Tbx3, Tac1, and Lef1 (lymphoid enhancing factor 1) (Figure 2E- 2T). [score:7]
In transverse section showed that Tac1 was expressed in mesenchyme under surface ectoderm region but it was not expressed mesenchyme below mammary bud after miR-137 over -expression (Figure 2K and 2L asterisks). [score:7]
G. - L. Over-expressed miR-137 inhibits VEGF expression. [score:7]
Moreover, the cells in the tumours formed from miR-137 over -expressing cells induced the epithelial marker E-cadherin expression (Supplementary Figure S5A-S5F) but mesenchymal marker, Vimentin expression was reduced compare to control (Supplementary Figure S5G-S5L). [score:7]
We used miExpress [TM] precursor miRNA expression clone (GeneCopoeia [TM], USA) for miR-137 over -expression in mouse embryo flank and MDA-MB-231 cell. [score:7]
Expression pattern of angiogenesis and tumour suppressor markers after miR-137 overexpression. [score:7]
On the other hand, expression of known tumour suppressors, Runx3 and p53, was increased in the tumours formed by miR-137 over -expressing cells (Figure 4S- 4X; Figure 5A- 5C). [score:7]
Upon over -expression of miR-137 in mouse embryo flank during organ culture, the mammary epithelium thickened but it did not express several key genes known to be required for gland development and it also failed to invaginate into the underlying mesenchyme. [score:6]
All these results indicate that over -expression of miRNA-137 suppresses development of the mammary gland in mouse embryos. [score:6]
For each 100 mm dish, helper plasmid pCD-NL/BH*ΔΔΔ 3 μg, envelope pLTR-G 300 ng, target miR-137 expressing lentivirus DNA 3 μg were mixed in 500 μl transfection reagent FuGENE HD (Roche). [score:5]
These data suggest that miR-137 is a potential therapeutic target for breast cancer by controlling of Tac1 expression. [score:5]
However, Gata3 expression was lost its typical pattern in mammary epithelium and surface ectoderm after miR-137 over -expression (Figure 3H). [score:5]
When miR-137 is over-expressed, mammary placode formed and thickened but failed to invade the underlying mesenchyme and did not express either Tbx3 or Lef1 in mammary epithelium. [score:5]
After miR-137 over -expression, Tbx3 expression pattern was similar as control in surface view of the dorsal part embryo flank (Figure 2N). [score:5]
When we over-expressed miR-137 in this breast cancer cell line, tumour formation in vivo was suppressed. [score:5]
Staining for the sinusoidal endothelial cell marker CD31 indicated that there were a smaller number of blood vessels in the tumours made by miR-137 over -expressing MDA-MB-231 cells (Figure 4A- 4F) and furthermore the expression of vasculogenesis markers, VEGF and vWF were dramatically reduced (Figure 4G- 4L; Figure 4M- 4R). [score:5]
Figure 5 A. - C. Expression level of p53 is increased in mammary gland tissue and MDA-MB-231 cells after over -expressing miR-137. [score:5]
S. - X. Tumour suppressor Runx3 expression is substantially increased after miR-137 treatment. [score:5]
Tumour formation after SC inoculation of MDA-MB-231 cells over -expressing scrambled miRNA (controls) or over -expressing miR-137. [score:5]
Figure 3 A. Cells over -expressing miR-137 form smaller tumours than cells over -expressing scrambled miRNA. [score:5]
E. - H. Gata3 expression is disrupted by over-expressed miR-137. [score:5]
In breast cancer cells, miR-137 has been shown to target expression of ERRα [28]. [score:5]
A. - C. Expression level of p53 is increased in mammary gland tissue and MDA-MB-231 cells after over -expressing miR-137. [score:5]
We found that miRNA-137 (miR-137) is highly expressed in the 3 [rd] mammary gland at E13.5 and over -expressing it in the flank region of developing mouse embryos perturbed invasion of the epithelial mammary bud. [score:5]
IHC of vasculogenesis and tumour suppressor markers after miR-137 over -expression. [score:5]
From screens of tissue from mouse embryos for miRNAs differentially expressed in the developing mammary gland, we identified miR-137 was highly expressed. [score:5]
Y. The area of CD31, VEGF, vWF and Runx3 expression in the scramble miRNA and miR-137 over -expression group (n = 7 for each). [score:5]
Gata3 expression pattern was altered by miR-137 over -expression. [score:5]
Ectopic expression of Tac1 was detected between 3 [rd] and 4 [th] mammary gland after miR-137 over -expression (Figure 2I and 2J arrowheads). [score:5]
A. Cells over -expressing miR-137 form smaller tumours than cells over -expressing scrambled miRNA. [score:5]
Moreover, epithelial-mesenchymal transition (EMT) was inhibited in the tumours formed from miR-137 over -expressing MDA-MB-231 cells. [score:5]
Over -expression of miR-137 in in vitro organ culture and breast cancer cellsDuring cell culture (MDA-MB-231), miR-137 expressing lentiviral vector was transduced into cells. [score:5]
Tac1 and Gata3 genes whose expression is also altered by over -expression of miR-137 are also detected at early bud stages. [score:5]
M. - R. vWF expression is decreased in breast cancer after over -expression of miR-137 in MDA-MB-231. [score:5]
However, Lef1 expression was detected in broad region of mammary gland than control after miR-137 over -expression (Figure 2R). [score:5]
Thus, the failure of the mammary placode invagination by loss of Tbx3 and Lef1 after miR-137 over -expression suggests that miR-137 correlated the early stages of mammary gland development. [score:4]
To investigate the function of miR-137 in mouse mammary gland development, we over-expressed miR-137 using a lentiviral system in the flank region of E11.0 mouse embryos and then cultured the flank for 72 h. As controls, we over-expressed scrambled miRNA. [score:4]
A large number of Ki67 -positive proliferating cells were observed in tumours formed by cells expressing the scrambled miRNA compared to tumours formed by cells over -expressing miR-137 (Supplementary Figure S4A-S4D). [score:4]
The outcomes of this study reveal that miR-137 not only perturbs embryonic mammary gland development but also inhibits tumour formation by human breast cancer cells. [score:4]
I. - L. MiR-137 over -expression alters Tac1 expression. [score:4]
Down-regulated miR-137 has been observed in various cancers such as colorectal cancer, gastric cancer, oral cancer, and squamous cell carcinoma of the head and neck [24- 27]. [score:4]
Both weight and volume of tumours developing from miR-137 over -expressing cells were significantly reduced compared with tumours developing from cells over -expressing scrambled miRNA (Figure 3B and 3C). [score:4]
The CD31, VEGF and vWF positive area was reduced in the miR-137 over -expression group than in those treated with scramble miRNA treated group. [score:3]
Our focus on miR-137 initially arose from screening for genes differentially expressed in embryonic mammary glands and this shows how the study of the developing embryonic mammary gland can provide new perspectives on breast cancer. [score:3]
D. A luciferase assay result indicating that Tac1 is a direct target of miR-137. [score:3]
We identified miR-137 as a miRNA highly expressed in the developing mouse mammary gland at a stage when the mammary placode has invaginated the underlying mesenchyme to form a spherical bud. [score:3]
Interestingly, we observed that cell proliferation of subcutaneously inoculated breast cancer cells was reduced when miR-137 was over-expressed. [score:3]
Concentrated miR-137 expressing lentivirus was added 1% (v/v) in culture medium containing polybrene (Santa Cruz Biotechnology). [score:3]
A. - F. Sinusoidal endothelial cell marker CD31 is reduced after miR-137 over -expression. [score:3]
After cells grew to 80-90% confluence, wild type (psiCHECK [TM]-2 Tac1) or mutant (Mut) reporter vectors were co -transfected into Cos-7 cells with or without a miR-137 expressing lentiviral vector using FuGENE [®]H (Promega) and salmon sperm DNA (ssDNA, Sigma). [score:3]
To confirm this possibility in vivo, we over-expressed miR-137 in cells of a breast cancer cell line, then inoculated them into nude mice and found that their ability to form tumours was reduced. [score:3]
The lentiviral system also incorporated an EGFP cassette and successful over -expression of miR-137 or the control scrambled miRNA was confirmed by immunohistochemistry (IHC) using EGFP antibody and real-time quantitative polymerase chain reaction (RT-qPCR) (Figure 2C and 2D; Supplementary Figure S2A). [score:3]
Over -expression of miR-137 in the cells was confirmed by RT-qPCR (Supplementary Figure S2B). [score:3]
Figure 4 A. - F. Sinusoidal endothelial cell marker CD31 is reduced after miR-137 over -expression. [score:3]
With the over -expression of miR-137, thickened epithelium was observed in mammary placode region. [score:3]
The number of Ki67 -positive cells was counted in scramble and miR-137 over -expression group. [score:3]
Cell proliferation was reduced in the tumours formed by miR-137 over -expressing cells. [score:3]
This high level of expression in the 3 [rd] mammary gland forming region was confirmed by carrying out in situ hybridization using a miR-137 locked nucleic acid (LNA) probe to detect miR-137 transcripts (Supplementary Figure S1D). [score:3]
These results indicate that miR-137 have multiple tumour suppress function including prevention of the cell proliferation, epithelial invasion and EMT. [score:3]
Gata3 was observed in the flank mesenchyme besides the mammary bud (Figure 2F) extending both ventrally and dorsally after miR-137 over -expression (Figure 2H). [score:3]
In fact, in 3 of the mice injected with MDA-MB-231 cells over -expressing miR-137 no tumours formed at all. [score:3]
The tumours formed by miR-137 over -expressing cells were noticeably smaller than those formed by cells transfected with the scrambled miRNA (Figure 3A). [score:3]
In addition, ectopic Lef1 expression was observed in mesenchyme around mammary gland after miR-137 over-exrpression (Figure 2T). [score:3]
The area of CD31, VEGF, vWF and Runx3 expression in the scramble miRNA and miR-137 over -expression group was measured (n = 7 for each). [score:3]
The numbers of Ki67 -positive cells were 38.57 cells/100 × 100 μm and 14.14 cells/100 × 100 μm in scramble miRNA and miR-137 over -expressing group, respectively (Supplementary Figure S4E). [score:3]
Our results also showed that over -expression of miR-137 reduced tumour formation in vivo. [score:3]
Moreover, luciferase assay results indicate that Tac1, which confers a poor prognosis in breast cancer [14, 15], was the direct target of miR-137. [score:3]
It is not clear whether ERRα could be the target of miR-137 in the developing mouse mammary gland. [score:3]
Over -expression of miR-137 in in vitro organ culture and breast cancer cells. [score:3]
A., B. HE staining of sections of mammary glands that developed after miR-137 over -expression, shows that normal invasion has not taken place although the placode has thickened. [score:3]
Figure 2 A., B. HE staining of sections of mammary glands that developed after miR-137 over -expression, shows that normal invasion has not taken place although the placode has thickened. [score:3]
During cell culture (MDA-MB-231), miR-137 expressing lentiviral vector was transduced into cells. [score:3]
C., D. EGFP IHC indicates that scrambled miRNA and miR-137 have been successfully over-expressed. [score:3]
In addition, we found that angiogenesis was markedly reduced after miR-137 over -expression. [score:3]
Thus, these results showed that miR-137 can suppress tumour formation in vivo. [score:3]
Mammary gland tissue and MDA-MB-231 cells treated with the scrambled miRNA and miR-137 -expressing lentiviral vectors underwent lysis by sonication (Nextadvance) in radio-immunoprecipitation assay (RIPA) buffer (50 nM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100). [score:2]
In vivo tumour formation assay after miR-137 over -expressionRecent work has shown that miR-137 impairs proliferation and migration of MDA-MB-231 human breast cancer cells in culture [28]. [score:2]
MiR-137 induces p53 expression in mammary gland tissue and breast cancer. [score:2]
This is consistent with miR-206 having a function at a slightly earlier stage in mammary gland development than miR-137. [score:2]
Among these, the expression level of miR-137 was increased about 30 fold in the 3 [rd] mammary gland compared to inter mammary gland region (red box in Figure 1B). [score:2]
In vivo tumour formation assay after miR-137 over -expression. [score:2]
B. Tumour weight is markedly reduced after miR-137 over -expression C. as is tumour volume compared to controls. [score:2]
Runx3 expression region was increased in miR-137 treated group compared to control group (Figure 4Y). [score:2]
Function of miR-137 during mammary gland development. [score:2]
results indicate that Tac1, which confers a poor prognosis in breast cancer [14, 15], was the directly correlated to miR-137 (Figure 5D). [score:2]
Wild-type (WT) Tac1 reporters showed an inhibition of Renilla luciferase activity compared with the mutant reporter (Mut), with mismatched sequences inserted into the seed sequences of the predicted miR-137 binding site (Figure 5D). [score:2]
Relationship between miR-137 and mammary gland development. [score:2]
MiR-137 is also highly expressed in an epithelial cell line derived from the adult human breast. [score:2]
In order to investigate the relationship between miR-137 and breast tumour growth in vivo, MDA-MB-231 cells over -expressing miR-137 were inoculated subcutaneously (SC) in nude mice (n = 34) and formation of tumours were monitored 7 weeks later. [score:1]
Our functional analysis suggests that miR-137 is involved in modulating early stages of mammary gland formation in the embryo especially invasion. [score:1]
Recent work has shown that miR-137 impairs proliferation and migration of MDA-MB-231 human breast cancer cells in culture [28]. [score:1]
[1 to 20 of 95 sentences]
4
[+] score: 358
Figure 7miR-137 inhibits HCC growth and metastasis via targeting AKT2 in vivo(A-C) miR-137 inhibits tumour growth via targeting AKT2 in HCC. [score:9]
miR-612, down-regulated in metastatic HCC, targeting AKT2 via 3' UTR regions distinct from those of miR-137, suppressed the invasive-metastatic cascades [25]. [score:8]
The transcription factor FoxD3 induces the expression of miR-137, which subsequently inhibits the expression of AKT2. [score:7]
Ectopic expression of miR-137 inhibits tumour growth and metastasis in vivoWe further confirmed the inhibitory effects of miR-137 on HCC in vivo. [score:7]
In this study, we found that miR-137 expression was significantly down-regulated and associated with tumour metastasis and poor prognosis in HCC. [score:6]
Data of our miRNA array indicated the expression of miR-137 was down-regulated by 2.38-fold in HCC [16]. [score:6]
Collectively, our study provides experimental evidence that miR-137 suppresses cell growth and metastasis in HCC by directly targeting AKT2. [score:6]
Figure 2miR-137 inhibits HCC cell proliferation, migration and invasion in vitro(A) miR-137 re -expression was confirmed in SK-Hep1 and QGY-7703 cells using qRT-PCR. [score:5]
miR-137 inhibits HCC growth and metastasis via targeting AKT2 in vivo. [score:5]
The hsa-miR-137 mimic and control mimic (miR10000843), hsa-miR-137 inhibitor and control inhibitor (miR20000429) were purchased from Ribobio (Guangzhou, China). [score:5]
Consistent with this in vitro data, re -expression of AKT2 markedly reversed the suppression of tumour growth induced by miR-137 (Fig. 7A-B, Supplementary Fig. S6A-B and Supplementary Fig. S7A-D). [score:5]
Consistently, ectopic miR-137 expression dramatically suppressed colony formation (Fig. 2C). [score:5]
In TargetScan database, many components involving the AKT pathway are putative targets of miR-137, such as PI3KR3, TGFA and Twist1. [score:5]
Furthermore, over -expression of AKT2 rescued the inhibition of cell migration and invasion induced by miR-137 (Fig. 4D-F). [score:5]
miR-137 inhibitor is a chemically modified, single stranded nucleic acids designed to specifically bind to and inhibits endogenous miR-137 molecules. [score:5]
miR-137 suppresses cell proliferation and migration via the suppression of AKT2. [score:5]
In clinical samples, E-cadherin expression was lower, whereas vimentin level was higher in HCC patients with low miR-137 expression (Supplementary Fig. S2A). [score:5]
The inhibitory effect of tumour growth by miR-137 restoration, which can be abrogated by AKT2 overexpression, was also demonstrated using bioluminescence (Fig. 7C). [score:5]
Collectively, our data indicated that miR-137 suppressed cell proliferation and migration by suppressing AKT2. [score:5]
Ectopic expression of miR-137 inhibits tumour growth and metastasis in vivo. [score:5]
Aberrant epigenetic regulation of miR-137 promoter constitutes a key mechanism for miR-137 down-regulation [8]. [score:5]
In the present study, down-regulation of miR-137 was frequently observed in HCC tissues and may serve as an independent predictor for the outcome of HCC patients. [score:4]
AKT2 is a direct target of miR-137 in HCC. [score:4]
We also observed that miR-137 was down-regulated by P50 (NFκB1) in SK-Hep1 cells (data not shown). [score:4]
AKT2 is a direct target of miR-137. [score:4]
In our study, AKT2 was identified as a direct target of miR-137. [score:4]
Kaplan-Meier plots revealed that down-regulation of miR-137 was associated with unfavourable overall survival (Fig. 1F). [score:4]
Taken together, our data showed that miR-137 negatively modulated AKT2 expression by directly binding to its 3'UTR. [score:4]
To explore the regulation of miR-137 expression, we analysed the 1.5 kb region of miR-137 upstream. [score:4]
In this study, we found that miR-137 down-regulation was related with the invasive clinical features and unfavourable prognosis in HCC. [score:4]
In the present study, we demonstrated that miR-137 exerted inhibitory effects on HCC progression by regulating AKT/mTOR pathway. [score:4]
Down-regulation of miR-137 is associated with metastasis and poor prognosis in HCC. [score:4]
Moreover, the transcription factor FoxD3 regulated the expression of miR-137, which in turn affected the progression of HCC. [score:4]
miR-137 is frequently down-regulated in HCC and associates with poor outcome. [score:4]
The down-regulation of miR-137 was significantly correlated with vein invasion, incomplete Involucrum and distant metastasis (Supplementary Table 1). [score:4]
Cells stably expressing miR-137 were cultured with 400 μg/ml G418 for two weeks. [score:3]
Furthermore, the lung metastasis was markedly suppressed by miR-137 and FoxD3, as shown using bioluminescence and histological analyses (Fig. 7E). [score:3]
miR-137 expression was markedly reduced in HCC venous invasion (Fig. 1D). [score:3]
Our data indicated that miR-137 suppressed cell migration and invasion of HCC cells. [score:3]
revealed that both miR-137 and AKT2 siRNA induced a comparable inhibition of cell growth (Fig. 5B&C). [score:3]
Relationship between miR-137 expression and some well-known genes in HCC cells lines, such as paxillin and Met, have also determined in our study (Supplementary Fig. S9). [score:3]
The cell viabilities of HCC cells infected with miR-137 mimics were significantly inhibited (Fig. 2B). [score:3]
HCC cells were transfected with FoxD3 and an empty vector for 24 h. The related expression of FoxD3 (A), miR-137 (B) and AKT2 (C) were examined using qRT-PCR. [score:3]
AKT2 expression was decreased by miR-137 and AKT2 siRNA in SK-Hep1 and QGY-7703 cells (Fig. 5A). [score:3]
Given that miR-137 expression was associated with tumour metastasis in HCC patients, we next examined whether miR-137 could affect HCC cell migration and invasion. [score:3]
Liang et al. demonstrated that transcriptional factor HMGA1 influenced miR-137 expression in colorectal cancer [9]. [score:3]
Furthermore, miR-137 blocked AKT2 expression at both the mRNA and protein level (Fig. 3C-E). [score:3]
miR-137 inhibits proliferation and migration of HCC cells in vitroTo determine the biological function of miR-137 in HCC progression, we re-introduced miR-137 into SK-Hep1 and QGY-7703 cells. [score:3]
It should be of interest to study the potential synergistic inhibitory effects of combination of miR-612 and miR-137 on HCC progression. [score:3]
As shown by Figure 7D-E, re -expression of miR-137 and FoxD3 reduced the metastasis of HCC xenografts, which was remarkably rescued by AKT2. [score:3]
Briefly, oligonucleotides encoding shRNA with mature miR-137 sequences (Supplementary Table 6) were subcloned into the BamHI and EcoRI sites of a lentiviral expression vector PGLV3/H1/GFP+ puro (GenePharm Co. [score:3]
HCC patients who developed metastasis were with lower expression level of miR-137 (Fig. 1C). [score:3]
In human cancers, miR-137 can modulate the expression of a multitude of genes, including EZH2, FMNL2, and Paxillin [9, 23, 24]. [score:3]
Lentivirus with the miR-137 expression vector (pLV3-miR-137) and control vector were (pLV3-control) purchased from GenePharma (Shanghai, China). [score:3]
In contrast, miR-137 inhibition in SMMC-7721 and Bel-7402 cells remarkably increased cell proliferation and colony formation (Supplementary Fig. S1A-C). [score:3]
Furthermore, ectopic miR-137 expression repressed HCC proliferation and migration in vitro, and tumour growth and metastasis in vivo. [score:3]
However, AKT2 siRNA could mimic the suppression of cell migration and invasion induced by miR-137 in both HCC cells (Fig. 5D-F). [score:3]
The expressions of miR-137 were determined (Fig. 2A). [score:3]
We further confirmed the inhibitory effects of miR-137 on HCC in vivo. [score:3]
The newly identified FoxD3/miR-137/AKT2 signalling axis offers new insights into the pathogenesis of HCC and a potential therapeutic target for HCC treatment. [score:3]
We also showed that silencing of AKT2 resulted in similar phenotype induced by miR-137 expression in HCC cells. [score:3]
miR-137 inhibits proliferation and migration of HCC cells in vitro. [score:3]
miR-137 inhibits HCC cell proliferation, migration and invasion in vitro. [score:3]
Clinical patients were divided into two groups according to the median of miR-137 expression in HCC samples. [score:3]
Decreased expression of miR-137 in HCC was observed in 53.9% (62/115) of the cases (Fig. 1B). [score:3]
Western blot analysis showed that miR-137 over -expression resulted in decrease of p-AKT, p-mTOR, p-p70S6K, MMP2, and vimentin, but increase of E-cadherin (Fig. 2F and Supplementary Fig. S2B). [score:3]
Reintroduction of AKT2 abrogates miR-137 -induced suppression of HCC growth and metastasis. [score:3]
miR-137 -mediated loss of colony formation was also antagonised by forced expression of AKT2 (Fig. 4C). [score:3]
Our results also showed that miR-137 re -expression resulted in decrease of p-AKT, p-mTOR, p-p70S6K, MMP2, and vimentin, but increase of E-cadherin, indicating that miR-137 was involved in HCC EMT process. [score:3]
miR-137 is directly regulated by the transcription factor FoxD3. [score:3]
In this study, we demonstrated that transcriptional factor FoxD3 modulated miR-137 expression. [score:3]
miR-137 mimics/inhibitor was transfected into HCC cells at a final concentration of 100nM. [score:3]
Figure 5(A) AKT2 expression was silenced using AKT2 siRNA and miR-137 mimics. [score:3]
Results showed that miR-137 re -expression distinctly abrogated the migration and invasion of SK-Hep1 and QGY-7703 cells (Fig. 2D-E). [score:3]
Cells expressing miR-137 and/or AKT2 were cultured for 14 days. [score:3]
We next confirmed whether AKT2 could affect the inhibitory effect of miR-137 on HCC progression. [score:3]
To date, the mechanism of miR-137 deregulation and its regulatory networks in HCC remain elusive. [score:3]
To confirm the binding of miR-137 to the 3'-UTR of AKT2, we constructed vectors containing wild-type or mutant 3' UTR of AKT2 by directly fusing downstream of the firefly luciferase gene (Fig. 3A). [score:2]
Collectively, we demonstrated that miR-137 affected HCC progression via regulating EMT and AKT signalling pathways. [score:2]
Using 115 pairs of primary HCC, we found that the median of miR-137 expression was 3-fold lower, compared to the non-tumourous tissues (median is −1.8386 and −0.4844, respectively) (Fig. 1A). [score:2]
Figure 1(A, B) miR-137 expression was significantly decreased in HCC compared to the corresponding non-tumourous (NT) livers using qRT-PCR analyses. [score:2]
Compared with the control group, stable QGY-7703 and SK-Hep1 cells expressing miR-137 or FoxD3 generated tumours of lighter weight and smaller volume. [score:2]
Furthermore, miR-137 expression in HCC cell lines was significantly decreased compared with the normal liver tissues (Fig. 1E). [score:2]
Taken together, these findings suggested transcription factor FoxD3 as a functional regulator of miR-137 in HCC. [score:2]
MTT assays showed that reintroduction of AKT2 significantly abrogated the suppression of cell proliferation induced by miR-137 (Fig. 4B). [score:2]
We also demonstrated that the FoxD3/miR-137/AKT2 regulatory network played an important role in HCC progression. [score:2]
miR-137 expression was lower in HCC cell lines compared to normal liver (N [1]). [score:2]
miR-137 functions primarily as an anti-tumour miRNA and is dysregulated in multiple types of cancer, including head and neck cancer [8] and colorectal cancer [9]. [score:2]
Our data suggest AKT2 as a direct downstream mediator of miR-137 in HCC. [score:2]
A dual-luciferase reporter assay showed that transient expression of FoxD3 effectively stimulated transcription of miR-137 in QGY-7703 cells (Fig. 6E). [score:2]
Liang et al. reported that miR-137 was regulated by HMGA1 [9]. [score:2]
Compared to the control groups, liver metastatic nodules were significantly decreased in miR-137 and FoxD3 groups, but not in groups with AKT2 overexpression (Fig. 7D and Supplementary Fig. S7E-F). [score:2]
QGY-7703 cells were cotransfected with either miR-137 mimics or the negative control and psiCHECK2-AKT2-3'UTR-wt or psiCHECK2-AKT2-3'UTR-mut1-3. For the binding of FoxD3 to miR-137 promoter, the 1.5kb region directly upstream of miR-137 transcription binding site were amplified by PCR and inserted into the pGL3 vectors. [score:2]
Cells were transfected with miR-137 and AKT2 for specific time periods. [score:1]
We further characterised AKT2 as a novel functional target of miR-137. [score:1]
Our results suggested that miR-137 represses proliferation of HCC cells. [score:1]
For the binding of miR-137 to AKT2 3'UTR, the 3'UTR of AKT2 gene was amplified by PCR and inserted into the psiCHECK2 vector. [score:1]
Multivariate Cox regression analysis confirmed that miR-137 was an independent indicator for poor outcome (Supplementary Table 2). [score:1]
The values of miR-137 were presented by the log [2]-fold change (HCC/NT). [score:1]
Cells were seeded onto 96-well plates and transfected with miR-137 mimics for 5 days. [score:1]
A positive correlation of FoxD3 and miR-137 was also revealed in HCC fresh tissues (Fig. 6F). [score:1]
Interestingly, the basal levels of AKT2 in several HCC cell lines appeared to be reversely correlated with the endogenous levels of miR-137 (Supplementary Fig. S3B). [score:1]
1×10 [7] QGY-7703 cells stably infected with LV3-NC, LV3-miR-137, LV3-miR-137 plus pcDNA3.0-AKT2, pcDNA3.1-FoxD3, pcDNA3.1-FoxD3 plus pcDNA3.0-AKT2 vector, respectively named QGY-7703-control, QGY-7703-miR-137, QGY-7703-miR-137+AKT2, QGY-7703-FoxD3, QGY-7703-FoxD3+AKT2, were implanted into the flanks of male BALB/c-nude mice (n=6 per group, 3-4 weeks of age) subcutaneously. [score:1]
AKT2 silencing recapitulates the effects of miR-137 on HCC cells. [score:1]
Taken together, these results suggest miR-137 as a potential biomarker for prognostic predictor in HCC. [score:1]
To determine the biological function of miR-137 in HCC progression, we re-introduced miR-137 into SK-Hep1 and QGY-7703 cells. [score:1]
Cells transfected with miR-137 and/or AKT2 were transferred to transwell chambers in the absence (E) or presence (F) of Matrigel coating and incubated for 24 h. All * P < 0.05; ** P < 0.01. [score:1]
To construct the psiCHECK2-AKT2-3'UTR-wt plasmid, a wild-type 3'UTR segment of AKT2 mRNA containing the putative miR-137 binding sites was amplified and cloned into the XhoI and NotI sites downstream of the luciferase reporter gene in psiCHECK-2. psiCHECK2-AKT2-3'UTR-mut carries the mutated sequence in the miR-137 binding sites. [score:1]
QGY-7703 cells were cotransfected with either pcDNA3.1 or pcDNA3.1-FoxD3 and miR-137 promoter. [score:1]
Silencing of miR-137 in SMMC-7721 and Bel-7402 cells promoted the migration and invasion (Supplementary Fig. S1D-E). [score:1]
Virus particles were harvested 48 h after cotransfection of the pLV3-miR-137 or pLV3-control with lentivirus packing vector into HEK-293T cells. [score:1]
Mutant constructs in miR-137 binding sites of AKT2 3'UTR region were generated. [score:1]
Figure 6(A-C) Levels of FoxD3 mRNA, miR-137 and AKT2 mRNA were determined. [score:1]
CHIP assay was performed to demonstrate that FoxD3 could directly bind to the region of −1485 to −1496 in the miR-137 promoter (Fig. 6D). [score:1]
Our data suggest an important role of miR-137 in HCC progression. [score:1]
The HCC metastatic mo del was used to confirm the effect of miR-137 on HCC metastasis. [score:1]
An inverse correlation of miR-137 and AKT2 was observed in HCC tissues (Fig. 3F). [score:1]
FoxD3 -induced increase of miR-137 was confirmed in HCC cells (Fig. 6A-B and Supplementary Fig. S5E). [score:1]
[1 to 20 of 118 sentences]
5
[+] score: 355
In conclusion, our expression and functional studies suggested that the miR-137 is frequently down-regulated in gastric cancer may act as a tumor suppressor in GC cells, reintroducing expression of which on GC cells suppressed gastric cancer cell proliferation, migration and invasion by directly targeting AKT2. [score:15]
As the miR-137 in our study was upregulated thousands of times, it may lead to the inhibition of other targets such as Cdc42. [score:8]
Firstly, we detected the expression of miR-137 in 100 patients and found that the expression of miR-137 is significantly down-regulated in cancer sample. [score:8]
Obviously, in this study we cannot exclude the possibility that the tumor suppressor effects of miR-137 was mediated by suppressing other target genes. [score:7]
Chen et al revealed that the miR-137 may plays as a tumor suppressor by targeting CDC42 to regulate cell cycle in gastric cancer [17]. [score:6]
MicroRNA-137 (miR-137) has been reported to be down-regulated and play roles as a tumor suppressor in colorectal cancer and oral cancer [15, 16]. [score:6]
These data suggest that miR-137 directly recognizes the 3’-UTR of AKT2 mRNA and inhibits AKT2 translation. [score:6]
In hepatocellular carcinoma, miR-137 inhibits cancer cell growth and metastasis via directly targeting AKT2 [20]. [score:6]
Thus, down regulated miR-137 in gastric cancer inhibits the suppression of AKT2, which in turn decelerate tumorigenesis. [score:6]
The western blot demonstrated that the AKT2 protein level in AKT2 overexpression sample was apparently higher than that of the negative control even under the suppression of miR-137. [score:5]
These results demonstrated that miR-137 played important roles in regulating cell migration and invasiveness in gastric cancer and suggested that the down-regulation of miR-137 might contribute to tumor metastasis in gastric carcinogenesis. [score:5]
As the present study revealed that the expression of miR-137 was down-regulated in most of the GC tissues compared with adjacent tissues (77%), we could consider about the diagnosis and prognostic use of miR-137. [score:5]
When we chose the patients who have low expression of miR-137 in their GC tissue to detect the AKT2 protein expression, we found most of these patients(9/12) have high AKT2 level in their GC tissue. [score:5]
Overexpression of miR-137 inhibits gastric cancer cell proliferation. [score:5]
Overexpression of miR-137 inhibits gastric cancer cell migration and invasion. [score:5]
This rescue experiment provides further evidence that the In vivo experiments also demonstrated that the miR-137 expression is negatively relative to the AKT2 expression (S1D Fig and S1E Fig). [score:5]
This result demonstrated that the migration ability of lung cancer cells can be inhibited by miR-137 overexpression. [score:5]
Out of 100 GC samples, the expression of miR-137 was down-regulated in 77 cases (77%) compared with adjacent tissues when the cut off was set up as 1.5. [score:5]
This may due to that the AKT2 overexpression reversed the protein level miR-137 suppressed. [score:5]
However, the overexpression method leads to very high expression levels of miR-137 (Fig 2A). [score:5]
These result verified that the miR-137 overexpression can suppress tumor growth in vivo (*: p<0.05;**: p<0.01; ***: p<0.001). [score:5]
There were also three patients who have low expression of AKT2 in GC tissue though the expression of miR-137 is low. [score:5]
Then, we found that miR-137 acts as a tumor suppressor gene through targeting AKT2, which is a member of AKT family. [score:5]
miR-137 active cell apoptosis and negatively regulate cell invasion by targeting AKT2. [score:4]
We found that the expression of AKT2 protein was down regulated in miR-137 treated HGC-27 and SGC-7901 cells, but not in scramble or untreated cells (Fig 4D). [score:4]
As the expression of miR-137 in GC tissues was lower than that in adjacent tissues in statistically significant differences (p = 0.00079), we could speculate that this expression characteristic was associated with the cancer development. [score:4]
It has been reported that the miR-137 is a negative regulator of Cdc42 and by targeting which inducing apoptosis and cell cycle G1 arrest in gastric cancer cells [17]. [score:4]
Furthermore, we analysed the protein levels of AKT2 in 12 GC patientsin whom miR-137 was down-regulated. [score:4]
Meanwhile, miR-137 was up-regulated in 23 cases (23%) (Fig 1B and 1C). [score:4]
For example, miR-137 is a negative regulator of Cdc42 and by targeting which inducing apoptosis and cell cycle G1 arrest in gastric cancer cells [17]. [score:4]
AKT2 is experimentally validated as a direct target of miR-137. [score:4]
The relative expression of miR-137 was computed by 2-ΔΔCT method. [score:3]
A. miR-137 expression in HGC-27 cells and SGC-7901 cells 72 h post transfection. [score:3]
miR-137 and AKT2 expression after transfection. [score:3]
From these results, it can be concluded that miR-137 could suppress lung cancer cell survival by inducing early apoptosis. [score:3]
miR-137 targets AKT2 in GC. [score:3]
As shown in Fig 3C, the bioluminescent imaging of mice in the miR-137 overexpression group showed a much smaller image. [score:3]
However, even in this condition, there was about 23%of the cancers have high miR-137 expression. [score:3]
The patients who have the lower levels of miR-137 expression were associated with high-grade and late-stage tumors (Fig 1D). [score:3]
Also, we have found a statistically significant association between the expression of miR-137 and gastric cancer clinical stage. [score:3]
These results further confirmed that the miR-137 overexpression could limit the gastric cancer cell proliferation in vivo. [score:3]
The miR-137 expression level can keep on a high level during a long period after transfection both in gastric cancer cell lines, end-stage xenograft tumors and inmetastatic location in lungs (S1A Fig– S1C Fig). [score:3]
In fact, we e have screened 8 genes as potential targets of miR-137 (S1 Table). [score:3]
A. Real-time PCR was performed to detect the miR-137 expression in HGC-27 and SGC-7901 cells treated with miR-137 mimic or scramble mimic. [score:3]
The tumor in miR-137 overexpression group is much smaller than the scramble. [score:3]
MiR-137 is down-regulated in gastric cancer cells and clinical samples. [score:3]
Then the mice (female, Nu/Nu, 6 weeks old) were injected with HGC-27 cells with or without miR-137 overexpression through the tail vein with 2×10 [5] cells in PBS. [score:3]
To test the hypothesis that AKT2 might be a target of miR-137, a reporter plasmid harboring the wild-type 3’-UTR region of AKT2 downstream of the luciferase coding region (Fig 4A, AKT2_WT) was constructed. [score:3]
0130124.g005 Fig 5 A. AKT2 protein level was assessed in GC cells treated by overexpression of miR-137 and/ or AKT2. [score:3]
Scramble -transfected and miR-137 overexpression HGC-27 cells (5 × 10 [6] cells) were inoculated s. c. into the dorsal flanks of BALB/c nude mice (female, Nu/Nu, 6 weeks old), all of which were purchased from the Animal Centre of Henan University and raised in pathogen-free conditions. [score:3]
S1 Fig A. miR-137 expression in HGC-27 cells and SGC-7901 cells 72 h post transfection. [score:3]
B. miR-137 expression in the end-stage xenograft tumors. [score:3]
As expected, the inhibition of luciferase activity by miR-137 was partly removed with binding site 1 or binding cite 2 mutant and almost abolished in the AKT2_MUT double mutant, suggesting that the conserved region was fully responsible for miR-137 function (Fig 4B). [score:3]
In general, the expression of miR-137 in GC tissues was lower than that in adjacent tissues in statistically significant differences (p = 0.00079, paired t-test, two-tailed, Fig 1C). [score:3]
This result suggested that the miR-137 could target AKT2 in patients. [score:3]
C. Bioluminescentimaging (left) and the number of lung metastasis per mice (middle) showed that the miR-137 can suppress metastasis in vivo. [score:3]
Even so, it is clearly to us that the microRNA regulates biological behaviors by multiple path way that there could be more regulation mechanism of miR-137 toward GC tumorigenesis. [score:3]
C. Relative expression of AKT2 in HGC-27 and SGC-7901 cells not transfected or transfected with miR-137 mimics or scramble 24 hours. [score:3]
0130124.g002 Fig 2 A. Real-time PCR was performed to detect the miR-137 expression in HGC-27 and SGC-7901 cells treated with miR-137 mimic or scramble mimic. [score:3]
A. AKT2 protein level was assessed in GC cells treated by overexpression of miR-137 and/ or AKT2. [score:3]
We found that tumor growth was significantly slower in the miR-137 overexpression mice than in the controls (Fig 2D, 2E and 2G). [score:3]
Potential target genes of miR-137. [score:3]
These results showed that both the tumor volume and weight was significantly reduced by miR-137 overexpression. [score:3]
To further study the relationship of miR-137 with GC occurrence, we detected the expression of miR-137 in 100 clinical patients (male 56, female 44; mean age 53 years) by Taqman probe-drived real-time PCR as described above. [score:3]
B. AKT2 restoration leads to a suppression of apoptosis in GC cells while miR-137 promotes apoptosis. [score:3]
In agreement with the tumor growth curve, the weights of tumors induced by scramble cells were significantly higher than that by the miR-137 overexpression (Fig 2F). [score:3]
E. Expression levelsof miR-137 in I–II stages (n = 38) versusIII–IV stages (n = 62) of the gastric cancer patients. [score:3]
miR-137 +AKT2_oe” represents the cells co -transfected by miR-137 and AKT2 overexpression vector. [score:3]
C. miR-137 expression in metastatic localization of mice lungs. [score:3]
We found some other functions of miR-137 in GC as well as another path way by which miR-137 played a role of tumor suppressor in GC tumorigenesis. [score:3]
We first examined the expression of mature miR-137 in 4 human gastric cancer cell lines (HGC-27, SGC-7901, SGC-7901 and MKN-45) and gastric epithelial cell (GES-1). [score:3]
MiR-137 expression in 100 clinical patients. [score:2]
There might be specific regulation path way of miR-137 in SGC-7901 which repressed the phosphorylation status of AKT2. [score:2]
Also, the number of lung metastasis per mice in miR-137 group showed a significantly lower level compared to scramble group, which indicated that the miR-137 could suppress metastasis in vivo. [score:2]
MiR-137 inhibits cell proliferation in vitro and in vivo. [score:2]
0130124.g001 Fig 1 A. MiR-137 expression ingastric cancer cell lines (HGC-27, SGC-7901, SGC-7901 and MKN-45) and gastric epithelial cell (GES-1). [score:2]
It seems impossible that the miR-137 regulates the gastric cancer by the single pathway. [score:2]
The restoration of AKT2 causes the up regulation of AKT2 in miR-137 transfected cells, which is much higher than that in scramble. [score:2]
A. MiR-137 expression ingastric cancer cell lines (HGC-27, SGC-7901, SGC-7901 and MKN-45) and gastric epithelial cell (GES-1). [score:2]
MiR-137 expression in gastric cancer cells and clinical samples. [score:2]
The miR-137 has been demonstrated to be related to AKT2 regulation [19]. [score:2]
fWestern blot analysis of AKT2 protein level in 12 GC patients in whom miR-137 was down regulatedin their GC tissues. [score:2]
The apoptosis assays were tested in HGC-27 and SGC-7901 cells lines with or without miR-137 overexpression by Apoptosis Detection kit I (BD Biosciences, USA) and C6 Flow Cytometer (USA). [score:2]
When it was set higher, there could be fewer patients with miR-137 down regulated in cancer tissues. [score:2]
Thus, our works is a good supplement to the previous work and is helpful for us to understand the miR-137 regulation mechanism in cancer. [score:2]
MiR-137 inhibits cell migration and invasion in vitro and in vivo. [score:2]
This speculation was confirmed by in vitro and in vivo studies that the miR-137 can negatively regulate the cell proliferation, migration and invasion. [score:2]
These GC cell lines exhibited extraordinarily low expression of miR-137 compared to the GES-1 cell line (Fig 1A). [score:2]
S1 Table The potential target genes of miR-137 were predicted by on line software and detected by dual luciferase reporter gene assay and western bloting. [score:2]
We further detected its downstream effectors Bad and GSK-B. As a result, the p-Bad and p-GSK-B was obviously down regulated in miR-137 treated HGC-27 and SGC-7901 cells compared with scramble -treated or untreated cells. [score:1]
B. Luciferase activity of the AKT2_WT reporter and the AKT2_MUT reporter in the presence of 10 nmol/L of miR-137 mimic or scramble. [score:1]
There are only a few researches referring the role miR-137 played in gastric cancer. [score:1]
We have tried to find the relationship between miR-137 and patients’ age and sex, but no statistic result was found. [score:1]
As a result, miR-137 transfected cells showed a marked reduction (≈58%) of luciferase activity (Fig 4B). [score:1]
This high level of miR-137 may cause additional effects. [score:1]
D. Immunoblotting of AKT2 in HGC-27 and SGC-7901 cells not transfected or transfected with miR-137 mimic or scramble. [score:1]
A. SGC-7901 and HGC-27 cells were not transfected or transfected with miR-137 mimics or scramble for 24 hours, and wounds were made. [score:1]
In conclusion, we have identified a link between miR-137 and AKT2 that is a novel constituent of gastric cancer tumorigenesis. [score:1]
A. Sequence of the miR-137 binding sites within the human AKT2 3’-UTR and a schematic diagram of the reporter constructs showing the entire AKT2 3’-UTR sequence (AKT2_WT) and the mutated AKT2 3’-UTR sequence (M1, M2). [score:1]
B. Growth of HGC-27 and SGC-7901 cells was shown after transfection with miR-137 mimic or scramble mimic or no transfection. [score:1]
Our results confirmed the above speculation that the change of gastric cancer cell activities in condition of miR-137 -transfected cells could be a result of decreased phosphorylation of Bad. [score:1]
These results indicated that alterations of miR-137 could be involved in gastric cancer progression. [score:1]
We further assessed the effects of miR-137 on cell migration and invasion, which were the key determinants of malignant progression and metastasis. [score:1]
No significant difference was observed between miR-137–treated and scramble -treated or untreated HGC-27 and SGC-7901 cells (Fig 4C). [score:1]
Briefly, the about 5000 miR-137 mimic transfected cells and scramble cells were respectively seeded into 96-well plates and cultured. [score:1]
Both of two cell lines treated with miR-137 mimic were distinctively less migratory than scramble control or untreated cells at 12, 24, and 36 hours after scratching (Fig 3A). [score:1]
C. AKT2 restoration actives the apoptosis and invasion of GC cells while miR-137 showed opposite effects. [score:1]
Furthermore, we conducted cell invasion assay to measure the directional invasion abilities of the cells after miR-137 overexpression. [score:1]
As predicted, there was complementarity between has-miR-137 and AKT2 3’-UTR (Fig 4A). [score:1]
The artificial wounds were produced on the confluent cell monolayer with FBS free, using a 200 μL pipette tip at 24 hours post miR-137 transfection. [score:1]
0130124.g004 Fig 4 A. Sequence of the miR-137 binding sites within the human AKT2 3’-UTR and a schematic diagram of the reporter constructs showing the entire AKT2 3’-UTR sequence (AKT2_WT) and the mutated AKT2 3’-UTR sequence (M1, M2). [score:1]
We transfected miR-137 mimic into GC cell lines HGC-27 and SGC-7901, both of which showed great transfection efficiency (Fig 2A). [score:1]
However, the AKT2 is the only direct target of miR-137 after dual luciferase reporter gene assay and western blot investigation. [score:1]
The early apoptotic cells in the scramble group was about 10% in HGC-27 and 2.9% in SGC-7901, whereas after miR-137 transfection, the percentage of early apoptotic cells was increased to 17.5% in HGC-27 and 8.3% in SGC-7901, which showed significantly difference (Fig 2C). [score:1]
However, the function of miR-137 and its mechanism underlying gastric carcinogenesis are still not very clear. [score:1]
In Fig 5, “miR-137” represents the cells transfected by miR-137 and pcDNA 3.1 empty vector. [score:1]
0130124.g003 Fig 3 A. SGC-7901 and HGC-27 cells were not transfected or transfected with miR-137 mimics or scramble for 24 hours, and wounds were made. [score:1]
The miR-137 mimic and the scramble mimic which is non-homologous to the human genome were synthesized by GenePharma (Shanghai, China) and transfected into the cells to a final oligonucleotide concentration of 10nmol/L. [score:1]
[1 to 20 of 118 sentences]
6
[+] score: 294
Chi-square test was used to examine the significance of the differences in MSI1 expression in distant or adjacent normal mucosa, primary cancer and lymph node metastasis, as well as the correlation of MSI1 expression and miR-137 expression with clinicopathological variables. [score:7]
In summary, miR-137 inhibits clonogenic growth, supporting its predicted role as a tumor suppressor miRNA that reduces colon cancer stem cell properties, in part by directly down -regulating MSI1. [score:7]
In conclusion, our data suggest that miR-137 acts as a tumor suppressive miRNA and when down-regulated promotes tumorigenesis through the up regulation of MSI1. [score:7]
The expression of miR-137 did not statistically correlate with MSI1 expression in tissue samples (P = 0.54, Supplemental Table 6), although a clear trend is revealed in our patient data analysis and provides important precedence that analyzing more patients for the expression of MSI1 and miR-137 is needed in order to obtain statistical significance. [score:7]
To examine whether the miR-137 -induced cell growth inhibition was via MSI1 down-regulation, a phenotype rescue experiment was performed. [score:6]
Since MSI1 is overexpressed in the panel of colon cancer cell lines, we hypothesized that miR-137 is down-regulated. [score:6]
Collectively the data supports our hypothesis that miR-137 acts as a tumor suppressor miRNA by down -regulating the oncogenic MSI1 that subsequently leads to tumor growth inhibition. [score:6]
Alternatively, inhibiting endogenous miR-137 in HEK-293FT and HCT-116 using antagomiRs increased MSI1 protein expression (Figure 2C and 2D). [score:5]
As expected, miR-137 inhibited the luciferase expression of the MSI1 WT 3′UTR construct (P <. [score:5]
In order to determine which miRNAs negatively regulate MSI1 in colon cancer cell lines, miRNA mimics and a negative control (NC) mimic were transfected into high MSI1 expressing cell lines; HCT-116 and DLD-1. Exogenous expression of miR-137 reduced MSI1 protein levels compared to NC mimic in both HCT-116 and DLD-1 cell lines (Figure 1C). [score:5]
This observation strongly supports our results and overall hypothesis that in colon cancer, miR-137 expression is silenced during differentiation due to hyper-methylation, resulting in MSI1 over -expression. [score:5]
In conclusion, our results show that miR-137 expression is decreased in colon cancer cell lines and rectal cancer tissues, and supports our overall hypothesis that loss of miR-137 promotes the overexpression of MSI1 in colorectal cancer. [score:5]
miR-137 inhibits colon cancer growth and clonogenic growth by inhibiting MSI1. [score:5]
In vitro studies demonstrated that miR-137 over -expression decreases MSI1 expression, reduces cell growth, colony formation and tumorsphere growth. [score:5]
Taken together, the data suggests that in normal cells, MSI1 is negatively regulated by miR-137, possibly during differentiation, and this level of regulation has been dismantled in colorectal cancer cells, thus leading to the MSI1 overexpression. [score:5]
The expression of miR-137 in the tumor samples was normalized to RNU6b and set relative to the expression of miR-137 in normal mucosal samples. [score:5]
In this study, we show that miR-137 acts as a tumor suppressive microRNA, in part by negatively regulating MSI1 and subsequently Wnt and Notch signaling pathways. [score:4]
This data suggests that miR-137 tumor suppressive function is mediated in part by negatively regulating MSI1. [score:4]
Based on our preliminary data, we hypothesized that miR-137 acts as a tumor suppressor miRNA by negatively regulating MSI1. [score:4]
Correlating miR-137 expression with patient survival demonstrated that patients with decreased miR-137 had an increased hazard of death (HR = 0.61) as compared to patients with no change or increased expression of miR-137, although this did not reach statistical significance (P =. [score:4]
miR-137 mediated inhibition of cell growth was partially restored when HCT-116 cells were co -transfected with a MSI1 cDNA expression vector that lacks the 3′UTR as compared to cells co -transfected with an empty vector (Figure 4B). [score:4]
Overall, we describe an important tumor-suppressive mechanism of miR-137 through the negative regulation of MSI1 and Notch/Wnt signaling, outlined in our working mo del (Figure 7). [score:4]
Our work reveals a novel mechanism for MSI1 dysregulation in CRC and demonstrates miR-137 as a tumor suppressor miRNA. [score:4]
If miR-137 successfully knocks down MSI1 levels, we would expect an increase in MSI1 target genes, p21 and mNumb. [score:4]
miR-137 down-regulates Wnt and Notch signaling. [score:4]
miR-137 reduced MSI1 protein expression in a dose -dependent manner (Figure 2A). [score:3]
To study the effect of constitutively active miR-137 expression on tumor progression, HCT-116-miR-137 Tet-on stable clones were subcutaneously injected into flanking sides of athymic nude mice. [score:3]
The restoration of miR-137 expression in xenograft tumor mo dels also reduced tumor growth in vivo. [score:3]
miR-137 reduces tumor growth in vivoTo study the effect of constitutively active miR-137 expression on tumor progression, HCT-116-miR-137 Tet-on stable clones were subcutaneously injected into flanking sides of athymic nude mice. [score:3]
Expression of MSI1 and miR-137 in patient tumor samples. [score:3]
Normal human lung fibroblast cell line, WI-38, has similar miR-137 expression levels as the normal colon cell line, CCD-841. [score:3]
Additional colon cancer cell lines HT29 and HCT-116 β/W were used to validate our findings, both of which displayed reduced MSI1 protein expression in cells transfected with miR-137 mimic (Figure 1D). [score:3]
miR-137 restoration in colon cancer cell lines, reduces MSI1 mRNA and protein levels, and inhibits cell growth, colony formation and tumorsphere growth. [score:3]
miR-137 directly regulates MSI1. [score:3]
In non -transfected cells, colonies grew significantly less when miR-137 expression was induced using DOX (P =. [score:3]
For the cell growth rescue experiment, cells were co -transfected with miR-137 and NC mimics (50nM) and the MSI1-GFP/EV-GFP expressing constructs (1 μg) for 24 hours and re-seeded in a 24-well plate. [score:3]
Data are means ± SE; n = 3; *** P < 0.001. were conducted to determine whether miR-137 inhibits MSI1 via the MSI1 3′UTR. [score:3]
In summary, induction of miR-137 significantly inhibited the human colon cancer xenograft tumor growth. [score:3]
Furthermore, expressing miR-137 in HCT-116 significantly reduces xenografts tumor growth. [score:3]
miR-137 expression with overall survival was tested using Log-Rank and Cox proportional hazards regression analysis. [score:3]
We analyzed the expression of pre and mature-miR-137 in the same panel of colon cancer cell lines. [score:3]
miR-137 acts as a tumor suppressor miRNA in colon cancer. [score:3]
Previous studies have shown that miR-137 expression increases upon differentiation of neural stem cells [28, 29] and mouse embryonic stem cells [30]. [score:3]
As expected, miR-137 and MSI1 expression are inversely correlated in cell lines (P =. [score:3]
The mature miR-137 or NC mimic sequence was cloned into the Tet-inducible pTRIPZ expression vector (Dharmacon) according to manufacturer's instructions. [score:3]
We also examined the expression of MSI1 and miR-137 in available tissue samples from patients with rectal cancer. [score:3]
Tumors were excised at the end of the study to analyze the expression of miR-137 and MSI1. [score:3]
Figure 3(A) MSI1, mNumb and p21 protein expression was analyzed in HCT-116 cells transfected with miR-137 and NC mimics. [score:3]
Since miR-137 significantly decreased MSI1 protein expression in both HCT-116 and DLD-1 compared to the other mimics; we focused this study on understanding the miR-137 -mediated regulation of MSI1. [score:3]
miR-137 inhibits human colon cancer xenografts growth. [score:3]
Pre-miR-137 was normalized to GAPDH and mature miR-137 expression was normalized to RNU6b. [score:3]
Musashi-1 is over expressed and miR-137 is decreased in rectal cancer tissue samples. [score:3]
Similar to the previous animal study, the induction of miR-137 significantly inhibited colon cancer xenograft tumor growth by 55% (n=10, P <. [score:3]
In the tumor progression experiment, after the tumors reached approximately 50 mm [3] in size, mice were fed 1 mg/ml Doxycycline Hyclate (Sigma) in the drinking water to induce the expression of miR-137 or NC miRNA. [score:3]
Tet-inducible miR-137 HCT-116 cells were transfected with either a MSI1 cDNA expression plasmid or control vector, in the presence or absence of DOX. [score:3]
c-Myc mRNA (P = 0.0325) was slightly reduced in miR-137 treated DLD-1 cells; however there was no change in c-Myc protein expression in DLD-1 cells when treated with miR-137 (Figures 3C and 3D). [score:3]
Expression of mature miR-137 was analyzed using Taqman qRT-PCR, normalized to RNU48 and set relative to cells treated without DOX. [score:3]
To study the effect of constitutively active miR-137, Tet-inducible miR-137 HCT-116 stable cells were produced using a pTRIPZ lentiviral expression vector. [score:3]
We successfully identified miR-137 as a negative regulator of MSI1 in colon cancer cells. [score:2]
These stable clones are capable of inducing transcription of miR-137 when treated with doxycycline (DOX) to a physiological relevant level as compared to the expression of mature miR-137 in colon epithelial cell line, CCD-841 (Supplemental Figure S1). [score:2]
Both c-Myc and Hes-1 mRNA and protein expression were significantly reduced in miR-137 -treated HCT-116 cells compared to cells treated with NC mimic (P = 0.0003 and P <. [score:2]
In the current study, we show that miR-137 can regulate MSI1 in colon cancer cell lines. [score:2]
Additionally, miR-137 expression was significantly increased in the Tet-on miR-137 tumors compared to NC xenografts (P <. [score:2]
Figure 2(A) MSI1 protein expression in HCT-116 cells transfected with increasing concentrations of miR-137 mimic as compared to cells transfected with NC mimic. [score:2]
Since MSI1 is a regulator of intestinal multipotent stem cells [21], we predicted that miR-137 reduces clonogenic cell growth in colon cancer. [score:2]
miR-137 negatively regulates Notch and Wnt signaling in colon cancer cell lines. [score:2]
The protein expression of MSI1 was decreased in the miR-137 -treated tumors as compared to NC tumors (P =. [score:2]
Our data suggests that miR-137 reduces Wnt and Notch signaling pathways, in part by negatively regulating MSI1. [score:2]
In all five colon cancer cell lines examined, miR-137 expression was significantly decreased compared to the normal colon epithelial cell line, CCD-841 (Figure 1E). [score:2]
Luciferase reporter assays were conducted to determine whether miR-137 inhibits MSI1 via the MSI1 3′UTR. [score:2]
As expected, in miR-137 -transfected HCT-116 cells, mNumb and p21 protein expression is increased compared to cells transfected with NC mimic (Figure 3A). [score:2]
Our findings are consistent with a previous study that discovered miR-137 as a negative regulator of MSI1 in a glioblastoma cell mo del [16]. [score:2]
miR-137 expression was determined using Taqman microRNA assay and normalized to control small RNA, RNU6b. [score:2]
In summary, miR-137 restoration in colon cancer cell lines significantly reduced Wnt and Notch signaling; two important oncogenic signaling pathways regulated by MSI1 and involved in colorectal cancer progression. [score:2]
The expression of mature miR-137 was quantified using microRNA TaqMan® Assays (Life Technologies) and normalized to housekeeping small RNAs, RNU6b or RNU48 (Supplemental Table 7). [score:2]
Three nucleotides within the miR-137 seed sequence in the pSGG-MSI1-3′UTR construct were mutated using the QuikChange Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, United States). [score:2]
miR-137 negatively regulates MSI1. [score:2]
miR-137 mimic transfected HCT-116 cells grew significantly less than cells treated with NC mimic (P <. [score:1]
In vitro studiesmiRNA mimics, siRNAs, NC mimics, NC siRNA, miR-137 antagomiR and antagomiR-NC were purchased from Dharmacon (GE Dharmacon, Lafayette, CO, United States). [score:1]
HEK-293FT cells were co -transfected with MSI1 3′UTR luciferase reporter construct and miR-137 or NC mimic. [score:1]
0001), which was de-repressed by mutating the miR-137 seed sequence within the MSI1 3′UTR (Figure 2E). [score:1]
Cells were transfected with 200 ng of pSGG-MSI1 3′UTR luciferase construct and 20 nM miR-137 mimic or NC mimic using Lipofectamine 2000. [score:1]
0006) upon miR-137 restoration in HCT-116 cells (Figure 4E). [score:1]
The induction of miR-137 decreased tumor growth by approximately 75% (n = 8, P =. [score:1]
miR-137 was normalized to RNU6b and set relative to matching normal. [score:1]
An inverse correlation between miR-137 and MSI1 is revealed in a panel of colon cancer cell lines. [score:1]
HCT-116 stable clones with inducible miR-137 and NC miRNA were injected (0.5 × 10 [6]) into sub-cutaneous regions 5-6 week old, female athymic nude mice (Hsd:Athymic Nude-Foxn1 [nu], Harlan). [score:1]
miRNA mimics, siRNAs, NC mimics, NC siRNA, miR-137 antagomiR and antagomiR-NC were purchased from Dharmacon (GE Dharmacon, Lafayette, CO, United States). [score:1]
Among the three prediction programs, five overlapping miRNAs contained conserved, potential binding sites within MSI1 3′UTR; miR-125b, miR-137, miR-144, miR-185, and miR-342-3p (Figure 1B, Supplemental Table 1). [score:1]
miR-137 reduces tumor growth in vivo. [score:1]
miR-137 is a promising candidate for future miRNA -based molecular therapy for treating a variety of cancer types, including colorectal cancer. [score:1]
Briefly, cells were transfected with miR-137 and NC mimics, 24 hours later cells were re-seeded into a 96-well plate in triplicate. [score:1]
The absorbance of miR-137 -treated cells was set relative to cells treated with NC mimic. [score:1]
The number of colonies and tumorspheres grown in miR-137 treated cells was set relative to the number of tumorspheres grown in NC treated cells. [score:1]
Figure 4(A) Cell growth curve in HCT-116 cells transfected with miR-137 and NC mimic. [score:1]
In cancer, miR-137 has been shown to be decreased in glioblastoma [29, 31], melanoma [32], gastric cancer [33], and colorectal cancer [34- 36]. [score:1]
We also measured Wnt and Notch signaling target genes, c-Myc and Hes-1, in miR-137- and NC -treated HCT-116 and DLD-1 cells. [score:1]
), miR-137 mimic (miR-137), negative control mimic (NC), MSI1 siRNA (si-MSI1) and a negative control siRNA (si-NC). [score:1]
The expression of miR-137 was measured in 68 paired normal mucosal and primary tumor tissue samples using Taqman qRT-PCR. [score:1]
To control for DOX's effect on tumor growth, a separate animal experiment was performed using HCT-116 NC and miR-137 stable cells. [score:1]
Our data is consistent with previous studies that discovered loss of miR-137 occurs early in the progression of colon cancer due to hypermethylation of the promoter region [34], which prevents binding of the transcription factor, high-mobility group AT-hook (HMGA)1 [36]. [score:1]
Figure 5(A) Tet-on miR-137 HCT-116 cells were injected into subcutaneously into mice. [score:1]
miR-137 significantly reduced clonal expansion of HCT-116 cells (P <. [score:1]
Cells were treated with 0.25, 0.5 or 1 μg/ml of doxycycline (DOX) to induce the transcription of miR-137 in HCT-116. [score:1]
Furthermore, miR-137 decreased MSI1 mRNA levels more than cells transfected with NC mimic (P <. [score:1]
According to our results, loss of miR-137 appears to be at the transcriptional level since both pre and mature forms of miR-137 were decreased in colon cancer cell lines. [score:1]
Cells were transfected with 200 ng of TOP or FOP Flash constructs and 20 nM miR-137 mimic or NC mimic using Lipofectamine 2000. [score:1]
[1 to 20 of 107 sentences]
7
[+] score: 286
Our studies showed, for the first time to the best of the authors' knowledge, that miR-124 and miR-137: (1) are expressed at significantly lower levels in GBM tumors relative to non-neoplastic brain tissue; (2) are up-regulated during neuronal differentiation of adult mNSCs induced by growth factor withdrawal; (3) promote neuronal-like differentiation of growth-factor-deprived mNSCs, mOSCs and hGSCs; (4) promote G0/G1 cell cycle arrest in GBM cells and growth-factor-deprived hGSCs; (5) inhibit expression of CDK6 mRNA, CDK6 protein and phosphorylated RB in GBM cells. [score:10]
It remains unclear why miR-124 and miR-137 were not detected previously in GBM tumors, particularly in light of our results that show dramatic expression decreases of miR-124 and miR-137 in GBMs (and AAs) relative to non-neoplastic brain tissue, and results that show clear down-regulation of miR-124 expression in human oligodendrogliomas [28], human astroblastomas [32] and GBM cell lines [32, 33]. [score:8]
CDK6 is an established target of miR-124 in HCT-116 colon cancer cells [26], a predicted target of miR-137 (TargetScan and PicTar), and has been functionally implicated in the development of multiple malignancies. [score:8]
We tested, therefore, whether expression of miR-124 and miR-137 could be activated in GBM cell lines following treatment with 5-aza-2'-deoxycytidine (5-aza-dC), a DNA methylation inhibitor and/or TSA, a histone deacetylase inhibitor. [score:7]
miR-124 and miR-137 are down-regulated in high-grade gliomas and up-regulated during adult NSC differentiation. [score:7]
Overexpression of miR-124 or miR-137 also reduced the expression of phosphorylated RB (Figure 6B), a downstream target of CDK6 [30]. [score:7]
Our studies revealed that miR-137, as well as miR-124, inhibited expression of CDK6, a predicted target of both miRNAs. [score:7]
Figure 1 miR-124 and miR-137 are down-regulated in anaplastic astrocytomas and glioblastoma multiformes and are up-regulated in glioblastoma multiforme cell lines following treatment with DNA demethylating agents. [score:7]
MiRNA-124 is down-regulated in human oligodendrogliomas [28], and both miR-124 and miR-137 are down-regulated over 10-fold in S100β-v- erbB tumor stem cells relative to mNSCs (Additional file 7). [score:7]
Expression of miR-124 and miR-137, respectively, increased up to 8- and 24-fold, expression of miR-129 and miR-139, respectively, decreased up to 2- and 4-fold, and expression of miR-7 and miR-218 did not change appreciably. [score:7]
The second mechanism by which miR-124 and miR-137 expression may be suppressed in GBM stem cells is via epigenetic modification of their transcriptional regulatory sequences. [score:6]
As we observed that expression of miR-124 and miR-137 is reduced in HGAs and that miR-124 and miR-137 promote differentiation of non-neoplastic adult mNSCs, we tested next whether up-regulation of miR-124 and miR-137 could promote differentiation of brain tumor-derived stem cells. [score:6]
Expression of microRNA-137 was increased 3- to 12-fold in glioblastoma multiforme cell lines U87 and U251 following inhibition of DNA methylation with 5-aza-2'-deoxycytidine (5-aza-dC). [score:5]
These results suggest that targeted delivery of microRNA-124 and/or microRNA-137 to glioblastoma multiforme tumor cells may be therapeutically efficacious for the treatment of this disease. [score:5]
Given that activation of EGF [37], PDGF [38] and FGF [39] signaling pathways have each been implicated in gliomagenesis, it is reasonable to speculate that one mechanism by which growth factor signaling promotes brain tumor formation is through suppression of miR-124 and/or miR-137 expression and NSC/TSC differentiation. [score:5]
Our differentiation studies in mNSCs suggested that growth factor signaling, which is recurrently activated in HGAs, suppresses expression of miR-124 and miR-137. [score:5]
These results suggest that targeted delivery of miR-124 and/or miR-137 to GBM tumor cells may be therapeutically valuable for GBM disease treatment. [score:5]
Figure 6 CDK6 expression is inhibited by miR-124 and miR-137 in glioblastoma multiforme cells. [score:5]
miR-124 and miR-137 inhibit CDK6 expression and phosphorylated retinoblastoma levels in GBM cells. [score:5]
To validate that the 3' UTR of CDK6 is a direct target of miR-137, we used a luciferase reporter system in which the predicted miR-137 binding site of CDK6 was cloned downstream of luciferase. [score:4]
To test whether up-regulation of miR-124 and miR-137 promote differentiation of adult mNSCs, we transfected proliferating mNSCs with double-stranded RNA oligonucleotides corresponding to the mature sequences of each miRNA. [score:4]
Therefore, miR-137, in addition to miR-124, is a direct inhibitor of CDK6. [score:4]
To ascertain the molecular mechanisms by which miR-124 and miR-137 induce G0/G1 cell cycle arrest in GBM cells, we assessed expression of CDK6, a regulator of the cell cycle and differentiation (reviewed in [29]), following transfection of these miRNAs to U251 cells. [score:4]
Of the 35 miRNAs, we identified six HGA-miRNAs, which were down-regulated in both AA and GBM tumors at a more stringent degree of significance (P < 0.01): miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218. [score:4]
It is interesting to note that CDK6 is known to regulate both cell cycle progression and differentiation (reviewed in [29]), suggesting that mir-124- and miR-137 -mediated inhibition of CDK6 may, in part, account for the observed effects on GBM cell proliferation and differentiation in this study. [score:4]
We identified six miRNAs of particular interest, miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218, which were down-regulated in both AAs and GBMs (Figure 1A, Additional file 8 and Table 1) at a more stringent level of significance (P ≤ 0.01). [score:4]
Further, as with miR-124a (see [26]), our results show that miR-137 is a direct inhibitor of CDK6. [score:4]
Mutation of the CDK6 miR-137 seed region rendered the reporter construct insensitive to inhibition by miR-137 (Figure 6D). [score:4]
Regulation of miR-124 and miR-137 expression. [score:4]
The ability of miR-124 and miR-137 to induce potent antiproliferative and prodifferentiation effects in CD133+ and CD133- human GBM cells suggests their potential value for treatment of this disease. [score:3]
Assessment of miR-124a and miR-137 expression in mouse oligodendroglial stem cells. [score:3]
Transfection of microRNA-124 or microRNA-137 induced morphological changes and marker expressions consistent with neuronal differentiation in mouse neural stem cells, mouse oligodendroglioma-derived stem cells derived from S100β-v- erbB tumors and cluster of differentiation 133+ human glioblastoma multiforme-derived stem cells (SF6969). [score:3]
Figure 5 miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme stem cells and induce cell G0/G1 cycle arrest. [score:3]
pMIR-REPORT vectors harboring CDK6-3'UTR sequences with wild type (WT) miR-137 binding sites or mutated (MUT) miR-137 binding sites were generated by cloning the following oligonucleotides into the HindIII and SpeI restriction sites of pMIR-REPORT: CDK6-UTR-WT fw 5'-AGCTTGATCACAGAAATATTGCTAGCTGATACATATTATTGCATTTCATAAAACTA CDK6-UTR-WT rv 5'-CTAGTAGTTTTATGAAATGCAATAATATGTATCAGCTAGCAATATTTCTGTGATCA CDK6-UTR-MUT fw 5'-AGCTTGATCACAGAAATTAACGAAGCTGATACATATTATTGCATTTCATAAAACTA CDK6-UTR-MUT rv 5'-CTAGTAGTTTTATGAAATGCAATAATATGTATCAGCTTCGTTAATTTCTGTGATCA Cells were transfected with (1) miR-137 or cel-miR-67 -negative-control mimics (50 nM), (2) pMIR-REPORT vectors containing WT or MUT miR-137 binding sites (400 ng) and (3) pRL-SV40 (Promega) expressing Renilla luciferase (400 ng) for normalization. [score:3]
Further analyses are required to determine the relative contributions of EGF-, FGF- and PDGF -induced signaling on suppression of miR-124 and miR-137 transcription in adult NSCs and GBM tumor stem cells. [score:3]
Further analyses of miR-137 and miR-124 promoter sequence methylation in primary tumors, TSCs and NSCs are warranted to establish the degree to which epigenetic mechanisms contribute to suppression of these miRNAs in HGAs. [score:3]
Levels of phosphorylated retinoblastoma (RB) (pSer 807/811), a known target of CDK6 [30], were also reduced in response to miR-124 and miR-137 transfection (Figure 6B). [score:3]
The first mechanism is growth factor signaling: removal of EGF, and FGF from the culture media resulted in robust increases in miR-124 and miR-137 expression in adult NSCs. [score:3]
Our results reveal two potential mechanisms by which miR-124 and miR-137 may be suppressed in stem cells and/or tumor cells. [score:3]
We observed that the majority of the HGA-miRNAs show expression changes during, or have been implicated in, differentiation of various cell lineages: miR-7 during photoreceptor differentiation [23]; miR-124 and miR-137 during erythropoiesis [24]; miR-124 and miR-218 during neuronal differentiation of embryonal carcinoma cell differentiation [25]; miR-124 during neuronal differentiation of ES cells [12]. [score:3]
Thus, overexpression of miR-124 and miR-137 enhances neuronal-like differentiation of adult NSCs in vitro. [score:3]
To further investigate the role of miR-137 in neuronal differentiation of GBM cells, we assessed expression of an additional neuronal marker, MAP2, following overexpression of miR-137. [score:3]
Click here for file Assessment of miR-124a and miR-137 expression in mouse oligodendroglial stem cells. [score:3]
Consistent with our observations in mNSCs, we observed a significant increase in the numbers of cells that express the neuronal marker Tuj1 following transfection with miR-124, miR-137 or a combination of both miRNAs (Figure 4A). [score:3]
Our studies revealed that expression levels of microRNA-124 and microRNA-137 were significantly decreased in anaplastic astrocytomas (World Health Organization grade III) and glioblastoma multiforme (World Health Organization grade IV) relative to non-neoplastic brain tissue (P < 0.01), and were increased 8- to 20-fold during differentiation of cultured mouse neural stem cells following growth factor withdrawal. [score:3]
We observed that miR-137 expression increased in GBM cell lines U87 and U251 following treatment with the DNA demethylating agent 5-aza-dC (Figure 1B). [score:3]
miRIDIAN miRNA mimic negative control (cel-miR-67) and miRIDIAN miRNA mimics (mmu-miR-124, mmu-miR-137) were purchased from Dharmacon (Lafayette, CO) and validated using the pMIR-REPORT miRNA Expression Reporter Vector System (Ambion, Austin, TX). [score:3]
While this does not change our conclusions that miR-124 and miR-137 can induce mNSC-, mOSC- and human GBM-derived stem cell (hGSC)-differentiation, it indicates that in situ expression analyses of miRNAs in HGAs, non-neoplastic adult brain tissue, and during fetal- and post-natal development of the mammalian central nervous system will be an important component of studies aimed at investigating the functions of miRNAs during normal brain development and tumorigenesis. [score:3]
Transfection of microRNA-124 or microRNA-137 also induced G1 cell cycle arrest in U251 and SF6969 glioblastoma multiforme cells, which was associated with decreased expression of cyclin -dependent kinase 6 and phosphorylated retinoblastoma (pSer 807/811) proteins. [score:3]
Our results indicate that overexpression of either miR-124 or miR-137 promotes neuron-like differentiation of non-neoplastic adult (mNSCs), mOSCs and CD133+ hGSCs. [score:3]
miR-124 and miR-137 inhibit proliferation of GBM cell lines. [score:3]
Overall, the most robust effects of miR-124 and miR-137 overexpression on cellular differentiation and proliferation were observed in growth factor-deprived human cells (Figures 4B and 5B). [score:3]
Although we restricted further analyses of these six miRNAs to miR-124 and miR-137 because of their elevated expression during adult NSC differentiation (Figure 1B), assessments of the other HGA-miRNAs may lead to novel insights into the biology of high-grade gliomas. [score:3]
Since exit from the cell cycle is required for induction of differentiation, we tested whether miR-124 and miR-137 inhibit proliferation of GBM cells. [score:3]
Our results show that miR-124 and miR-137 can induce neuronal differentiation of OSCs and GBM stem cells and inhibit proliferation of GBM cell lines. [score:3]
A total of 100 nM miRIDIAN miRNA mimics (50 nM each for miR-124 and miR-137 co-transfections) were complexed with LipofectAMINE 2000 (Invitrogen) and added directly to cells growing in proliferating medium. [score:2]
Regulation of differentiation and the cell cycle by miR-124 and miR-137. [score:2]
MiRNA-137 expression increased up to 8-fold in GBM cell lines treated with 5-aza-dC, and up to 12-fold in cells treated with both 5-aza-dC and TSA (Figure 1B and Additional file 8). [score:2]
These data suggest that epigenetic modification of regulatory sequences in CpG islands may contribute to miR-124 and miR-137 silencing in GBMs. [score:2]
Further investigations are needed to define the relationship between CDK6 down-regulation and cell cycle arrest and/or differentiation in GBM stem cells, and to identify and characterize additional miR-124 and miR-137 target genes. [score:2]
miR-124 and miR-137 promote neuronal differentiation of adult NSCs. [score:1]
Our studies show that miR-124 and miR-137 enhance neurogenesis of mNSCs, mOSCs and hGSCs in the absence of growth factor signaling. [score:1]
Unsorted SF6969 GBM cells were transfected with miR-137 and cultured for 10 days in NBE media without growth factors. [score:1]
Transfection with either miR-124 or miR-137 resulted in rounded or trapezoidal cellular morphology of Tuj1 -positive cells with reduced neuritic outgrowth. [score:1]
Cells were transfected with miR-124 and/or miR-137 (100 nM) or a negative control oligonucleotide for 4 hours using lipofectamine. [score:1]
Further testing of miR-124 and miR-137 in pre-clinical mo dels of GBM [52, 53] in conjunction with various delivery strategies will help define their ultimate therapeutic potential for treatment of GBM. [score:1]
Levels of phosphorylated RB (pSer 807/811) are also markedly reduced in response to miR-124 or miR-137 transfection. [score:1]
In addition to the expected increase of cells positive for Tuj-1 after 10 days, we also observed an evident increase in MAP2-postive cells following transfection of miR-137 (Figure 4C). [score:1]
miR-124 and miR-137 promote neuronal differentiation of brain TSCs. [score:1]
We also observed that transfection of miR-124 and miR-137 reduced the numbers of GFAP -positive mOSCs (Figure 4A). [score:1]
Collectively, our results suggest that while miR-124 and miR-137 have the capacity to induce alone cell cycle arrest and differentiation in human GBM cells and stem cells, abrogation of growth factor signaling enhances their capacity to do so. [score:1]
Figure 3 miR-124 and miR-137 promote neuronal differentiation of subventricular zone-neural stem cells. [score:1]
Relative to control oligonucleotides, transfection of miR-124 or miR-137 resulted in a marked reduction in the number of cells in the S-phase of the cell cycle and a marked increase in the number of cells in G0/G1 in U251 GBM cells (Figure 5A) and early passage GBM cells derived from a newly diagnosed human GBM (Figure 5B). [score:1]
Distinct morphological changes were also apparent for each miRNA; miR-124 induced neuritic branching of the cells whereas miR-137 induced a rounded or trapezoidal cellular appearance with no neuritic outgrowth (Figure 3A and 3B). [score:1]
Figure 4 Induction of neuronal differentiation of tumor-derived neural stem cells by miR-124 and miR-137. [score:1]
Finally, transfection of miR-124, but not miR-137, resulted in a 2-fold decrease in the numbers of GFAP -positive cells (Figure 3A and 3C). [score:1]
A control reporter vector was also developed in which the seed region of the miR-137 binding site was mutated (Figure 6C). [score:1]
We also identified a number of miRNAs, including miR-124 and miR-137, which have not been described in prior GBM profiling studies. [score:1]
However, cell cycle arrest was more pronounced in miR-124- and miR-137 -transfected GBM cells (SF6969) that were deprived of growth factors (Figure 5B). [score:1]
microRNA-124 and microRNA-137 induce differentiation of adult mouse neural stem cells, mouse oligodendroglioma-derived stem cells and human glioblastoma multiforme-derived stem cells and induce glioblastoma multiforme cell cycle arrest. [score:1]
Therapeutic potential of miR-124 and miR-137. [score:1]
Although we have not tested whether miR-124 and miR-137 alone can induce differentiation of the various stem cells tested in this study, transfection of miR-124 or miR-137 alone was sufficient to induce G1 cell cycle arrest in standard GBM cell lines (Figure 5A). [score:1]
These results suggest that miR-124 and miR-137 may be useful therapeutic agents for the treatment of GBMs. [score:1]
Transfection of miR-124 and/or miR-137 dramatically increased the percentage of Tuj1 -positive cells, and reduced the percentage of GFAP -positive cells and in both CD133+ and CD133- GBM cell fractions (Figure 4B). [score:1]
Our data suggest that miR-124 and miR-137 induce G0/G1 cell cycle arrest in GBM cells. [score:1]
Transfection of either miR-124 or miR-137 resulted in a 5-fold increase in the numbers of cells stained with the neuronal marker Tuj1 relative to controls (Figure 3A, B and 3C). [score:1]
Mutated bases (underlined) were also introduced into the miR-137 seed region (boxed) of the cyclin -dependent kinase 6-3'UTR (mutated). [score:1]
was conducted by fluorescence-activated cell sorter at 48 hours after transfection of 100 nM (final total microRNA concentration) miR-124, miR-137, miR-124 and miR-137 together or negative control oligonucleotides (neg#1, neg#2) to U251 (A) and SF6969 (B) glioblastoma multiforme cells. [score:1]
Further, miR-137 is closely associated with a large CpG island [27], suggesting that it may also be epigenetically silenced in tumors. [score:1]
Again, as in mNSCs and oligodendroglioma tumor spheres, miR-137 induced rounded morphology with little evidence of neuritic outgrowth (Figure 4C). [score:1]
Both CD133+ and CD133- cells were transfected with miR-124 and/or miR-137 and then cultured for 10 days in NBE media without growth factors. [score:1]
Co-transfection of U251 cells with a WT CDK6-3'UTR (CDK6-WT) reporter and the miR-137 mimic resulted in a significant decrease in luminescence (P < 0.0001) relative to cells co -transfected with CDK6-WT and a negative control miRNA mimic (Figure 6D). [score:1]
In independent experiments we observed marked reductions of CDK6 transcript (Figure 6A) and CDK6 protein (Figure 6B) in response to miR-124 and miR-137 transfection. [score:1]
The inset shows a Tuj1+ cell with neuronal morphology from a miR-124 and/or miR-137 cotransfection. [score:1]
Collectively, our results show that in the absence of growth factor signaling, miR-124 and miR-137 enhance neuron-like differentiation of oligodendroglial and GBM TSCs. [score:1]
We tested next whether miR-124 and miR-137 could promote differentiation of human GBM stem cells. [score:1]
[1 to 20 of 96 sentences]
8
[+] score: 264
Here, we observed that the expression levels of p-AKT, HIF-1α and VEGF in miR-137 -expressing lung cancer cells were both downregulated, but elevated in miR-137 -inhibitor expressing lung cancer cells (Figure 5C, 5D). [score:12]
The expression levels of miR-137 were significantly lower in WHO stage III-IV NSCLC tissues than those in stage I and stage II, indicating that miR-137 expression was greatly down-regulated in late stages of lung cancer cancer tissues (Figure 1B). [score:8]
The expression levels of phosphorylated AKT (p-AKT) and HIF-1α were decreased in A549/PTX and A549/CDDP cells with miR-137 overexpression, but increased in A549 cells with miR-137 inhibitor, while AKT and protein levels were not changed. [score:7]
The expression levels of VEGF were decreased in A549/PTX and A549/CDDP cells with miR-137 overexpression, but increased in A549 cells with miR-137 inhibitor. [score:7]
To fully understand the mechanisms of miR-137 in lung cancer, TargetScan search program was used to predict targets of miR-137, which NUCKS1 has been thought to be putative target of miR-137 (Figure 5A). [score:7]
The results showed that the activity of cell growth in A549 cells were enhanced when inhibition of miR-137 expression compared with A549 cells expressing miR-NC (Figure 3A). [score:6]
Then, western blotting analysis was conducted to measure the levels of NUCKS1 protein, we found that the expression of NUCKS1 protein was downregulated in miR-137 treated cells, but increased in cells transfected with miR-137 inhibitor (Figure 5C). [score:6]
Down-regulation of miR-137 expression in tumor tissues of human lung cancer patients. [score:6]
NUCKS1 is a direct target of miR-137, and is elevated in human lung cancer tissues, which is inversely correlated with miR-137 expression levels. [score:6]
The results showed that patients with low miR-137 expression levels had a shorter disease free survival (DFS) compared with patients with high miR-137 expression (Figure 1C). [score:6]
Kaplan-Meier survival analysis and log-rank test were used to assess the normalized miR-137 expression levels (tumor/normal) and Disease free survival (DFS). [score:5]
The expression level of miR-137 is downregulated in the lung cancer resistant cells strains: A549/PTX and A549/CDDP when compared with lung cancer A549 cells. [score:5]
Among them, miR-137 has been demonstrated to function as a tumor suppressor, and loss of miR-137 expression has been reported in many cancer types, including myeloma, hepatocellular carcinoma, colorectal cancer, lung cancer and glioma [14– 18]. [score:5]
Moreover, we found that overexpression of miR-137 inhibited cell proliferation, migration, induced apotosis and arrested the cell cycle in G1 phase in A549/PTX and A549/CDDP; repression of miR-137 signifcantly promoted cell growth, migration, cell survival and cell cycle G1/S transition in A549 cells. [score:5]
Moreover, inhibition of miR-137 expression promoted cell survival by and cell cycle G1/S transition by Cell Cycle analysis, respectively (Figure 3C, 3D). [score:5]
After cultured overnight, cells were cotransfected with the wild-type or mutated plasmid, pRL-TK plasmid, and equal amounts of miR-137 mimics, miR-NC, and miR-137 inhibitors or miR-NC inhibitors, respectively. [score:5]
Overexpression of miR-137 in A549/PTX and A549/CDDP cells inhibited cell proliferation, migration, induced cell apoptosis, arrest the cell cycle in G1 phase and reversed drug resistance to PTX and CDDP in A549/PTX and A549/CDDP cell lines respectively. [score:5]
In this study, we found that the expression of miR-137 is downregulated in lung cancer samples compared with adjacent normal tissues. [score:5]
miR-137 -inhibitor dramatically inhibited the normally strong migration capacity of lung cancer cells (Figure 3B). [score:5]
To reveal the molecular mechanisms of miR-137 in tumor growth, total RNAs were extracted to perform qPCR analysis and found that the expression levels of VEGF, a key angiogenic regulator in both tumorigenesis and angiogenesis, were differentially regulated in these 2 groups of tumors (Figure 5C, 5F). [score:5]
These results suggest that miR-137 inhibits PI3K/AKT pathways via targeting NUCKS1. [score:5]
To further evaluate the correlation between miR-137 expression levels and prognosis in NSCLC patients, we used Kaplan-Meier survival analysis and log-rank test to assess the normalized miR-137 expression levels (tumor/normal) and Disease free survival (DFS). [score:5]
Overexpression of miR-137 in A549/PTX and A549/CDDP cells inhibited cell proliferation, migration, induced cell apoptosis and arrest the cell cycle in G1 phase and reversed drug resistance to PTX and CDDP in A549/PTX and A549/CDDP cell lines respectively. [score:5]
Thus, our results suggest that overexpression of miR-137 in A549/PTX and A549/CDDP cells inhibited cell proliferation, migration, induced cell apotosis, arrest the cell cycle in G1 phase and reversed drug resistance to to PTX and CDDP in A549/PTX and A549/CDDP cell lines respectively. [score:5]
Our study is the first to identify the tumor suppressive role of overexpressed miR-137 in chemosensitivity. [score:5]
Then, we will ask several important questions in this study: (1) what are the roles of miR-137 in lung cancer growth; (2) what are the roles of miR-137 in A549, A549/PTX and A549/CDDP cells; (3) what is the potential direct target of miR-137 that may be associated with cancer development; and (4) What role of miR-137 in chemoresistance of lung cancer in vivo. [score:5]
We tested the expression levels of miR-137 in 50 pairs of non-small cell lung cancer(NSCLC) tumor specimens and adjacent normal tissues, and found that miR-137 expression levels in tumor tissues were significantly lower than those controls (Figure 1A). [score:5]
The results showed that cell growth were attenuated in miR-137 -overexpressing lung cancer cells compared with lung cancer cells expressing miR-NC (Figure 4B). [score:4]
In the present study, we demonstrated that miR-137 was downregulated in 50 pairs human lung cancer specimens. [score:4]
Over the past few years, it has been shown that the miR-137 was downregulated in different tumors such as hepatocellular carcinoma, colorectal cancer, lung cancer and glioma. [score:4]
These results suggest that miR-137 directly targets NUCKS1 by binding its seed region to their 3′-UTRs in lung cancer cells. [score:4]
Recent studies have been reported that miR-137 plays a potential role as a tumor suppressor in many kinds of cancers. [score:3]
Interestingly, the expression levels of miR-137 in lung cancer A549 cells were higher than resistant cells strains: A549/PTX and A549/CDDP (Figure 2B). [score:3]
Then, we determine the correlation between NUCKS1 levels and miR-137 expression levels in the same human lung cancer specimens. [score:3]
Restoration of miR-137 expression has been shown to abrogate tumorigenesis. [score:3]
In addition, miR-137 inhibitor induced luciferase activity in NUCKS1 3′-UTR (WT) reporter constructs. [score:3]
As shown in Figure 5F, Spearman's rank correlation analysis showed that the expression levels of NUCKS1 and miR-137 in 50 human lung cancer specimens were inversely correlated (Spearman's correlation r = −0.6468). [score:3]
To study the role of miR-137 in lung cancer carcinogenesis, A549 cells transfected with miR-137 -inhibitor were used to analyze cell growth. [score:3]
We further found that inhibition of miR-137 could render resistance to PTX and CDDP in A549 cell lines (Figure 3E). [score:3]
A549/PTX and A549/CDDP cells stably expressing miR-137 or miR-NC were injected subcutaneously into both flanks of nude mice (5×10 [6] cells in 100 μl). [score:3]
The cutoff for the definition of subgroups (high and low) of miR-137 expression level was the 50th percentile value. [score:3]
What's more, overexpression of miR-137 promoted cell apotosis by and arrest the cell cycle in G1 phase by Cell Cycle analysis, respectively (Figure 4D, 4E). [score:3]
Taken together, the low expression levels of miR-137 in lung cancer patients could be used as a potential new biomarker which could predict poor prognosis for NSCLC. [score:3]
The correlation between miR-137 expression and NUCKS1 levels in human lung cancer tissues were analyzed using Spearman's rank test. [score:3]
Figure 1(A) Expression levels of miR-137 in 50 pairs of lung cancer tumor and adjacent normal specimens were analyzed by stem-loop qRT-PCR, and normalized to the levels of U6. [score:3]
We tested the expression levels of miR-218, miR-497, miR-30b and miR-137 in A549, A549/CDDP and A549/PTX cell lines. [score:3]
As shown in Figure 5B, luciferase activities were significantly reduced in those cells transfected with the wild sequence and miR-137, and significantly induced in those cells transfected with the wild sequence and miR-137 inhibitor, but not in the cells with the mutant sequence. [score:3]
To date, some genes have been identified as miR-137 target genes, including Cdc42, Cdk6, Cox-2, paxillin, AKT2 and MCL-1 [14– 18], which are involved in pathogenesis of cancers. [score:3]
Restoration of miR-137 dramatically inhibited the normally strong migration capacity of lung cancer cells (Figure 4C). [score:3]
The expression levels of miR-137 in resistant cells strains of lung cancer A549/PTX and A549/CDDP were lower than A549 cells. [score:3]
Figure 4(A) Real-time PCR analysis to quantify the expression levels of miR-137 and in A549/PTX and A549/CDDP cells. [score:3]
In this study, miR-137 overexpressing A549/PTX and A549/CDDP cells were used to analyze cell growth (Figure 4A). [score:3]
In our study, NUCKS1 oncogene has been experimentally validated as the novel target of miR-137 not only in vitro, but also in vivo. [score:3]
We further found that overexpression of miR-137 could reverse drug resistance to PTX and CDDP in A549/PTX and A549/CDDP cell lines respectively. [score:3]
Cellular levels of p-AKT were significantly decreased in lung cancer cells stably expressing miR-137 compared with miR-NC, while no statistically significant reduction of AKT was detected (Figure 5C). [score:2]
MiR-137 markedly suppressed luciferase activity in NUCKS1 3′-UTR (WT) reporter constructs. [score:2]
Figure 3(A) The CCK8 assay of A549 cells were determined after transduction with the miR-137 or miR-NC inhibitors, respectively. [score:2]
Repression of miR-137 in A549 cells signifcantly promoted cell growth, migration, cell survival and cell cycle G1/S transition and rendered resistance to PTX and CDDP. [score:1]
In summary, we have identified a link between miR-137, NUCKS1 and chemoresistance that is a novel constituent of lung cancer tumorigenesis. [score:1]
Male BALB/c nude mice were subcutaneously injected with 5 × 10 [6] cells infected with lentiviruses harboring miR-NC or miR-137. [score:1]
Figure 5(A) Sequence of the miR-137 -binding site within the human NUCKS1 3′-UTR and a schematic diagram of the reporter construct showing the entire NUCKS1 3′-UTR sequence and the mutated NUCKS1 3′-UTR sequence. [score:1]
Lentivirus carrying hsa-miR-137 or hsa-miR -negative control (miR-NC) was packaged following the manufacturer's manual. [score:1]
Stable cell lines, A549/PTX/miR-NC, A549/PTX/miR-137, A549/CDDP/miR-NC and A549/CDDP/miR-137 were collected and subcutaneously injected into both posterior blanks of male BALB/c nude mice, respectively. [score:1]
To determine the effects of miR-137 on growth of lung cancer cells, cells were seeded in 96-well plates at confluence of 2000 cells per well. [score:1]
Repression of miR-137 in A549 cells signifcantly promoted cell growth, migration, cell survival, cell cycle G1/S transition and rendered resistance to PTX and CDDP. [score:1]
Thus, our results suggest that repression of miR-137 in A549 cells signifcantly promoted cell growth, migration, cell survival, cell cycle G1/S transition and chemo-resistance in A549 cell lines. [score:1]
Moreover, the tumors from A549/PTX/miR-137 plus PTX and A549/CDDP/miR-137 plus CDDP showed an decreased VEGF positive staining through a standard immunohistochemistry staining (Figure 5C, 5F). [score:1]
As paclitaxel and cisplatin -based chemotherapy is still the main treatment option for advanced metastatic lung cancer, it is important that a miR-137 restoration approach may offer a new modulation strategy to overcome chemoresistance. [score:1]
These results suggested that miR-137 enhances lung cancer paclitaxel and cisplatin sensitivity in nude mice Figure 6. Figure 6MiR-137 enhances the chemosensitivity of paclitaxel and cisplatin in vivo(A, B) Effect of miR-137 on the growth of A549/PTX cells inoculated into nude mice. [score:1]
The fold changes were obtained by the ratio of miR-137 in cancer tissues to that in the adjacent normal tissues. [score:1]
In this study, we found that a miR-137 restoration approach may offer a new modulation strategy to overcome chemoresistance to paclitaxel and cisplatin in lung cancer. [score:1]
For its mutagenesis, the sequences complementary to the binding site of miR-137 in the 3′-UTR (NUCKS1: AGCAATAA) was replaced by TGGATAAA. [score:1]
These results suggested that miR-137 enhances lung cancer paclitaxel and cisplatin sensitivity in nude mice Figure 6. Figure 6MiR-137 enhances the chemosensitivity of paclitaxel and cisplatin in vivo(A, B) Effect of miR-137 on the growth of A549/PTX cells inoculated into nude mice. [score:1]
However, the molecular mechanism of miR-137 repression in lung cancer has not been fully determined. [score:1]
[1 to 20 of 74 sentences]
9
[+] score: 230
Other miRNAs from this paper: hsa-mir-122
Indeed, inclusion of the ASCT2 3′-UTR inhibited luciferase activity when 293T or HCT116 cells were co -transfected with miR-137 mimics, whereas mutation of the predicted binding site significantly reversed inhibition of luciferase expression under similar conditions (Figure 2d and e), validating ASCT2 as a direct miR-137 target. [score:11]
Notably, ectopic expression of miR-137 similarly inhibited glutamine consumption, α-KG production and ATP generation (Figure 4e–g), whereas its depletion in NCM460 cells significantly enhanced endogenous ASCT2 abundance and glutamine consumption concomitant with a prominent increase in α-KG and ATP production (Figure 4h and k), arguing that miR-137 inhibits glutamine metabolism primarily through ASCT2 downregulation. [score:10]
To examine whether inhibition of ASCT2 expression could impact the miR-137 tumor suppressor functions, we generated HCT116 cells expressing the control vector, ASCT2 [ASCT2 OE], ASCT2 shRNA [shASCT2], miR-137 or miR-137/ASCT2 combination [miR-137+ASCT2 OE] (Figure 5a). [score:9]
Moreover, we showed that, through downregulation of ASCT2 expression, miR-137 inhibits glutamine metabolism that is critical for cell proliferation and survival. [score:8]
As expected, either ASCT2 shRNA knockdown or miR-137 ectopic expression significantly inhibited HCT116 proliferation, whereas ASCT2 overexpression partially, but significantly, rescued cell proliferation repressed by miR-137 (Figure 5b). [score:8]
Of note, miR-137 expression was lowest in SW480 and SW620 tumor cells, which conversely exhibited the highest ASCT2 abundance, whereas NCM460 cells with the highest miR-137 expression showed a much lower ASCT2 protein level (Figure 3a), suggesting miR-137 as an essential regulator of endogenous ASCT2 expression. [score:8]
We then determined whether miR-137 directly targets and inhibits the expression of ASCT2 through specific base-pair binding to its 3′-UTR. [score:8]
Since miR-137 functions as a global tumor suppressor miRNA in a wide spectrum of human cancers whereas miR-122 is a liver-specific miRNA downregulated in hepatocellular carcinoma, 28, 29, 30, 31, 32, 33, 34 we focused on miR-137 regulation of ASCT2 in the current study. [score:7]
We depleted EZH2 expression in HCT116 cells, but found that its inhibition had little effect on miR-137 and ASCT2 expression (Supplementary Figure S5). [score:7]
All these data suggest that inhibition of ASCT2 expression and glutamine metabolism is important for miR-137 tumor suppressor functions. [score:7]
As expected, transient transfection of miR-137 mimics consistently inhibited endogenous ASCT2 expression in all the tumor cells examined without affecting GLS1 expression (Figure 2b and c and Supplementary Figure S2a). [score:7]
Combined in-silico algorithms with systemic experimental screening, we herein identify the global tumor suppressor microRNA, miR-137, as an essential regulator that selectively targets ASCT2 and tumor glutamine metabolism. [score:6]
In support of this notion, either MeCP2 knockdown or 5-Aza-CdR treatment significantly reduced MeCP2 and DNMT3B occupancy in these CpG islands (Figure 6f and g), and administration of the miR-137 inhibitor rescued 5-Aza-CdR repression of ASCT2 expression (Supplementary Figure S6). [score:6]
Altogether, these results support that ASCT2 downregulation contributed to miR-137 inhibition of tumorigenesis in vivo. [score:6]
In this regard, our results suggest that DNMT inhibitors can be used as an alternative approach to indirectly targeting ASCT2 (via miR-137 reactivation) and glutamine metabolism. [score:6]
In support of this notion, inhibition of endogenous miR-137 using an miRNA sponge significantly increased endogenous ASCT2 levels in NCM460 cells, a normal colon epithelial cell line exhibiting remarkable endogenous miR-137 expression (Figures 3a and 4h). [score:5]
Ectopic ASCT2 expression partially rescued miR-137 suppression of tumorigenesis. [score:5]
Transient transfection of either miR-137 or miR-122 mimics markedly inhibited endogenous ASCT2 expression in 293T cells, whereas the remaining mimics exhibited undetectable effects (Figure 1b and c and Supplementary Figure S1). [score:5]
The TargetScan algorithm predicts that miR-137 could selectively target the seed sequence within 3′-UTR of ASCT2 mRNA (Figure 2a). [score:5]
Altogether, these results suggest that miR-137 might play a more universal role in suppression of ASCT2 expression and glutamine metabolism. [score:5]
Again, mice inoculated with HCT116 cells harboring shASCT2 or miR-137 consistently developed much smaller tumors than those with the control cells, whereas restoration of ASCT2 expression significantly reversed miR-137 inhibitory effect (Figure 5c–f). [score:5]
We identify that miR-137, a tumor suppressor microRNA silenced in a wide spectrum of human cancers, 28, 29, 30, 31, 32 selectively targets ASCT2 and tumor glutamine metabolism. [score:5]
Moreover, either MeCP2 depletion or DNMT inhibition, similar to miR-137 overexpression, significantly decreased glutamine consumption, α-KG production and ATP generation (Figure 7a–f). [score:5]
The inhibitory effects of miR-137 or miR-122 mimics on ASCT2 appeared quite specific, as the expression of glutaminase 1 (GLS1, encoded by GLS1), a critical enzyme catalyzing the conversion of glutamine to glutamate, was barely affected (Figure 1b and c and Supplementary Figure S1). [score:5]
In conclusion, our findings not only identify a novel mechanism depicting the miR-137 tumor suppressor functions but also provide a mechanistic basis for differences in glutamine metabolism, a key driver of tumor development and response to therapy. [score:4]
Of note, this sequence is highly conserved across different species (Figure 2a), indicating that specific base-pairing to this site by miR-137 may have an evolutionarily conserved role in regulation of ASCT2 expression. [score:4]
To examine a potential correlation between ASCT2 and miR-137, we analyzed their expression levels in normal colonic epithelial cells (NCM460) and series of colorectal carcinoma cells (Figure 3a). [score:3]
MiR-137 targets ASCT2 by directly binding to its 3′-UTR. [score:3]
As expected, either treatment significantly increased endogenous miR-137 expression while conversely depleted ASCT2 accumulation (Figure 6b–e). [score:3]
Altogether, these results suggest that MeCP2 and DNMTs cooperate to reactivate ASCT2 expression and glutamine metabolism through miR-137 epigenetic silencing. [score:3]
Further analysis showed that both miR-137 and miR-122 mimics inhibited ASCT2 in a dose -dependent manner, resulting in prominent ASCT2 reduction even at a lower dose of 2.5 n M (Figure 1d and e). [score:3]
Our results suggest that epigenetic silencing of miR-137 by MeCP2 and DNMTs inversely enhanced ASCT2 translation and glutamine uptake (Figure 7g). [score:3]
BALB/C nude mice (4–6 weeks old) were injected subcutaneously in both flanks with 4 million HCT116 cells expressing the control vector, ASCT2, miR-137 or miR-137/ASCT2 combination in 200 μl PBS. [score:3]
Across the seven cell lines examined, we identified an inverse correlation between miR-137 expression and ASCT2 protein levels. [score:3]
Administration of miR-137 mimics had also undetectable effects on the expression of glycolytic genes as well as the aerobic glycolysis of HCT116 cells (Supplementary Figure S2b–d). [score:3]
As expected, overall miR-137 expression was significantly lower in tumor samples than in adjacent normal tissues, where ASCT2 levels were conversely elevated (Figure 3b and c). [score:3]
Mechanistic studies show that MeCP2 and DNA methyltransferases cooperate to promote active methylation of the miR-137 promoter and its decreased transcription, leading to enhanced ASCT2 expression and glutamine metabolism. [score:3]
Epigenetic silencing of miR-137 by MeCP2 and DNMTs reactivated ASCT2 expression and glutamine metabolism. [score:3]
Analysis of sequencing data from Cancer Genome Atlas confirms that the expression levels between miR-137 and ASCT2 are inversely correlated in multiple human cancer types. [score:3]
These findings thus elucidate a novel, global mechanism accounting for ASCT2 deregulation in human cancers, revealing a molecular link between miR-137, ASCT2 and tumor metabolism. [score:2]
[39] HCT116 cells with ASCT2 depletion or miR-137 overexpression were cultured in Dulbecco’s modified Eagle’s medium media with 2 m M glutamine for 24 h. Glutamine consumption, α-KG and ATP contents were determined using respective assay kits obtained from BioVision (Milpitas, CA, USA). [score:2]
Identification of miR-137 and miR-122 as potential regulators of ASCT2. [score:2]
In addition to miR-137, the Myc family members, c-Myc in glioblastoma and N-Myc in neuroblastoma, directly activate ASCT2 transcription and glutamine metabolism. [score:2]
Conceivably, miR-137 epigenetic silencing, together with additional essential oncogenic lesions (for example, Myc deregulation), would enable precancerous cells to alter their glutamine metabolism to survive and propagate in a stressed microenvironment, with the ‘fittest’ cells enduring and eventually acquiring cancerous properties. [score:2]
MiR-137 overexpression elicits similar metabolic dysfunction as ASCT2 depletion. [score:2]
To test this, we cloned the 3′-UTR sequence of ASCT2 including the predicted miR-137 -binding site into pGL3-promoter vector. [score:1]
We demonstrate that MeCP2 and DNMTs cooperate to promote active methylation of the miR-137 promoter leading to its transcriptional silencing. [score:1]
Pre-miR-137 and specific shRNAs against ASCT2, MeCP2 and GFP were cloned into pL KO. [score:1]
28, 29, 30, 31, 32 We therefore examined if miR-137 could decrease the ASCT2 abundance in tumor cells from these cancer types. [score:1]
ASCT2 is inversely correlated with miR-137 in multiple human cancers. [score:1]
35, 36 Yet, the molecular mechanisms whereby miR-137 is epigenetically silenced remain to be determined. [score:1]
Previous studies suggested epigenetic silencing of miR-137 involving the Polycomb Group proteins EZH2/SUZ12 and/or DNA hypermethylation. [score:1]
Potential miR137 -binding site (wildtype or mutant, see Supplementary Table S1) in the 3′-UTR of human ASCT2 were synthesized from GENEWIZ Inc. [score:1]
The correlation between miR-137 and ASCT2 in TCGA data sets was performed by Pearson’s correlation. [score:1]
Interestingly, miR-137 levels significantly, but conversely, correlated with ASCT2 in multiple cancer types, including colorectal carcinoma, glioblastoma, prostate and pancreatic cancers (Figure 3d–g). [score:1]
Notably, miR-137 was the only one identified by these three algorithms. [score:1]
These observations prompted us to investigate whether there is any inverse correlation between the expression of miR-137 and ASCT2 in human cancers. [score:1]
[1 to 20 of 57 sentences]
10
[+] score: 194
Enforced expression of miR-137 remarkably reduced the luciferase activity of the reporter gene with the wild-type construct but not with the mutant PAQR3 3′UTR construct, which indicates that miR-137 directly targeted the PAQR3 3′UTR. [score:6]
Therefore, we believe that miR-137 plays a role in the promotion of metastasis in bladder cancers, at least in part, by downregulating the protein expression of PAQR3. [score:6]
Moreover, we found that PAQR3, a novel tumor suppressor gene, was the direct target of miR-137 in bladder cancer. [score:6]
The expression of miR-137 is up-regulated in bladder cancer cell lines. [score:6]
Enforced expression of miR-137 promoted bladder cancer cell proliferation, migration and invasion through directly targeting PAQR3. [score:6]
Expression of miR-137 is up-regulated in bladder cancer cell lines. [score:6]
Intriguingly, migration and invasion assay showed that overexpression of miR-137 significantly promoted the migration and invasion of T24 cells compared with the control whereas miR-137 inhibitor inhibited both cell migration and invasion (Fig. 3D and E). [score:5]
Upregulation of miR-137 expression in bladder cancer cell lines and tissues compared with the corresponding controls. [score:5]
The growth index as assessed at 0, 24, 48 and 72 h. (C) Expression levels of miR-137 were examined by real-time PCR after transfection of miR-137 inhibitor or control or no transfection. [score:5]
In summary, these data indicate that inhibition of PAQR3 expression by miR-137 is responsible, at least in part, for the promoting effects of miR-137 on cell proliferation and invasion in human bladder cancer. [score:5]
Conversely, miR-137 inhibitor significantly inhibited the proliferation of the T24 cells (Fig. 3C). [score:5]
We also showed that, when miR-137 -expressing cells resumed PAQR3 expression, their invasion deficiencies were partly reversed. [score:5]
MiR-137 has attracted much attention because it is frequently down-regulated and functions as a tumor suppressor in many cancers such as ovarian cancer, gastric cancer, glioblastoma, lung cancer, colorectal cancer and neuroblastoma [23]– [28]. [score:5]
Co-transfection of a construct expressing PAQR3 and miR-137 in T24 cells led to the restoration of PAQR3 expression, as confirmed by Western blot (Fig. 5C). [score:5]
A previous study by Shimuzu et al. also showed that miR-137 was frequently methylated in primary bladder tumors and ectopic expression of miR-137 suppressed bladder cancer cell proliferation [29]. [score:5]
The expression of miR-137 was first evaluated by quantitative reverse transcription-PCR (qRT-PCR) in bladder cancer cell lines and one normal bladder cell line SV-HUC-1. As shown in Fig. 1, miR-137 was significantly up-regulated in all the bladder cancer cell lines compared with SV-HUC-1. We further quantified the expression level of miR-137 in 6 pairs of human bladder cancer tissues and adjacent normal mucosal tissues by qRT-PCR (Fig. 1). [score:5]
In conclusion, our results have shown that miR-137 was significantly upregulated in bladder cancer cells and tissues. [score:4]
In this study, we detected frequent upregulation of miR-137 in human bladder cancer tissues and cell lines. [score:4]
Importantly, specific PAQR3 knockdown with siRNA phenocopied the migration- and invasion-promoting effects of miR-137 over -expression. [score:4]
Meanwhile, miR-137 was down-regulated in 5 cases (5/50, 10%). [score:4]
This novel miR-137/PAQR3 axis may provide new insights into the mechanisms underlying tumor metastasis, and repression of miR-137 expression may be a potential therapeutic strategy for the treatment of bladder cancer in the future. [score:3]
The exact role of miR-137 in bladder cancer was still unclear although its tumor-suppressing function has been implicated [29]. [score:3]
The growth index as assessed at 0, 24, 48 and 72 h. (E) Transwell analysis of T24 cells after treatment with miR-137 mimics, inhibitors or scramble or control; the relative ratio of migrated cells per field is shown below. [score:3]
Overexpression of miR-137 promoted cell proliferation, migration and invasion of bladder cancer cells. [score:3]
The expression of PAQR3 partially rescued miR-137-enhanced cell proliferation and invasion. [score:3]
Cells were transfected with scrambled control oligo or miR-137 mimics and inhibitor, which showed high transfection efficiency (Fig. 3A). [score:3]
However, we herein report the contradictory expression and function of miR-137 in bladder cancer, which are opposed to that reported in the literature. [score:3]
In general, the expression of miR-137 in bladder cancer tissues was significant higher than in adjacent tissues (Fig. 2A, p<0.001). [score:3]
Overexpression of miR-137 promoted bladder cancer cell proliferation, migration and invasion. [score:3]
Moreover, the oncogenic function of miR-137 may be specific to bladder tissue since its tumor suppressing function has been wi dely reported in other tissue types. [score:3]
Thus, our current study intended to clarify the expression and biological function of miR-137 in bladder cancer. [score:3]
As expected, enforced expression of miR-137 enhanced proliferation, migration and invasion of T24 cells. [score:3]
Relative expression of miR-137 in four bladder cancer cell lines and one normal bladder cell line SV-HUC-1 was determined by qRT-PCR. [score:3]
To study the relationship of miR-137 with bladder cancer occurrence, the expression of miR-137 was detected in 50 clinical patients using real-time PCR. [score:3]
The transfection of hsa-miR-137 mimic, inhibitor, and scramble, chemically synthesized by GenePharma (Shanghai, China) was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol and were transfected into the cells with a final oligonucleotide concentration of 20 nmol/L. [score:3]
0109734.g002 Figure 2 (A) Relative miR-137 expression levels in bladder cancer tissues and adjacent normal tissues were determined by qRT-PCR. [score:3]
Out of 50 bladder cancer samples, miR-137 was up-regulated in 45 cases (45/50, 90%) compared with adjacent tissues (Fig. 2B). [score:3]
miR-137 targets PAQR3 in bladder cancer cells. [score:3]
Overexpression of miR-137 reduced the protein and mRNA levels of PAQR3 in bladder cancer cells (Fig. 4C and D). [score:3]
Restored expression of PAQR3 partially rescued miR-137-enhanced cell proliferation and invasion. [score:3]
Contrary to the findings of Shimuzu et al. [29], our study demonstrated that miR-137 was frequently up-regulated in bladder cancer cell lines and tissues compared to normal bladder cell line and tissues. [score:3]
0109734.g003 Figure 3. (A) Expression levels of miR-137 were examined by real-time PCR after transfection of miR-137 mimics or sramble or no transfection. [score:3]
The higher level expression of miR-137 was associated with pTNM stage (Fig. 2C), and higher level of miR-137 was associated with pM stage (p = <0.05, metastasis vs. [score:3]
The results showed that the expression level of miR-137 was generally higher in tumor tissues compared to matched non-tumor tissues. [score:2]
In this study, the real-time PCR, and luciferase assays showed that PAQR3 is a target of miR-137. [score:2]
The effect of miR-137 on the translation of PAQR3 mRNA into protein was then assessed by using a luciferase reporter assay (Fig. 4B). [score:2]
MiR-137 targets PAQR3 in bladder cancer cells. [score:2]
More importantly, we found that restoration of PAQR3 could significantly reverse the proliferation and invasion promoted by miR-137 (Figs. 5D and 5E). [score:1]
Based on these findings, we hypothesized that miR-137 might be a potential oncogene in bladder cancer. [score:1]
Silencing of PAQR3 significantly enhanced the proliferation of bladder cancer cells (Figs. 5B), which phenocopied the effects of miR-137 on proliferation of bladder cancer cells. [score:1]
As predicted by PicTar, there was complementarity between has-miR-137 and the PAQR3 3′UTR (Fig. 4A). [score:1]
The growth index as assessed at 0, 24, 48 and 72 h. (C) Western blot analysis of PAQR3 in T24 cells co -transfected with either miR-137 mimic or scramble and 2.0 µg pCDNA- PAQR3 or pCDNA empty vector. [score:1]
Thus, our results suggest important roles for miR-137 in bladder cancer pathogenesis and indicate its potential application in cancer therapy. [score:1]
We explored the potential impact of miR-137 in bladder cancer cell proliferation, migration and invasion. [score:1]
Our present findings suggest that miR-137 plays a critical role in the invasive and metastatic potential of bladder cancer and may be potential diagnostic and predictive biomarkers. [score:1]
Thus, we speculated that miR-137 might be a putative oncogene in bladder cancer. [score:1]
As one of the most prominent miRNAs implicated in the tumorigenesis, miR-137 has presented with a controversial role during tumor progression [33]. [score:1]
Next, we addressed the molecular mechanism of miR-137 in promoting proliferation, migration and invasion in bladder cancer cells. [score:1]
Expression of miR-137 in clinical bladder cancer patients and their correlation analysis with clinicopathological characteristics. [score:1]
The Ct value of miR-137 and PAQR3 was quantified with the 2 [−ΔΔCt] method. [score:1]
These data suggested that alterations of miR-137 could be involved in bladder cancer progression. [score:1]
The expression of miR-137 in clinical bladder cancer patients and their correlation analysis with clinicopathological characteristics. [score:1]
[1 to 20 of 62 sentences]
11
[+] score: 190
Other miRNAs from this paper: mmu-mir-137
Inhibition of CXCL12 expression enhances miR-137 -mediated inhibition. [score:7]
In order to identify the effect of CXCL12 expression inhibition on miR-137 -mediated the development of GBM, the CXCL12 siRNAs were co -transfected into U87 and U251 cells with miR-137 mimics. [score:6]
Subsequently, we used bioinformatics analysis and cell transfection to demonstrate the tumor-suppressing effects of miR-137 were due to down-regulation of CXCL12. [score:6]
In addition, miR-137 mimics and si-CXCL12 synergically inhibited the expression of CXCL12 (Figure 7B). [score:5]
In conclusion, our work demonstrated that miR-137 serves as a tumor suppressor by inhibition of CXCL12 in human GBM. [score:5]
These findings suggested that miR-137 expression exerts the inhibitory effects on GBM cell migration and invasion. [score:5]
The target genes of miR-137 were selected based on target scan algorithms [microRNA. [score:5]
We found that miR-137 mimics or si-CXCL12 obviously inhibited the expression of CXCL12 than miR-NC or si-control group respectively (Figure 7A). [score:5]
In vitro data further indicated that miR-137 expression plays a suppressive role in tumor cell proliferation, migration and invasion. [score:5]
Furthermore, the expression of CXCL12 protein was reduced in the miR-137 mimics and 3′-UTR-wt-co -transfected U87 cell lines as compared with the miR-137 mimics and 3′-UTR-mut-co -transfected U87 cell lines These results suggested that the 3′-UTR of CXCL12 is a direct target of miR-137. [score:5]
We found that the expression of EGFR and Bcl-2 protein was significantly decreased in U87 and U251 cells transfected with miR-137, while the expression of EGFR and Bcl-2 protein in miR-NC group were not affected (Figure 3B). [score:5]
CXCL12 over -expression attenuates miR-137 -mediated inhibition. [score:5]
We found that the expression of miR-137 was significantly decreased in U87 and U251 cells, while the expression of miR-137 was obviously increased in normal NHA cells (p<0.01; Figure 2A). [score:5]
The 3′-UTR of CXCL12 is a direct target of miR-137. [score:4]
These findings indicated that miR-137 expression affected cell proliferation in the development of GBM. [score:4]
To identify whether the 3′-UTR of CXCL12 mRNA was a direct target of miR-137, we inserted a 3′-UTR (wt/mut) sequence of CXCL12 mRNA into a luciferase reporter vector, and then we detected the luciferase density. [score:4]
To figure out the role and significance of miR-137 and CXCL12 in the development of GBM, we firstly detected the expression of miR-137 and CXCL12 in 50 cases of tumor tissues and paired adjacent non-tumor tissues. [score:4]
In the present work, our study showed that U87 and U251 cells transfected with miR-137 mimics indeed decreased the expression of EGFR, MMP2 and MMP9 proteins than control, suggesting that miR-137 reduced GBM cell proliferation and invasion. [score:3]
The miR-137 mimic inhibited the luciferase activity controlled by wild-type CXCL12-3’-UTR (B) but did not affect the luciferase activity controlled by mutant CXCL12-3’-UTR (C) in U87 and U251 cells. [score:3]
These results indicated that miR-137 exerts the inhibitory effects on GBM cell migration and invasion. [score:3]
Figure 1 (A-B) The RT-PCR analysis of miR-137 and CXCL12 mRNA expression were conducted in tumor tissues and matched non-tumor tissues. [score:3]
Figure 6 (A) The proliferation capacity of miR-137 -overexpressing U87 and U251 cells was partially improved when cells were transfected with CXCL12 plasmids in comparison with miR-NC. [score:3]
CXCL12 is a candidate target of miR-137. [score:3]
This result suggested that cell proliferation was obviously inhibited owing to transfection of miR-137 mimics. [score:3]
miR-137 -overexpressing or control cells (5 × 10 [6] per mouse, 3 mice per group) were subcutaneously injected into the right flanks of mice. [score:3]
In the present study, the expression detection of miR-137 and CXCL12 was subjected to qRT-PCR analysis. [score:3]
The expression profile of miR-137 and CXCL12 in GBM tissues. [score:3]
The expression of miR-137 and CXCL12 in GBM tissues. [score:3]
The expression of miR-137 and CXCL12 in GBM cell lines. [score:3]
Figure 2 (A-B) RT-PCR analysis of miR-137 and CXCL12 expression in glioblastoma U87 and U251 cell lines. [score:3]
Thus, miR-137-CXCL12 can be recommended as a useful and effective target for treatment of GBM. [score:3]
We found the expression of miR-137 was obviously decreased in tumor tissues than that in paired non-tumor tissues (p<0.01; Figure 1A). [score:3]
miR-137 inhibits glioblastoma cell proliferation. [score:3]
Previous reports suggested that miR-137 expression is reduced and suggested as a prognosis biomarker in many kinds of tumors, involving lung cancer, colorectal cancer [9], and oral squamous cell carcinoma [10]. [score:3]
However, the expression and the role of miR-137 in GBM have not been clearly reported till now. [score:3]
The expression profile of miR-137 and CXCL12 in GBM cell lines. [score:3]
Besides, we applied western blot to investigate the change of cell invasion-related molecules, and observed that the expression of MMP2 and MMP9 protein in U87 and U251 cells with miR-137 mimics was obviously reduced, while their expression levels were increased in U87 and U251 cells with miR-NC (p<0.01) (Figure 4C). [score:3]
Our study firstly showed that the expression of miR-137 was reduced in tumor tissues than that in paired non-tumor brain tissues. [score:3]
We further evaluated whether CXCL12 is an objective target of miR-137, which would be a potential target for treatment of human glioblastoma. [score:3]
The wound healing analysis showed that miR-137 mimics had the capacity to inhibit U87 or U251 cell migration as compared with miR-NC group (p<0.01) (Figure 4A). [score:2]
In addition, our transwell analysis further showed that CXCL12 siRNAs in U87 and U251 cells with miR-137 mimics inhibited U87 and U251 cell invasion as compared with their controls (Figure 6D). [score:2]
Meanwhile, the expression of Bax protein was also increased in U87 and U251 cells transfected with miR-137 mimics as compared with miR-NC group (Figure 3B). [score:2]
In order to identify the effect of CXCL12 on miR-137 -mediated the development of GBM, the pcDNA3.1(+)-CXCL12 plasmids were co -transfected into U87 and U251 cells with miR-137 mimics. [score:2]
MiR-137 affects engrafted tumor growth in vivoAs mentioned above, in-vitro assay demonstrated that miR-137 expression affected GBM progression. [score:2]
This is the first study to explore the post-transcriptional regulation of CXCL12 by miR-137 in human GBM. [score:2]
These results were consistent with some previous reports, indicating that miR-137 is involved into the development of human GBM [18]. [score:2]
As mentioned above, in-vitro assay demonstrated that miR-137 expression affected GBM progression. [score:2]
Tumor volume analysis showed that the volume value of U87-engrafted tumor with miR-137 mimics got significantly slower than their controls (Figure 7D), indicating that miR-137 mimics repressed U87-engrafted tumor growth. [score:1]
For 3’UTR luciferase assay, the putative binding sites of miR-137 and its homologous mutation sites in the 3’-UTR region of CXCL12 mRNA were amplified and cloned into pGL3-contral luciferase reporter plasmid (Invitrogen, Carlsbad, CA). [score:1]
However, the role of miR-137/CXCL12 in human GBM is still unknown. [score:1]
Quantification analysis was defined as the relative density of miR-137 and CXCL12 mRNA to U6 and GAPDH, respectively. [score:1]
Cells were transfected with or without NC miRNAs or miR-137 mimics. [score:1]
U87 and U251 cells were transfected with miR-137 mimics or scramble control. [score:1]
Figure 3 (A) Cells were transfected with miR-137 mimics and identified by RT-PCR. [score:1]
Quantification analysis was defined as the relative density of miR-137 and CXCL12 mRNA to U6 and GAPDH respectively. [score:1]
We demonstrated no toxic effects of miR-137 on nude mice. [score:1]
We observed that miR-137 mimics decreased the luciferase intensity of U87 cells transfected with CXCL12-3’UTR-wt in a dose -dependent fashion (Figure 5B), while miR-137 mimics did not altere the luciferase activity of U87 cells transfected with CXCL12-3’UTR-mut (Figure 5C). [score:1]
CXCL12 affects the effect of miR-137 on cell proliferation and invasion. [score:1]
Cells were transiently transfected with 50 nmol of the miR-137 mimic with Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendation. [score:1]
In the present study, firstly, we used three miRNA databases to predict common and putative miR-137 -binding sequences located in the 3′-UTR of CXCL12 mRNA (Figure 5A). [score:1]
Transient transfection of miR-137 oligonucleotides. [score:1]
Tumor weight analysis showed that the weight value of U87-engrafted tumor with miR-137 mimics was significantly lower than their controls (Figure 7C). [score:1]
We found that miR-137 mimics effectively reduced the number of viable cells of U87 and U251 cells, while cells in miR-NC group were not affected (p<0.01) (Figure 3A). [score:1]
miR-137 affected the growth of U87-engrafted tumor. [score:1]
Effects of miR-137 on GBM cell proliferation. [score:1]
Figure 5 (A) The WT and Mut of 3′UTR of CXCL12 mRNA contains the binding sequences of miR-137. [score:1]
Effects of miR-137 on GBM cell migration and invasion. [score:1]
miR-137 reduces GBM cell migration and invasion. [score:1]
Based on results above, we evaluated the expression of miR-137 and CXCL12 in U87 and U251 cell lines. [score:1]
Panels show U87 and U251 cell invasion after transfection with miR-137 mimics or miR-NC. [score:1]
[1 to 20 of 70 sentences]
12
[+] score: 185
Other miRNAs from this paper: hsa-mir-21, hsa-mir-34a, hsa-mir-143
The results of this study exhibit that the expression level of miR-137 was down-regulation in gastric cancer cells and tissues, and miR-137 expression was an independent prognostic indicator for gastric cancer. [score:8]
While, in colorectal cancer cells, ectopic miR-137 expression also could arrest cell cycle, repress cell growth, and inhibit cell invasion through targeting cell division control protein 42 homolog (Cdc42) [20]. [score:7]
As listed in Table 4, only the gastric cancer patients with TNM stage III could be stratified by miR-137 expression significantly, the prognosis of TNM stage III gastric cancer patients with high miR-137 expression was significantly better than those with low miR-137 expression in the two independent sets (Training set: P = 0.006, Validation set: P = 0.016, respectively; Fig 3). [score:7]
It was recently shown that miR-137 expression was significantly decreased in gastric cancer tissues, and the suppression was concurrently with the severity of pathological changes, suggesting the potential tumor suppressor role of miR-137 in gastric cancer [16]. [score:7]
As shown in the following Table 3, TNM stage and miR-137 expression were both recognized as independent and significant prognostic parameters in the two independent sets (Training set: TNM stage: HR, 12.83; 95% CI, 3.48 to 47.30; P<0.001; miR-137 expression: HR, 6.80; 95% CI, 2.06 to 22.48; P = 0.002; Validation set: TNM stage: HR, 5.21; 95% CI, 2.04 to 13.31; P = 0.001; miR-137 expression: HR, 2.41; 95% CI, 1.13 to 5.11; P = 0.023, respectively). [score:7]
As shown in Fig 1A, the human gastric cancer cells expressed significantly lower levels of miR-137 than GES-1. Collectively, these observations suggest that miR-137 expression is decreased in gastric cancer cells compared with the immortalized normal human gastric epithelial cell, and decreased miR-137 expression may be related to the oncogenesis of gastric cancer. [score:6]
Patients were divided into high and low expression group according to the ratio of their normal/cancer tissue median expression levels of miR-137 according the results of (cut-off ratio = 1.5). [score:5]
Besides, the percent of patients with low miR-137 expression increased accompanied with disease progression from TNM stage I to III in the two independent sets (Fig 1B and 1C). [score:5]
Zheng and his colleagues demonstrated that ectopic expression of miR-137 was sufficient to inhibit gastric cancer cell proliferation [21]. [score:5]
Recently, Wu et al. indicated that the miR-137 is acted as tumor suppressor on gastric cancer cells by targeting AKT2 and further affecting the Bad and GSK-3β, and potentially involved in tumorigenesis and metastasis of gastric cancer [16]. [score:5]
As shown in Fig 2, patients with low miR-137 expression showed significantly shorter overall survival than those high ones in the two independent sets (P<0.001 and P<0.001, respectively), which indicated a vital impact of miR-137 expression on clinical outcome in gastric cancer patients. [score:5]
In the present research, we evaluated the association between the expression of miR-137 and prognosis of patients with gastric cancer after radical gastrectomy, and found that miR-137 expression was an independent prognostic factor for overall survival of these patients in addition to TNM stage, and the prognosis of the patients with low miR-137 expression were significantly worse than those with high. [score:5]
Previously studies demonstrated that the expression of miR-137 is down-regulated and considered as a prognostic marker in various types of cancer, including lung cancer [9], colorectal cancer [10], ovarian cancer [11], multiple myeloma [12], gastrointestinal stromal tumor [13], glioblastoma [14], and squamous cell carcinoma of the head and neck [15]. [score:5]
Cell proliferation and migration of breast cancer could be suppressed by miR-137 by suppressing estrogen related receptor a (ERRa) [19]. [score:5]
0142377.g003 Fig 3 Kaplan-Meier analyses of overall survival according to miR-137 expression in (A) Training set, TNM stage I+II (n = 32), (B) Training set, TNM stage III (n = 35), (C) Validation set, TNM stage I+II (n = 37), and (D) Validation set, TNM stage III (n = 50). [score:3]
Associations between miR-137 expression and clinicopathologic factors. [score:3]
As shown in Table 1, the expression of miR-137 was significantly associated with tumor cell differentiation (P = 0.009 and P = 0.002, respectively), N stage (P = 0.019 and P<0.001, respectively), and TNM stage (P = 0.007 and P = 0.007, respectively) in the two independent sets. [score:3]
The principle aim of this research is to evaluate the relationship between the expression of miR-137 and overall survival of gastric cancer patients in an effort to identify the prognostic significance of miR-137 expression. [score:3]
Pearson’s χ [2] or Fisher’s exact test was used to analyze the relationship between miR-137 expression and clinicopathological factors. [score:3]
Large prospective randomized controlled clinical studies are needed to identify the prognostic value of miR-137 expression in the patients with gastric cancer. [score:3]
In addition, univariate analyses for overall survival in this study exhibited that low miR-137 expression is a significant negative prognostic predictor for patients with gastric cancer in the training set (hazard ratio [HR], 6.30; 95% CI, 2.17 to 18.27; P = 0.001) and validation set (HR, 3.74; 95% CI, 1.81 to 7.73; P<0.001). [score:3]
The prognostic value of miR-137 expression was determined by univariate and multivariate analysis. [score:3]
In addition, in the training set, miR-137 expression was also significantly related with T stage (P = 0.002). [score:3]
In the present study, we evaluated the expression level of miR-137 in human gastric cancer cell lines with quantitative real-time PCR, the results exhibited that the human gastric cancer cells, including MKN-45, SGC7901, BGC-823, MGC-803, and AGS, expressed significantly lower levels of miR-137 than GES-1, which is an immortalized normal human gastric epithelial cell line. [score:3]
The above-mentioned studies confirmed that miR-137 plays a role that is similar to tumor suppressor miRNAs. [score:3]
Moreover, these TNM stage III gastric cancer patients with low miR-137 expression might need more aggressive postoperative treatment and closer follow-up. [score:3]
In order to ascertain the expression level of miR-137 in human gastric cancer cells, we first evaluated miR-137 expression by in immortalized normal human gastric epithelial cell line GES-1 and five human gastric cancer cell lines, including MKN-45, SGC7901, BGC-823, MGC-803, and AGS. [score:3]
0142377.g002 Fig 2 Kaplan-Meier analyses of overall survival according to miR-137 expression in (A) Training set (n = 67) and (B) Validation set (n = 87). [score:3]
Stratified analysis of overall survival according to the expression of miR-137 in gastric cancer patients with different TNM stage. [score:3]
Expression analysis of miR-137 in human gastric cancer cells. [score:3]
The expression of miR-137 in human gastric cells and tissues. [score:3]
However, an extensive analysis of expression of miR-137 in correlated to prognosis of gastric cancer patients has not been performed and awaits further elucidation. [score:3]
Log-rank test on overall survival for TNM stage split by miR-137 expression. [score:3]
Analyses of overall survival according to the expression of miR-137 in gastric cancer patients. [score:3]
Second, there was heterogeneity in the thresholds used to determine the cutoff of miR-137 expression in this research. [score:3]
Prognostic value of miR-137 expression in patients with gastric cancer. [score:3]
This result indicated that abnormal miR-137 expression may be related to the oncogenesis of gastric cancer. [score:3]
To our knowledge, this is the first study to identify miR-137 expression as an independent poor prognostic factor for overall survival of gastric cancer patients following radical gastrectomy. [score:3]
Kaplan-Meier analyses of overall survival according to miR-137 expression in (A) Training set, TNM stage I+II (n = 32), (B) Training set, TNM stage III (n = 35), (C) Validation set, TNM stage I+II (n = 37), and (D) Validation set, TNM stage III (n = 50). [score:3]
Kaplan-Meier analyses of overall survival according to miR-137 expression in (A) Training set (n = 67) and (B) Validation set (n = 87). [score:3]
And according to the criterion, approximately 56.72% (Training set, 38 of 67) and 49.43% (Validation set, 43 of 87) tumors were scored as low miR-137 expression. [score:3]
Based on this condition, applying the prognostic value of miR-137 expression to TNM stage III group showed a better risk stratification for overall survival in patients with late-stage gastric cancer. [score:3]
0142377.g001 Fig 1 (A) analysis for miR-137 expression levels in immortalized normal human gastric epithelial cell line GES-1 and five human gastric cancer cell lines (MKN-45, SGC7901, BGC-823, MGC-803, and AGS). [score:3]
To determine whether miR-137 expression could stratify patients with different TNM stage stratum, we did stratified analyses of gastric cancer patients with TNM stage I+II and TNM stage III and evaluated the prognostic value of miR-137 expression in the two independent sets respectively. [score:3]
As important components of gene regulation, in many human cancer cells, miR-137 could regulate different genes and influence their functions in many cellular pathways. [score:3]
To further investigate the prognostic value of miR-137 expression in gastric cancer patients, we compared overall survival according to miR-137 expression, and Kaplan-Meier survival analysis was performed. [score:2]
Same with the other miRNAs, it has been reported that miR-137 was closely correlated with the formation and development of human cancers [8, 18]. [score:2]
Association between miR-137 expression and clinical characteristics. [score:1]
In addition, Steponaitiene R et al. exhibited that miR-137 methylation is a frequent event in gastrointestinal cancers which occurs early in stepwise manner during gastric carcinogenesis and inversely correlates with global methylation [22]. [score:1]
In the light of these conditions, whether miR-137 underexpression is also observed in gastric cancer samples of patients from western countries needs to be evaluated in the future. [score:1]
The expression levels of miR-137 were further measured to analyze their relationship with clinicopathologic factors. [score:1]
In summary, the results of this study demonstrate that miR-137 is a promising marker to predict the overall survival of patients with gastric cancer after radical gastrectomy. [score:1]
However, all these researches are mainly performed in the gastric cancer cell lines, the relationship between the expression level of miR-137 and the clinical characteristic factors of patients with gastric cancer has not been established. [score:1]
[1 to 20 of 53 sentences]
13
[+] score: 135
GABAergic synapse Glutamatergic synapse hsa-miR-137-3p targets GABRA1 ADCY1 PLCL1 ADCY2 ADCY1 GRM5 ADCY2 SLC17A6 GABRG2 CPD GABBR2 PLCB1 GAD2 PPP3CB GABRA6 DLGAP1 SRC GRM7 CACNA1D CACNA1D ADCY9 GRIN2A SLC6A1 ADCY9 KCNJ3 SLC1A2In order to further confirm dme-miR-137 could directly regulate targets in neuroactive-ligand receptor interaction pathway, we constructed luciferase reporter plasmids carrying Nmdar2, D2R and GABA-B-R3 3’UTR fragments containing miR-137 binding sites (Fig 9A). [score:7]
GABAergic synapse Glutamatergic synapse hsa-miR-137-3p targets GABRA1 ADCY1 PLCL1 ADCY2 ADCY1 GRM5 ADCY2 SLC17A6 GABRG2 CPD GABBR2 PLCB1 GAD2 PPP3CB GABRA6 DLGAP1 SRC GRM7 CACNA1D CACNA1D ADCY9 GRIN2A SLC6A1 ADCY9 KCNJ3 SLC1A2 In order to further confirm dme-miR-137 could directly regulate targets in neuroactive-ligand receptor interaction pathway, we constructed luciferase reporter plasmids carrying Nmdar2, D2R and GABA-B-R3 3’UTR fragments containing miR-137 binding sites (Fig 9A). [score:7]
By regulating expression of nuclear receptor tailless (TLX) and lysine-specific demethylase 1 (LSD1) in neural stem cells, miR-137 controls the dynamics between neural stem cell proliferation and differentiation during neural development [63]. [score:5]
Among 154 coexpressed miRNAs, five mature miRNAs (dme-miR-1008-5p, dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p, dme-miR-932-5p) were differentially expressed between PD and control groups (p<0.05) (Table 2 and S5 Table). [score:5]
Among the dysregulated miRNAs, miR-13b, miR-133 and miR-137 were highly conserved from Drosophila to H. sapiens and their expression was validated by qRT-PCR. [score:4]
We found that five miRNAs (dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p, dme-miR-932-5p, dme-miR-1008-5p) were upregulated in PD flies. [score:4]
Luciferase reporter assays confirmed dme-miR-137 could inhibit the targets in neuroactive-ligand receptor interaction pathway. [score:4]
Our study using high throughput sequencing of miRNAs identified miR-13b, miR-133, miR-137, miR-932 and miR-1008 consistently upregulated in early stage PD flies. [score:4]
Taken together, these results indicate that NMDAR2, D2R and GABA-B-R3 are direct targets for dme-miR-137-3p. [score:4]
As four of the dysregulated miRNAs in PD flies including dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p and dme-miR-932-5p were brain enriched, we predicted targets of them and then submit to DAVID for Gene Ontology analysis (Fig 6 and S7 Table). [score:4]
The regulatory effects of miR-137 on GRIN2A expression have been confirmed in human neuronal like SH-SY5Y cells [23]. [score:4]
Recently, it was reported that miR-137 and its seed-similar fly homologue miR-1000 regulated vesicular glutamate transporter (VGlut) expression and fine-tune excitatory synaptic transmission [65]. [score:4]
Luciferase reporter assay showed that miR-137 could target GRIN2A directly in Rats [24], suggesting the regulatory mechanisms seemed to be highly conserved from Drosophila to humans. [score:4]
MiR-137 is also a highly conserved miRNA and exerts important roles in neuronal development and diseases. [score:4]
As shown in S3 Fig and Table 4, miR-137-3p potentially targeted Nmdar2 (receptor for N-Acetylaspartyl glutamate and Glutamate, L-asparate, L-cysteic acid, L-homocysteic acid), GABA-B-R1/GABA-B-R3 (GABA receptor) and D2R/DopR (Dopamine receptor). [score:3]
The hsa-miR-137-3p targets predicted by DIANA miRPath v. 2.0 in Glutamatergic synapse pathway were shown in red square. [score:3]
Target genes for hsa-miR-137-3p in GABAergic synapse and Glutamatergic synapse pathway in Homo sapiens. [score:3]
Further more, when we mutated both of miR-137 binding sites in D2R 3’UTR, the inhibitory effects were abolished (Fig 9C). [score:3]
We examined the transcriptional levels of miR-137 targets in neuroactive ligand-receptor interaction pathway. [score:3]
The hsa-miR-137-3p targets predicted by DIANA miRPath v. 2.0 in GABAergic synapse pathway were shown in red square. [score:3]
Taken together, ɑ synuclein may induce miR-137 expression by transcription factor CREB and NF-κB. [score:3]
MiR-137 could also regulate neuronal maturation by targeting ubiquitin ligase mind bomb-1 [64]. [score:3]
In another neurodegenerative disorder Alzheimer’s disease, miR-137 is found to be associated with serine palmitoyltransferase (SPT) and amyloid β (Aβ) levels [71]. [score:3]
Luciferase reporter assays showed that dme-miR-137-3p could does -dependently inhibit the luciferase activities for all these vectors as compared with miR -negative control, indicating that dme-miR-137-3p could target these predicted sites (Fig 9B). [score:3]
Interestingly, hsa-miR-137-3p was also predicted to target KEGG pathways including Glutamatergic synapse (hsa04724) (p = 0.001749507) and GABAergic synapse (hsa04727) (p = 0.007160067) by DIANA miRPath analysis. [score:3]
GABA-B receptor (GABRA1, GABRA6, GABBR2) and NMDA receptor (GRIN2A) were identified as hsa-miR-137-3p targets (Table 5). [score:3]
qRT-PCR were performed to validate the expression of dme-miR-13b-3p, dme-miR-133-3p and dme-miR-137-3p in control and PD flies. [score:3]
Luciferase reporter assay showed that miR-137 could target GRIN2A directly in Rats [24]. [score:3]
0137432.g005 Fig 5 qRT-PCR were performed to validate the expression of dme-miR-13b-3p, dme-miR-133-3p and dme-miR-137-3p in control and PD flies. [score:3]
Further studies showed miR-137 targeted multiple molecules in this pathway as predicted, including dopamine receptor (DopR, D2R), GABA receptor (GABA-B-R1, GABA-B-R3) and NMDA receptor (Nmdar2). [score:3]
The 3’UTR fragments flanking miR-137 targeting sites of Nmdar2, D2R and GABA-B-R3 were cloned from Drosophila cDNA library and inserted into pGL3-promoter vectors respectively. [score:3]
NMDA receptor GRIN2A was also predicted to be targeted by miR-137 in Homo sapiens, which have been validated in human SY-SH5Y cells [23]. [score:3]
The mechanistic studies reveal that miR-137 regulates gene sets involved in synaptogenesis and neuronal transmission as well as glucocorticoid receptor -dependent signalling network, contributing to etiology of schizophrenia [23, 70]. [score:2]
In addition, CREB and NF-κB were also predicted to bind to hsa-miR-137 promoter, indicating the regulatory mechanisms were highly conserved. [score:2]
Our results were consistent with previous reports that PD was associated with neuroactive ligand-receptor interaction pathway [22] and miR-137 could regulate synaptogenesis and neuronal transmission [23]. [score:2]
The results showed that dme-miR-137-3p could inhibit the luciferase activities for all these vectors does dependently as compared with miR -negative control. [score:2]
Using high throughput small RNA sequenceing technology, we measured miRNA expression profiles of early stage PD flies and identified five dysregulated mature miRNAs (miR-13b, dme-miR-133, dme-miR-137, miR-932 and miR-1008). [score:2]
Each of these vectors was co -transfected with Renilla plasmid pRL-TK and dme-miR-137-3p mimics (Genepharma, Shanghai) into HEK 293 cells in 12-well plates using Lipofactamine 2000 (Invitrogen). [score:1]
0137432.g009 Fig 9 (A) 3′UTRs of Nmdar2, D2R and GABA-B-R3 containing dme-miR-137-3p binding sites predicted by DIANA—microT (shown in square) were cloned into pGL3-promoter vectors. [score:1]
Among them, dme-miR-133-3p, dme-miR-137-3p and dme-miR-13b-3p (the mature sequence both for dme-mir-13b-1 and dme-mir-13b-2) were highly conserved from flies to humans and enriched in nervous system. [score:1]
miR-137 is also proved to be associated with schizophrenia susceptibility, which usually accompanied with PD [67– 69]. [score:1]
Among them, miR-13b, miR-133, miR-137 are brain enriched and highly conserved from Drosophila to Homo sapiens. [score:1]
We analyzed the promoter region of dme-miR-137 (5kb upstream of pre-dme-miR-137) using AliBaba2.1 based on TRANSFAC 4.0 and found three CREB binding sites as well as six NF-κB binding sites. [score:1]
In addition, miR-137 also plays important roles in brain disorders. [score:1]
[1 to 20 of 44 sentences]
14
[+] score: 119
We also identified that miR-137 and miR-9 directly downregulate CUL4A expression by targeting the 3′-UTR of its mRNA, and indirectly regulate downstream Hippo-YAP signaling in GC. [score:11]
Western blotting results showed that overexpressing miR-9 and miR-137 significantly reduced CUL4A protein expression in HGC-27 cells; whereas, overexpressing miR-103 and miR-107 had no effect on CUL4A protein expression (Figure 5B). [score:9]
As shown by western blotting in Figure 6D, overexpressing miR-9 and miR-137 in HGC-27 cells resulted in the upregulation of LATS1 and p-YAP and downregulation of CUL4A, but no change in MST1/2. [score:9]
Moreover, we showed that miR-9 and miR-137 targeted CUL4A in GC cells, thereby indirectly regulating the LATS1-Hippo signaling pathway and promoting cell proliferation and invasion. [score:5]
Luciferase expression from the wild-type but not from mutant 3′-UTR constructs was significantly suppressed by miR-9 and miR-137 (Figure 5E). [score:5]
This is supported by our observation that overexpressing miR-9 and miR-137 suppressed the proliferation and invasion of GC cells in vitro (Figure 6A, 6B, 6C). [score:5]
C. suggested an inverse correlation between miR-137 and miR-9 expression and CUL4A and YAP protein expression, respectively. [score:5]
CUL4A is a direct target of miR-9 and miR-137. [score:4]
Our findings suggest that miR-9 and miR-137 might regulate Hippo-YAP signaling in GC cells by targeting CUL4A. [score:4]
These data support that the CUL4A 3′-UTR is a direct target of miR-9 and miR-137 in GC cells. [score:4]
To determine whether miR-9 and miR-137 repressed CUL4A expression by targeting its 3′-UTR, wherein the predicted binding sites were disrupted, were cloned into luciferase reporter vectors and tested using luciferase activity assays (Figure 5D). [score:4]
Four miRNAs, including miR-103, miR-107, miR-9, and miR-137 (Figure 5A), were predicted using two independent miRNA databases: TargetScan (http://www. [score:3]
B. Western blotting results showed that the overexpression of miR-9 and miR-137 significantly reduced CUL4A protein levels in HGC-27, SGC-7901 and BGC-823 cells; whereas, miR-103 and miR-107 had no effect on CUL4A protein levels. [score:3]
Predicted miRNA binding regions for miR-9 and miR-137 in the 3′-UTR of CUL4A were subcloned into the pMIR-REPORT Luciferase miRNA expression vector (pLuc, Ambion, Waltham, MA, USA). [score:3]
We observed that the expression of miR-137 was inversely correlated with protein levels of CUL4A (Figure 8C, R=−0.593, P=0.025) and YAP (Figure 8C, R=−0.576, P=0.031). [score:3]
A. The relative levels of miR-9 and miR-137 expression in 14 fresh GC tissues were determined by qPCR. [score:3]
In addition, miR-137 decreased the expression of CTGF, CYR61, AREG, and c-Myc, but not of CDX2 (Figure 6F). [score:3]
Several studies have demonstrated that miR-9 and miR-137 are decreased in human GC tissues and cell lines, suggesting that they function as tumor suppressors [23, 24]. [score:3]
We detected the expression of miR-9 and miR-137 in addition to CUL4A and YAP proteins in 14 fresh GC tissues, which included seven clinical stage I-II and seven clinical stage III-IV samples (Figure 8A, 8B). [score:3]
Figure 8 A. The relative levels of miR-9 and miR-137 expression in 14 fresh GC tissues were determined by qPCR. [score:3]
Importantly, co-transfecting miR-9 or miR-137 with a CUL4A gene construct missing its 3′-UTR into MGC-803 or BGC-823 cells rescued miR-9/137 -mediated inhibition of GC cell invasion (Figure 7A), cell proliferation (Figure 7B) and EMT (Figure 7C) through the Hippo pathway (Figure 7C). [score:3]
Moreover, overexpression of miR-9 and miR-137 significantly reduced CUL4A protein levels in two other cell lines, SGC-7901 and BGC-823 (Figure 5B). [score:3]
Here, using bioinformatics and luciferase reporter assays, we identified that the miRNAs, miR-9 and miR-137, directly target the 3′-UTR of CUL4A transcripts. [score:3]
miR-9 and miR-137 regulate the CUL4A-LATS-Hippo signaling pathway. [score:2]
E. In luciferase activity assays, miR-9 and miR-137 suppressed luciferase activity of the wild-type but not mutant CUL4A 3′-UTR constructs in 293 cells. [score:2]
C. miR-9 and miR-137 inhibited HGC-27 cell invasion in Transwell chamber assays. [score:2]
miR-9 and miR-137 regulate Hippo-YAP signaling. [score:2]
D. Western blotting results ofthe levels of proteins in CUL4A-LATS1-Hippo signaling pathway in HGC-27 cells after transfecting with CUL4A-siR-1, miR-9 or miR-137, respectively. [score:1]
In addition, immunofluorescence results showed that the nuclear distribution of YAP was reduced after transfecting HGC-27 cells with miR-9 and miR-137 mimics (Figure 6E). [score:1]
Importantly, a significant correlation among miR-137/9, CUL4A and YAP was observed in GC samples. [score:1]
Hence, a miR-137/9-CUL4A-Hippo signaling axis that results in the inactivation of Hippo promotes GC proliferation and invasion. [score:1]
F. Levels of mRNA for the indicated genes in the Hippo signaling pathway were decreased by miR-9 and miR-137 in HGC-27 cells. [score:1]
C. Western blotting results of the levels of the indicated proteins in HGC-27 cells co -transfected with 3′-UTR-less CUL4A and miR-9 or miR-137. [score:1]
HEK293 cells were seeded in 24-well plates at a density of 1×10 [5] cells per well and transiently transfected with wild type or mutant luciferase reporter plasmids (miR-9, miR-137 and the negative control) at a final concentration of 50 nM. [score:1]
E. Immunofluorescence results of YAP in GC cells transfected with miR-9 and miR-137 mimics. [score:1]
C. Quantitative PCR results of CUL4A mRNA levels after transfecting GC cells with miR-9 and miR-137 mimics. [score:1]
D. Schematic of the miR-137/9-CUL4A-Hippo signaling axis in GC. [score:1]
[1 to 20 of 37 sentences]
15
[+] score: 107
Other miRNAs from this paper: hsa-mir-2682
Whilst DPYD is expressed almost ubiquitously across all tissues studied, MIR137 and EU359082 display indistinguishable expression profiles, with their expression being limited to the brain and pituitary in this data set. [score:7]
EU358092 (termed ‘jufobu’ in this database) displayed a similar expression pattern to that of MIR137, with highest expression restricted to the brain and pituitary gland, whereas DPYD was found to be expressed at high levels across the majority of tissues in all primate species tested (Supplementary Fig. 1). [score:7]
The broadly similar expression patterns of EU358092 and MIR137 may suggest co-ordinated expression of both RNAs, and point to an as yet undetermined brain-related function for EU358092 (Fig. 3). [score:5]
Analysis of its expression in vivo in the CNS (Figs. 3 and Supplementary Fig. 1) suggested co -expression of EU358092 and MIR137 in many cells. [score:5]
Similarly, brain microarray data showed MIR137 expression across regions of the prefrontal cortex, including the medial, dorsolateral, and ventrolateral regions, as well as being most highly expressed in the temporal association and temporal auditory cortices (Fig. 3b). [score:5]
The similar expression patterns of EU358092 and MIR137 across brain regions may suggest a co-ordinated pattern of expression for genes at this locus, pointing to a potentially important brain-related function for EU358092. [score:5]
EU358092 expression was found to be consistently lower than MIR137 across all primate species except humans, where MIR137 and EU358092 expression levels were identical in the human brain. [score:5]
Stimulus inducible expression of EU358092 in response to drug challenge was demonstrated in vitro in SH-SY5Y neuroblastoma cells, which was again similar to previous expression patterns observed for MIR137 (Fig. 4), consistent with both RNAs responding to related transcriptional cues. [score:5]
This pattern of expression in response to challenge was also seen for MIR137 (Warburton et al., 2015b) and may suggest related regulatory responses of transcripts at this locus. [score:4]
EU358092 was regulated in response to psychoactive compounds, with an increase in expression after 5 mM sodium valproate treatment, and a strong decrease after 10 μM cocaine treatment (Fig. 4a); this was analogous to our previous data on MIR137. [score:4]
The location of GWAS significant SNPs outside of the MIR137 sequence and protein coding regions of DPYD suggest that a regulatory mechanism might operate at this locus that could result in modulation of expression of these genes. [score:4]
Neither EU358092 nor MIR137 were found to be expressed in the thalamus or cerebellum. [score:3]
These targets have been postulated to include transcripts from many schizophrenia associated genes, such as CACNA1C, and thus MIR137 has been highlighted as a potential modulator of CNS function that could reveal underlying schizophrenia biology. [score:3]
This arrangement of schizophrenia GWAS SNPs in a haplotype block spanning EU358092 and MIR137 may suggest that schizophrenia risk at this locus is mediated through related mechanisms on multiple targets. [score:3]
We have previously demonstrated that expression of MIR137 in this cell line was inducible by drug action (Warburton et al., 2015b). [score:3]
As a microRNA, MIR137 will modulate multiple mRNA targets, with consequences at the protein level. [score:3]
Supplementary Fig. 1 Tissue expression profile of EU358092, MIR137, and DPYD in humans and primates. [score:3]
MIR137 was not found to be expressed in the thalamus or cerebellum. [score:3]
RNA-seq data from the Non-Human Primate Reference Transcriptome Resource (NHPRTR) comparing EU359082, MIR137, and DPYD expression across 16 tissues in humans and primates. [score:3]
Three SNPs at the MIR137 major and internal promoters were also incorporated into this analysis, including the schizophrenia GWAS SNP, rs2660304, which resides at the internal MIR137 promoter, and which we have previously shown to support differential allele-specific expression (Warburton et al., 2015a). [score:3]
Fig. 3 Comparison of MIR137 and EU358092 expression in vivo. [score:3]
3.4Expression of EU358092 in vivo across primate species was compared to MIR137 and DPYD by analysis of RNA-seq data from the Non-Human Primate Reference Transcriptome Resource (NHPRTR, accessed via AceView). [score:2]
We have previously used bioinformatic and functional genetics to address differential regulation of MIR137 (Warburton et al., 2015a, Warburton et al., 2015b). [score:2]
3.1 of the MIR137 locus identifies regions of conservation and transcriptional activityIdentification of non-coding evolutionary conserved regions (ECRs) at the MIR137 locus is likely to highlight important functional domains, such as transcriptional or post-transcriptional regulatory elements, in addition to other RNAs. [score:2]
Identification of non-coding evolutionary conserved regions (ECRs) at the MIR137 locus is likely to highlight important functional domains, such as transcriptional or post-transcriptional regulatory elements, in addition to other RNAs. [score:2]
EU358092 lncRNA microRNA-137 Schizophrenia Chromosome 1p21.3 (chr1:98298371-98581337, GRCh37/hg19) has consistently been associated with schizophrenia by genome-wide association studies (GWAS) (Ripke et al., 2013, Ripke et al., 2011). [score:1]
Points above the green line represent GWAS SNPs with a statistically significant P-value of 5.0 × 10 [− 8] or more, demonstrating high genome-wide association for schizophrenia across the locus, which expands from MIR137 into EU358092 and the neighbouring gene, DPYD. [score:1]
The schizophrenia GWAS SNPs at EU358092 were in LD with the schizophrenia GWAS SNP rs2660304 at the MIR137 internal promoter. [score:1]
We demonstrated that EU358092 was as conserved as MIR137 (Fig. 1) and that the mRNA was tagged by many SNPs significantly associated with schizophrenia by GWAS over the locus (Fig. 2). [score:1]
For example, using the UCSC Genome Browser's Multiz 100 vertebrate genome alignment tool, the exons of EU358092 were shown to be conserved to the same degree as the second exon of the MIR137 short transcript, AK311400, exons 3 and 4 of the long MIR137HG transcript, and the second MIR137 locus microRNA, MIR2682 (Fig. 1a). [score:1]
Bioinformatic analysis of the MIR137 locus identifies regions of conservation and transcriptional activity. [score:1]
Efforts to understand the significance of this locus have predominantly focused on the function of one of the genes within this locus, MIR137, and to a lesser extent its neighbouring gene, DPYD (dihydropyrimidine dehydrogenase), which has also been implicated in a range of neurological and psychiatric conditions (Carter et al., 2011, Prasad et al., 2012, Xu et al., 2012). [score:1]
GWAS has identified the MIR137/DPYD locus on chromosome 1p21.3 as being strongly associated with schizophrenia. [score:1]
org; accessed 01/03/2015) to identify ECRs of interest at the MIR137 locus. [score:1]
The functional significance of the GWAS across this locus may be highlighting either EU358092 or MIR137, which may be acting separately or synergistically to influence the association across this locus with schizophrenia. [score:1]
LD analysis showed that six of the seven EU358092 schizophrenia GWAS SNPs tested were in complete LD with each other, and formed a haplotype block which spanned the MIR137 transcript, including complete (D′ = 1) or strong (D′ ≥ 0.85) LD with the MIR137 internal promoter SNP. [score:1]
Specifically, EU358092 demonstrated many of the characteristics of MIR137 with regard to genetic association and expression in vivo and in vitro. [score:1]
Our analysis, using both the UCSC and ECR genome browsers, identified ECRs between DPYD and MIR137 (chr1:98,395,390–98,407,578; GRCh37/hg19) (Fig. 1). [score:1]
[1 to 20 of 38 sentences]
16
[+] score: 73
Of the two miRNAs predicted to target EGR2, miR-19b was downregulated, which in accordance with the increased expression of EGR2, while miR-137 was downregulated only at T1 followed by upregulation from T2 to T4. [score:14]
Rno-miR-19a, rno-miR-19b-2 and rno-miR-214 were downregulated at all four time-points, while rno-miR-137 was downregulated at T1 followed by upregulation from T2 to T4 (Fig.   6). [score:10]
A previous study also demonstrated that miR-137 promotes proliferation and represses differentiation of NSCs by targeting Ezh2 [39] and regulates NSC maturation by targeting mind bomb-1 [40]. [score:6]
Rno-miR-19a (Rno, Rattus Norvegicus) and rno-miR-137, and their target gene EGR2, as well as rno-miR-19b-2 and rno-miR-214 and their target gene ARC were found to be closely related to neural developmental processes, including proliferation, differentiation, and maturation of NSCs. [score:6]
The expression of four miRNAs (rno-miR-19a, rno-miR-137, rno-miR-19b-2 and rno-miR-214) and their target genes (EGR2 and ARC) were shown to be regulated by propofol in primary cultured embryonic NSCs. [score:6]
The results of the present study indicate that propofol may have the ability to regulate the expression of rno-miR-19a, rno-miR-137, rno-miR-19b-2 and rno-miR-214 and their target genes, ARC and EGR2. [score:6]
Relative expression levels of rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214 at all four time-points (immediately (T1), Day 1 (T2), Day 3 (T3) and Day 7 (T4) after treatment with propofol or DMSO). [score:3]
The fold-change in the mean expression levels of rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214 ranged from -2.56 to -12.15, -2.02 to 4.61, -2.33 to -6.68 and -2.16 to -4.63, respectively (Table  5). [score:3]
The expression patterns obtained in the present study combined with the results of these previous reports indicate that miR-19b and miR-137 interact with EGR2 to promote proliferation and repress the differentiation of NSCs. [score:3]
In this way, we confirmed two genes (EGR2 and ARC) and four miRNAs (rno-miR-19a, rno-miR-137, rno-miR-19b-2 and rno-miR-214) that exhibited at least a 2-fold change in the mean expression level following propofol treatment at all four time-points. [score:3]
Fig. 6Quantitative RT-PCR analysis of relative expression levels of rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214. [score:3]
Sun G Ye P Murai K Lang MF Li S Zhang H Li W Fu C Yin J Wang A miR-137 forms a regulatory loop with nuclear receptor TLX and LSD1 in neural stem cells. [score:2]
However, the potential relationship between EGR2 and miR-19b/miR-137 on the development of NSCs remains to be fully elucidated. [score:2]
Shi et al. found that miR-137 exerts a negative effect on proliferation of embryonic NSCs and then accelerates differentiation via a feedback regulatory loop with TLX and LSD1 [38]. [score:2]
MiR-137, miR-124, miR-34a, and miR-34c have also been implicated in ketamine -induced neurotoxicity in various in vivo and in vitro mo dels [20– 23]. [score:1]
MiR-137 is a versatile miRNA that plays different roles in the proliferation, differentiation and maturation of NSCs. [score:1]
MiR-124 and miR-137 affect early neurogenic response through cooperative control of caspase-3 activity [13]. [score:1]
The miRNAs predicted by all four databases (rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214, (Rno, Rattus Norvegicus)) were selected for validation (Table  4 and Fig.   5). [score:1]
[1 to 20 of 18 sentences]
17
[+] score: 65
Other miRNAs from this paper: hsa-mir-141, hsa-mir-200a
Taken together, these results showed that BBP reduced PITX2 expression in EN-MSC differentiation (Fig.   2B) via increased expression of miR-137 (Fig.   2C), its upstream negative regulator. [score:6]
miR-137 down-regulates PITX2 by targeting the 3′UTR. [score:6]
Ectopic miR-137 expression decreased the expression of the myogenic marker MyoD, PITX2 in differentiated condition (Fig.   3D), which supports the hypothesis that BBP exerts its effect on EN-MSC myogenic differentiation through the action of miR-137. [score:5]
miR-137 affects myogenesis through PITX2To understand the extent to which miR-137 affects EN-MSC differentiation through PITX2 directly, we used a short hairpin RNA (shRNA) to knockdown PITX2 expression (Fig.   4A). [score:5]
To understand the extent to which miR-137 affects EN-MSC differentiation through PITX2 directly, we used a short hairpin RNA (shRNA) to knockdown PITX2 expression (Fig.   4A). [score:5]
Over -expression of miR-137 decreased the level of PITX2 and MyoD, whereas knock-down of mir-137 increase the levels of PITX2 and MyoD (Fig.   3C). [score:4]
Figure 3 PITX2 mRNA is a direct target of miR-137. [score:4]
These results indicated that, in our experimental system, PITX2 was indeed a direct target of miR-137. [score:4]
Although several studies have demonstrated that miR-137 functions in neurogenesis or adipogenesis in stem cells 50, 51, ours is the first study to demonstrate that BBP administration modulates miR-137 level and to identify PITX2 as a novel miR-137 downstream target during myogenic differentiation. [score:3]
The luciferase reporter showed that miR-137 inhibited the PITX2 wild-type reporter but did not affect the PITX2 mutant reporter (Fig.   3B). [score:3]
Next, we examined whether PITX2 expression was affected by miR-137. [score:3]
Overexpression of precursor-miR-137 in EN-MSCs reduced the PITX2 transcript level (Fig.   2D). [score:3]
To test whether miR-137 targets PITX2, the 3′UTR of PITX2, which contains a miR-137 binding site, was cloned into the pGL-2 control vector to create a luciferase reporter system (Fig.   3A). [score:3]
org/) to select three candidate miRNA regulators of PITX2: miR-137, miR-141 and miR-200a. [score:2]
Precursor-miR-137 effectively decreased the transcript level of PITX2. [score:1]
Co-transfection was performed with pre-miR-137 (precursor control) and pGL2-PITX2 3′UTR (mutant version of pGL2-PITX2 3′UTR). [score:1]
Cells were seeded onto 48-well culture plates and co -transfected with 200 ng of vector pGL2-PITX2–3′UTR or pGL2 that contained a mutant version of the PITX2 3′UTR, 200 ng pre-miR-137 or a precursor control, 30 ng luciferase reporter, and 5 ng Renilla luciferase reporter. [score:1]
The following plasmids were used: Precursors of miR-137 and anti-miR-137 plasmids were purchased from System Biosciences. [score:1]
Further, we performed western blotting to confirm whether miR-137 affects the protein level of PITX2 and MyoD. [score:1]
These data suggested that the BBP -induced effects on the level of PITX2 transcript are mediated through miR-137. [score:1]
Cotransfection was performed with pre-miR-137 (precursor control) and either wild-type pGL2-PITX2 3′UTR or a mutant derivative. [score:1]
miR-137 affects myogenesis through PITX2. [score:1]
BBP treatment increased the level of miR-137 in EN-MSCs, whereas the levels of miR-141 and miR-200a were not affected (Fig.   2C). [score:1]
[1 to 20 of 23 sentences]
18
[+] score: 64
In organoid growth assays, miR-137 specifically suppresses the development of organoids derived from colorectal CSCs through the inhibition of DCLK1 without affecting that of normal intestinal organoids, suggesting that miR-137 is a putative therapeutic target for colorectal CSC targeting therapy with less effect on the normal colorectal tissues. [score:9]
The roles of RBPs targeted by these miRNAs are described in Chapter 4. In addition, miRNAs, such as miR-137 and miR-221, are differentially expressed between CSCs and normal intestinal stem/progenitor cells, and will be candidate molecules to target CSCs in colorectal cancers (Figure 2B). [score:7]
Although the number of studies that analyzed the miRNA expression and/or functions in colorectal CSCs is still limited, miRNAs, such as miR-200 family miRNAs, miR-203, miR-137, miR-34a and miR-221, function as the regulator of stem cell properties in colorectal CSCs by targeting various genes involved in the regulation of CSC properties (Figure 2A). [score:7]
Liu M. Lang N. Qiu M. Xu F. Li Q. Tang Q. Chen J. Chen X. Zhang S. Liu Z. Mir-137 targets cdc42 expression, induces cell cycle g1 arrest and inhibits invasion in colorectal cancer cellsInt. [score:6]
miR-137 negatively regulates the progression of colorectal cancer through directly targeting the oncogenes, such as MSI1, FMNL2 and CDC42 [97, 98, 99]. [score:5]
Recent study reported that miR-137 suppresses the expression of DCLK1, a microtubule -associated protein with C-terminal serine/threonine kinase domain. [score:5]
Chen Q. Chen X. Zhang M. Fan Q. Luo S. Cao X. miR-137 is frequently down-regulated in gastric cancer and is a negative regulator of cdc42Dig. [score:5]
Sakaguchi M. Hisamori S. Oshima N. Sato F. Shimono Y. Sakai Y. Mir-137 regulates the tumorigenicity of colon cancer stem cells through the inhibition of dclk1Mol. [score:3]
In contrast, miR-137 is much highly expressed in normal intestinal stem/progenitor cells than in colon CSCs (Figure 2B) [102]. [score:3]
Silber J. Lim D. A. Petritsch C. Persson A. I. Maunakea A. K. Yu M. Vandenberg S. R. Ginzinger D. G. James C. D. Costello J. F. miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cellsBMC Med. [score:3]
miR-137 suppresses stem cell functions in various types of stem cells, such as neural stem cells and embryonic stem (ES) cells [100]. [score:3]
miR-137 is located on human chromosome 1p21 and has been implicated to act as a tumor suppressor in colorectal and gastric cancers, glioblastoma and melanoma [93, 94, 95, 96]. [score:3]
Bemis L. T. Chen R. Amato C. M. Classen E. H. Robinson S. E. Coffey D. G. Erickson P. F. Shellman Y. G. Robinson W. A. MicroRNA-137 targets microphthalmia -associated transcription factor in melanoma cell linesCancer Res. [score:2]
Balaguer F. Link A. Lozano J. J. Cuatrecasas M. Nagasaka T. Boland C. R. Goel A. Epigenetic silencing of miR-137 is an early event in colorectal carcinogenesisCancer Res. [score:1]
3.1.4. miR-137. [score:1]
Epigenetic silencing of miR-137 by promoter hyper methylation contributes to early colorectal carcinogenesis [93]. [score:1]
[1 to 20 of 16 sentences]
19
[+] score: 56
HEY2 was revealed as a direct target of miR-137 that is frequently downregulated in human cancers including HCC. [score:7]
In HCC samples, HEY2 expression was inversely correlated to miR-137 expression. [score:5]
In contrast, miR-137 inhibitor induced the mRNA and protein expression of HEY2 in HepG2 and QGY-7404 cells (Figure 5D). [score:5]
HEY2 expression is inhibited by miR-137 in HCC cells. [score:5]
In clinical samples, miR-137 expression was reversely associated with the HEY2 mRNA expression in 18 HCC fresh tissues (Figure 5E). [score:5]
HEY2 was predicted as a direct target of miR-137. [score:4]
HEY2 is a direct target of miR-137. [score:4]
Furthermore, miR-137 has been demonstrated to inhibit neuronal maturation and dendritic morphogenesis [29], and to associate with unfavorable prognosis [26]. [score:3]
C. miR-137 was overexpressed in QGY-7703 and Bel-7402 cells for 48 hours. [score:3]
To date, another four genes (FOXO1 [25], AKT2 [26], CDC42 [27] and EDIL3 [28]) have been shown to be inhibited by miR-137. [score:3]
It should be of clinical significance to assess the prognostic implication of the combination of miR-137 and HEY2 expressions. [score:3]
D. The inhibitor of miR-137 was introduced into HepG2 and QGY-7404 cells for 48 hours. [score:3]
Results showed that overexpression of miR-137 significantly reduced the relative luciferase activity of wild-type HEY2 promoter but not of the mutant (Figure 5B). [score:3]
For the binding of miR-137 to HEY2 3′ UTR, Bel-7402 cells were co -transfected with miR-137 mimic or negative control and wild-type or mutant vectors for 36 hours. [score:1]
B. The relative luciferase activities modulated by miR-137 were analyzed in Bel-7402 cells. [score:1]
Re-introduce of miR-137 into QGY-7703 and Bel-7402 cells led to markedly decreased levels of HEY2 mRNA and protein (Figure 4C). [score:1]
[1 to 20 of 16 sentences]
20
[+] score: 55
Figure 4TINCR expression was inhibited by miR-137/ miR-133a(A) miR-137, miR-133a, and miR-137/ miR-133a cotransfection could suppress the luciferase activity in pmirGLO-TINCR transfected HUH7 cells. [score:7]
These data suggest that TINCR is a direct target of miR-137/ miR-133a, which is suppressed by miR-137/ miR-133a. [score:6]
Therefore, we could not conclude that miR-137 and miR-133a have synergistic roles in inhibiting TINCR expression in HCC. [score:5]
Moreover, the expression of TINCR protein was inhibited significantly in HUH7 cells by miR-137 and miR-133a, with the TINCR protein level decreased to 58.96 ± 2.52% and 35.03 ± 8.85% (Figure 4C,D, P=0.001 and 0.017), respectively. [score:5]
Although miR-137/ miR-133a cotransfection seemed to show more power than miR-133a in suppressing the expression of TINCR, it displayed less activity than miR-137. [score:5]
TINCR expression was inhibited by miR-137 and miR-133a. [score:5]
TINCR expression was inhibited by miR-137/ miR-133a. [score:5]
To investigate whether miR-137 and miR-133a could synergistically inhibit TINCR expression in HCC, the HUH7 cells were cotransfected with miR-137 and miR-133a, and subjected to luciferase assay and TINCR expression detection. [score:4]
We found that miR-137 and miR-133a co-transfection significantly decreased the luciferase activity (40.59 ± 6.37%), TINCR mRNA expression (53.06 ± 10.84%) and TINCR protein level (47.55± 5.08%) in HUH7 cells (Figure 4, P<0.05). [score:3]
showed that miR-137 and miR-133a could significantly reduce the TINCR mRNA expression level by 56.74 ± 4.92% and 50.13 ± 8.64% in HUH7 cells (Figure 4B, P=0.003 and 0.002), respectively. [score:3]
We next detected whether miR-137 and miR-133a could decrease TINCR mRNA expression levels in HCC cells. [score:3]
The luciferase assays demonstrated that miR-137 and miR-133a, rather than miR-126, miR-22, and miR-372 could significantly suppress the luciferase activity in pmirGLO-TINCR (3′-UTR) and miRNAs cotransfected cells (Figure 4). [score:2]
Data showed that miR-137 and miR-133a transfection led to 45.14 ± 7.31% and 35.87 ± 3.24% decrease in luciferase activity in HUH7 cells, respectively (Figure 4A, P=0.002 and 0.006). [score:1]
Based on these data and the previous reports about the candidate miRNAs’ function, six cancer-related or tumor-suppressing miRNAs were chosen for further investigation, including miR-198, miR-126, miR-133a, miR-137, miR-22, and miR-372 [18– 23]. [score:1]
[1 to 20 of 14 sentences]
21
[+] score: 52
The transcriptional regulatory activity of the ECRs, predicted from available ENCODE and expression data, was validated by reporter gene assay, and in conjunction with supporting data from the PGC schizophrenia GWAS studies, suggests a functional role for these sequences in the regulation of expression at the MIR137 locus. [score:6]
MIR137 is highly expressed in the brain and is known to function in neural development and adult neurogenesis (Smrt et al. 2010; Szulwach et al. 2010), as well as regulating synaptic plasticity (Siegert et al. 2015). [score:5]
Identifying non-coding evolutionary conserved regions (ECRs) is one method of determining regulatory domains that may influence gene expression at the MIR137 locus. [score:4]
The microRNA MIR137 is present within this locus, and subsequent work has revealed transcripts from other schizophrenia -associated loci as targets of MIR137 (Collins et al. 2014; Kim et al. 2012; Kwon et al. 2013), thereby suggesting MIR137 -mediated regulation of a larger network of genes and pathways relevant to mental illness. [score:4]
Schizophrenia microRNA-137 Gene regulation Gene expression Transcription Genetics Meta-analyses of schizophrenia genome-wide association studies (GWAS) data have identified a locus on chromosome 1p21.3 (chr1:98,298,371–98,581,337, GRCh37/hg19) to be among the most significantly associated regions for schizophrenia (Ripke et al. 2013; Schizophrenia Psychiatric Genome-Wide Association Study 2011). [score:4]
Sequencing of the MIR137 locus by Duan et al. revealed 133 new variants which are enriched in non-coding sequences, and one of these, a rare enhancer SNP 1:g. 98515539 A> T, was associated with schizophrenia and reduced enhancer activity of its flanking sequence, predicting lower expression of MIR137 (Duan et al. 2014). [score:3]
This demonstrates multiple ‘gene x environment’ pathways that could impact on MIR137 expression levels either individually or synergistically to modulate CNS behaviour, contributing to schizophrenia and potentially other brain-related conditions. [score:3]
gov/ieb/research/acembly/) lists this EST as being identified in nervous tissue, and data from Fig. 3a showed histone modifications around the MIR 1 ECR indicative of active transcription from this locus in the human brain As the MIR137 locus is shown to be highly associated with schizophrenia through GWAS, new ESTs and RNAs from within this region warrant further study for their potential involvement in brain development and function. [score:2]
We have demonstrated through reporter gene assays that the seven ECRs selected at the MIR137 locus can modulate reporter gene expression in the neuroblastoma cell line, SH-SY5Y (Fig. 4). [score:2]
The boxed region including MIR137 and upstream regions (chr1:98448000-98595000; GRCh37/hg19) displays the highest signal at this locus in terms of association for schizophrenia, suggesting that MIR137 and potential upstream regulatory regions are likely to be the causal association at this locus. [score:2]
In our study, we identified seven non-coding ECRs with potential transcriptional regulatory function at the schizophrenia -associated MIR137 locus (Fig. 1). [score:2]
gov/ieb/research/acembly/) lists this EST as being identified in nervous tissue, and data from Fig. 3a showed histone modifications around the MIR 1 ECR indicative of active transcription from this locus in the human brainAs the MIR137 locus is shown to be highly associated with schizophrenia through GWAS, new ESTs and RNAs from within this region warrant further study for their potential involvement in brain development and function. [score:2]
Using a similar strategy to better understand the genomic regulatory architecture around the MIR137 locus, we used the evolutionary conserved region (ECR) and UCSC Genome Browsers to align and compare multiple vertebrate genomes to identify and prioritise conserved domains of interest. [score:2]
This analysis also showed that schizophrenia GWAS SNPs within the ECRs at the MIR137 locus are preferentially in linkage disequilibrium with each other, whereas non-GWAS SNPs in the same ECRs are not. [score:1]
Fig. 2Linkage disequilibrium (LD) analysis of SNPs across the MIR137 ECRs: a) Schematic of MIR137 and upstream region containing the ECRs of interest, with PGC2 schizophrenia GWAS data overlaid, showing 80 schizophrenia GWAS SNPs across this locus. [score:1]
edu/pgc/downloads) over the MIR137 locus ECRs. [score:1]
edu) to identify ECRs of interest at the MIR137 locus. [score:1]
Additionally, the Broad Institute’s Ricopili tool was used to visualise schizophrenia GWAS SNPs from the ‘PGC_SCZ52_may13’ dataset across the MIR137 locus (http://www. [score:1]
Identification of ECRs at the MIR137 Locus. [score:1]
This identified four highly conserved regions upstream of MIR137 (MIR 3, 4, 6 and 7). [score:1]
In conclusion, bioinformatic analysis identified seven highly conserved, functional ECRs at the MIR137 locus. [score:1]
PGC2 data showed that the strongest GWAS signal at this locus was across MIR137 itself and extended significantly into the upstream region (Fig. 1). [score:1]
Three additional ECRs were selected for study due to their proximity to highly significant schizophrenia GWAS SNPs, namely rs1625579 and rs1198588; two were intronic, MIR 1 and 2, and one was upstream of MIR137, MIR 5. ECRs are herein named MIR 1–7 (Fig. 1). [score:1]
Fig. 1Schizophrenia genome-wide associated SNPs and evolutionary conserved regions (ECRs) at the MIR137 locus. [score:1]
[1 to 20 of 24 sentences]
22
[+] score: 45
Other miRNAs from this paper: hsa-mir-132
We showed that inhibition of MeCP2 affected the overexpression of miR-137 and decreased PTEN expression, while overexpression of miR-137 could also inhibit the expression of PTEN, suggesting that miR-137 is critical to the regulation of PTEN by MeCP2. [score:14]
Overexpression of miR-137 mimic reduced PTEN expression by about 56% (Figs 2C,D). [score:5]
Indeed, we found that miR-137 was up-regulated for over 2.1 fold in Mecp2 -knockout mouse cortical neurons, as demonstrated by Solexa -based RNA sequencing (RNA-seq) (Fig. 2A). [score:5]
To determine if miR-137 regulated the expression of PTEN, we transduced primary cultured neurons with miR-137 mimic oligonucleotides. [score:4]
In conclusion, we demonstrated that MeCP2 regulates PTEN expression via the specific miRNA, miR-137. [score:4]
MeCP2 regulates PTEN expression via miR-137. [score:4]
It is previous reported that MeCP2 represses miR-137 expression in neural stem cells 15. [score:3]
miR-137 is intermediate in MeCP2 regulation of PTEN. [score:2]
We also confirmed that pri-miR-137 levels were increased in primary cultured neurons transfected with lentivirus expressing GFP or MeCP2 RNAi compared with control neurons (Fig. 2B). [score:2]
These results suggest the existence of a regulatory cascade from MeCP2, miR-137, to PTEN (Fig. 2E). [score:2]
[1 to 20 of 10 sentences]
23
[+] score: 39
miR-137 has been reported to target the CtBP1, a co-repressor of various tumor suppressor genes [47]. [score:5]
Thus, CpG islands of 9 disease-related miR genes, including 5 extragenic miR genes or gene clusters (miR-9-3, miR-137, miR-200b/200a/429, miR-203, and miR-375) and 4 intragenic genes or gene clusters (miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210), were selected as the representative genes in the present study (Additional file 1: Table S1). [score:3]
Most importantly, an inverse relationship between miR methylation and the corresponding expression level was observed for miR-9-1, miR-9-3, miR-137, and miR-200b in these gastric tissue samples (Spearman’s Rank Correlation analysis, miR-9-1, r [s] = −0.533, P = 0.001; miR-9-3, r [s] = −0.464, P = 0.004; miR-137, r [s] = −0.378, P = 0.019; miR-200b, r [s] = −0.409, P = 0.010; Figure 3H-K). [score:3]
However, a solid relationship between miR methylation and expression has not been thoroughly established as only weak supporting evidence has been provided in many of the previous studies, as we have summarized for 9 tested miR genes/clusters (extragenic miR-9-3, miR-137, miR-200b/200a/429, miR-203, miR-375; intragenic miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210) in this present study (Additional file 1: Table S2) [19- 27]. [score:3]
These findings strongly suggest that methylation of these miR CpG islands is related to the development of GCs (trend-test, miR-9-1, P < 0.001; miR-9-3, P < 0.001; miR-34b, P = 0.008; miR-137, P < 0.001; miR-210, P = 0.001; Table 1). [score:2]
The miRNA levels were then analyzed using a TaqMan Gene Expression Master Mix kit (Life Technologies) with the corresponding probe and primers (Life Technologies, miR-375 #TM000564, miR-34b #TM000427, miR-137 #TM000593, and miR-9 #TM000583). [score:2]
Inversed relationship between miR methylation of CpG islands and their corresponding expression levelsTo investigate the relationship between the above aberrant miR methylation and the transcription of the corresponding miR gene, we quantified the mature miRNA levels of miR-9-1, miR-9-3, miR-34b, miR-137, miR-210, miR-200b, (and miR-375), whose methylation status is related to the development of GC (and GC host adaptation) as described above, in a set of human cell lines with different methylation status of miR CpG islands. [score:2]
As is consistent with others’ reports [14, 15, 19, 25, 27, 36- 40], miR-9-1, miR-9-3, miR-34b, miR-137, and miR-375 methylation was observed in gastric carcinogenesis in the present study. [score:1]
miR-9-1 and miR-137 methylation may be a GC-specific event. [score:1]
DHPLC chromatogram of methylated and unmethylated miR-137 in various cell lines. [score:1]
Such an inverse relationships could also be observed for the miR-9-1, miR-9-3, miR-137, and miR-200b CpG islands in gastric tissue samples in vivo. [score:1]
Methylation frequency of 5 miR CpG islands (miR-9-1, miR-9-3, miR-137, miR-34b, and miR-210) gradually increased while the proportion of methylated miR-200b gradually decreased during gastric carcinogenesis (Ps < 0.01). [score:1]
The inverse relationship was also observed for miR-9-1, miR-9-3, miR-137, and miR-200b in gastric samples. [score:1]
In contrast, the overall survival of GC patients with miR-137 methylation was shorter than for those without methylation, but was not statistically significant (P = 0.181; Figure 4C). [score:1]
In the present study, we found that methylation or demethylation of all 7 tested miR CpG islands (GC-related miR-9-1, miR-34b, miR-9-3, miR-137, miR-210, miR-200b and host-related miR-375) was consistently, inversely correlated to a statistically significant level with their corresponding miRNA levels in a number of human cell lines in vitro. [score:1]
Except for miR-9-1 and miR-137, the methylation positive rates or proportions of methylated miR-9-3, miR-34b, miR-210, and miR-200b in GCs were similar to those in SMs (Table 1). [score:1]
We found that miR-137 methylation was also very common among gastritis lesion, SM, and GC samples (63% ~ 96%), and the positive rate of miR-137 methylation increased gradually in gastric tissues along with the severity of pathological changes. [score:1]
Many studies have reported miR-137 methylation in head and neck and colorectal carcinomas [22, 23, 48, 49]. [score:1]
In contrast, the positive rate of miR-137 methylation positively correlated with the depth of invasion, pTNM, lymph metastasis, and vessel embolus of GCs (trend-test for depth of invasion, P = 0.012; Pearson’s Chi-square test for pTNM/ lymph metastasis/ vascular embolus, P = 0.024/ 0.028/ 0.031). [score:1]
In addition, the positive rate of miR-9-1 methylation and the proportion of methylated miR-137 in elderly GC patients were significantly higher than in younger patients (Pearson’s Chi-square test, miR-9-1, P = 0.005; Student’s  t-test, miR-137, P = 0.009). [score:1]
The average proportion of the methylated miR-137 was also significantly higher in GCs than SMs (Mean ± SD, 26 ± 2 versus 38 ± 2, Paired t-test, P < 0.001). [score:1]
This is consistent previous study that has reported that miR-137 methylation (by MSP) correlated to the overall survival of 67 patients with head and neck carcinomas [49]. [score:1]
Therefore, miR-137 methylation may be another early epigenetic event that occurs during gastric carcinogenesis. [score:1]
The miRNA-137 levels in SMs were also higher than those in GCs, but was not statistically significant (P = 0.059). [score:1]
Because the proportion of methylated miR-137 showed a positive correlation with the invasiveness of GCs, miR-137 methylation may also affect the progression of the tumor. [score:1]
These results confirmed that miR-9-1 and miR-137 methylation was a tumor-specific event and that miR-9-3, miR-34b, and miR-210 methylation, as well as miR-200b demethylation, was a field-effect that occurred during gastric carcinogenesis. [score:1]
[1 to 20 of 26 sentences]
24
[+] score: 33
Here we have demonstrated that a mutation in rs17592236 may decrease the affinity for miR-137 to bind to the 3’UTR of FOXO1 mRNA and consequently reduce miR-137 -mediated inhibition of FOXO1 expression. [score:6]
Coexpression of miR-137 will subject this reporter mRNA to regulation by miR-137. [score:4]
The result of luciferase assays indicated that the expression of FOXO1-wild constructs was suppressed by miR-137, which was recovered when the potential miR-137 binding site rs17592236 was mutated. [score:4]
The present study provides evidence for a mo del in which miR-137 can modulate FOXO1 expression through SNP rs17592236 and thereby affecting the PI3K-Akt- FOXO1 axis in HCC carcinogenesis. [score:3]
org/) [20] revealed that all three SNPs are located within potential miRNA target sites: rs17592236 (miR-137), rs4946936 (miR-1182), rs4503258 (miR-1322). [score:3]
Importantly, Group 2 cells showed higher luciferase activity than Group 1 cells, suggesting that mutation in rs17592236 affected the binding affinity of miR-137 to 3’UTR in messenger RNA (mRNA) of FOXO1. [score:2]
Further research is needed to elucidate how miR-137 regulates the PI3K-Akt- FOXO1 axis in vivo and in vitro at the molecular level. [score:2]
MiR-137 is located on human chromosome 1p22 and has been suggested to function as a tumor suppressor via cell cycle control in several cancers including colorectal cancer [36], squamous cell carcinoma [37] and melanoma [38]. [score:2]
Additionally, miR-137 has been suggested to be involved in HCC [39], although the underlying mechanism was not clearly understood. [score:1]
This was most likely due to enhanced binding of has-miR-137 to the 3’UTR of FOXO1 mRNA. [score:1]
Group 3 cells received pMIR-REPORT plasmid and hsa-miR-137 miRNA mimics, whereas Group 4 cells received only transfection reagents and Group 5 cells received no transfection. [score:1]
When cells reached 80% confluence, they were transiently co -transfected with reporter plasmids and hsa-mir-137 mimics (Ambion) using Lipofectamine 2000 (Invitrogen) following manufacturer’s instructions. [score:1]
Group 1 and 2 cells were cotransfected hsa-miR-137 miRNA mimics (Ambion) along with the FOXO1-wild and FOXO1-mut plasmids, respectively. [score:1]
Cells were plated in 5 groups that each contained 6 wells: Group 1[(FOXO1-wild plasmids and hsa-miR-137 miRNA mimics (Ambion)], Group 2 (FOXO1-mut plasmids and hsa-miR-137 miRNA mimics), Group 3 (blank plasmids and hsa-miR-137 miRNA mimics), Group 4 (only transfection reagents), and Group 5 (293T cells without transfection). [score:1]
293T cells were co -transfected with miR-137 mimics and luciferase reporter constructs carrying FOXO1 3’UTR or rs17592236 mutated FOXO1 3’UTR fragment. [score:1]
[1 to 20 of 15 sentences]
25
[+] score: 33
According to the targets of miR-137 which are known, the first process can be mediated by Mib1 down-regulation (Smrt et al., 2010), while the second one is mediated by the down-regulation of GRIA1, a critical component of AMPA receptors (Olde Loohuis et al., 2015). [score:9]
MicroRNA miR-137 regulates neuronal maturation by targeting ubiquitin ligase mind bomb-1. Stem Cells 28, 1060– 1070. [score:4]
miR-137 modulates a tumor suppressor network-inducing senescence in pancreatic cancer Cells. [score:3]
One might speculate that for opposite reasons, both the Older Men Group and the Older Women Group could have a null final effect concerning their targets CPLX1 and SYN3 despite their differential content in miR-137. [score:3]
Transcriptional targets of the schizophrenia risk gene MIR137. [score:3]
On the contrary, in the Old Women Group, where miR-137 is lower, CPLX1 will be increased inhibiting SNARE, whilst SYN3 will also be increased, favoring the availability of vesicles. [score:3]
However, because SYN3 (Synapsin III) will also be diminished (SYN3 is another miR-137 target), the presynaptic vesicles would be unavailable for release because they would not be bound to the cytoskeleton (Tang et al., 2015), thus any observable effect is neutralized. [score:3]
As the target molecule CPLX1 (Complexin 1) diminished due the presence of high-miR-137 in the Older Men Group compared to the Older Women Group, an increased release of glutamate from the pre-synaptic vesicles could be expected, because SNARE will be activated (Martin et al., 2011). [score:2]
Note that, miR-137 is associated to sharp effects in both interaction and age, but actually corresponds to different probes annotated to a same nominal gene. [score:1]
Interestingly, miR-137 showed a very high, negative interaction (super-ratio = −7) much higher than that observed for the same microRNA as age effect (coefficient = −1.36). [score:1]
The highly negative interaction effect detected in miR-137 could have some un-expected effects. [score:1]
[1 to 20 of 11 sentences]
26
[+] score: 29
Developmental suppression of schizophrenia -associated miR-137 alters sensorimotor function in zebrafish. [score:4]
A very recent in-depth study in a zebrafish mo del system by Giacomotto et al. (2016) has reported that a slight change in synaptic function or a defect in the axonal network mediated by schizophrenia -associated suppression of miR-137 is likely responsible for the behavioral phenotype. [score:3]
MIR137 gene and target gene CACNA1C of miR-137 contribute to schizophrenia susceptibility in Han Chinese. [score:3]
When it comes to the schizophrenia -associated ncRNAs miR137 and Gomafu, it is possible to target these two ncRNAs simultaneously and investigate if miRNA137 and Gomafu each alone or in combination affect the development and progression of schizophrenia. [score:2]
Meta gene set enrichment analyses link miR-137-regulated pathways with schizophrenia risk. [score:2]
Polymorphisms in MIR137HG and microRNA-137-regulated genes influence gray matter structure in schizophrenia. [score:2]
International Schizophrenia Consortium et al. (2009) reported that the genetic elements for a small ncRNA, the microRNA137 (MIR137) gene with chromosomal location 1p21.3, have been the schizophrenia -associated loci, conferring susceptibility to schizophrenia and the discovery has received great attention within the field. [score:1]
The miR-137 schizophrenia susceptibility variant rs1625579 does not predict variability in brain volume in a sample of schizophrenic patients and healthy individuals. [score:1]
Association of a miRNA-137 polymorphism with schizophrenia in a Southern Chinese Han population. [score:1]
MicroRNA-137 regulates a glucocorticoid receptor -dependent signalling network: implications for the etiology of schizophrenia. [score:1]
In the following large-scale genome-wide association study conducted by Franke et al. (2016) using more than 40,000 recruited participants, the rs1625579 polymorphism in the miRNA137 gene was identified to be strongly linked to schizophrenia (Schizophrenia Psychiatric Genome-Wide Association Study (GWAS) Consortium, 2011; Ma et al., 2014). [score:1]
The schizophrenia risk gene product miR-137 alters presynaptic plasticity. [score:1]
The molecular mechanism whereby the genetic variants of miR-137 confer a high risk of schizophrenia also has been shown to be related to a declined fronto-striatal brain white and gray matter structure but without changes in the volume of the local brain (Rose et al., 2014; Wright et al., 2016), which may cause symptoms such as poor concentration, low processing speed, cognitive impairment, etc. [score:1]
MIR137 variants identified in psychiatric patients affect synaptogenesis and neuronal transmission gene sets. [score:1]
The impact of genome wide supported microRNA-137 (MIR137) risk variants on frontal and striatal white matter integrity, neurocognitive functioning and negative symptoms in schizophrenia. [score:1]
The multifarious hippocampal functions of microRNA-137. [score:1]
Over past years, an increasing number of schizophrenia -associated ncRNAs such as miR-137, lncRNA Gomafu, etc. [score:1]
The genome-wide supported microRNA-137 variant predicts phenotypic heterogeneity within schizophrenia. [score:1]
In contrast to the above studies with microarray analysis, a genome-wide association study performed in a large-scale population revealed schizophrenia -associated non-coding genes, including miRNA genes, among which miRNA137 stands out (International Schizophrenia Consortium et al., 2009; Schizophrenia Psychiatric Genome-Wide Association Study (GWAS) Consortium, 2011). [score:1]
[1 to 20 of 19 sentences]
27
[+] score: 24
In the context of CRC, several such biomarkers have recently been described as potentially promising diagnostic biomarkers, including: SEPT9 (Septin 9), a member of the septin family involved in cytokinesis and cell cycle control [9], [10], [11]; ALX4 (Homeobox protein aristaless-like 4), a transcription factor involved in skull and limb development [12], [13]; TWIST1 (Twist homolog 1), an antiapoptotic and pro-metastatic transcription factor [14], [15]; IGFBP3 (Insulin-like grown factor binding protein 3), a member of the insulin-like growth factor binding protein family [16]; GAS7 (growth arrest-specific 7), which plays a putative role in neuronal development [17], [18]; and miR137, a non-coding microRNA which is embedded in a CpG island [17], [19], [20], [21]. [score:3]
Although work from our laboratory and other laboratories have previously provided data for the functional role of miR-137 and IGFBP3 methylation in colorectal cancer [21], [44], additional in-vitro and in-vivo studies in this regard may further facilitate in gathering a better understanding of the biological roles of these biomarkers in colorectal carcinogenesis. [score:1]
Accordingly, each gene was classified as methylated when mean methylation levels were higher than 7.1% for SEPT9, 35.7% for TWIST, 27.5% for IGFBP3, 53.5% for GAS7, 28.5% for ALX4, and 11.9% for miR137. [score:1]
0104285.g002 Figure 2Bisulfite pyrosequencing results of methylation of sept9 (a), twist1 (b), igfbp3 (c), alx4 (d), gas7 (e) and mir137 (f) comparing normal mucosa from healthy patients (n-n) and primary tumors from crc patients of all tnm stages i–iv. [score:1]
This diagnostic accuracy was further improved by combining the methylation status of two gene markers; in particular, the methylation status of IGFBP3+TWIST1 or IGFBP3+ miR137 had the highest accuracy values of 86% and 82.7% respectively, with sensitivity and specificity values > 80%. [score:1]
Furthermore, we found that the combination of miR137+ IGFBP3+TWIST1 methylation had the highest diagnostic accuracy, 92%, as shown in Table 1. [score:1]
In this study, four of the six genes were positively associated with the CIMP phenotype (ALX4, IGFBP3, GAS7, and miR137). [score:1]
The mean methylation levels for each gene in primary CRC tissues were: 23.8% for SEPT9, 50.5% for TWIST1, 44.9% for IGFBP3, 50.2% for GAS7, 36.5% for ALX4, and 35.3% for miR137. [score:1]
Based upon these analyses, the most frequently methylated markers in CRC tissues were the miR-137 gene (302/344, 87.7%), followed by IGFBP3 (289/348, 83%), TWIST1 (269/356, 75.6%), SEPT9 (244/346, 70.5%), ALX4 (214/350, 61.1%), and GAS7 (164/378, 43.3%). [score:1]
To the best of our knowledge, no previous study has examined the relationship between methylation of the SEPT9, IGFBP3, TWIST1, GAS7, ALX4, and miR137 genes with prognosis in patients with CRC, as well as the ability of these biomarkers to predict response to 5-FU -based adjuvant chemotherapy. [score:1]
By analyzing a large, population -based CRC cohort, we demonstrate the potential clinical significance of miR137 and IGFBP3 hypermethylation as promising diagnostic biomarkers in CRC. [score:1]
The promoter methylation status of six genes (SEPT9, TWIST1, IGFBP3, GAS7, ALX4 and miR-137) was analyzed in all 425 CRC patients, as well as in normal colonic mucosa from 21 healthy individuals with a normal colonoscopy. [score:1]
In the recent years, a number of promising gene methylation -based diagnostic biomarkers including SEPT9, TWIST 1, IGFBP3, GAS7, ALX4, and miR137 have been proposed for the early detection of colorectal neoplasia. [score:1]
Bisulfite pyrosequencing results for methylation of SEPT9 (A), TWIST1 (B), IGFBP3 (C), ALX4 (D), GAS7 (E) and miR137 (F) genes comparing normal mucosa from healthy controls (N–N) and primary tumors from CRC patients. [score:1]
Methylation of four genes, ALX4, IGFBP3, GAS7, and miR137, was significantly correlated with CIMP -positive tumors (p<0.001). [score:1]
Methylation status of the SEPT9, TWIST1, IGFBP3, GAS7, ALX4 and miR137 genes was studied by quantitative bisulfite pyrosequencing in a population -based cohort of 425 CRC patients. [score:1]
Figure S1 Representative pyrograms of methylation markers in the sept9, twist1, alx4, igfbp3, gas7, and mir137. [score:1]
linear regression analysis comparing tumor methylation of sept9 (a), twist1 (b), igfbp3 (c), alx4 (d), gas7 (e) and mir137 (f) vs age of the healthy control patients (years). [score:1]
Bisulfite pyrosequencing results of methylation of sept9 (a), twist1 (b), igfbp3 (c), alx4 (d), gas7 (e) and mir137 (f) comparing normal mucosa from healthy patients (n-n) and primary tumors from crc patients of all tnm stages i–iv. [score:1]
In summary, this study performed a comprehensive analysis of a large, population -based CRC cohort and clearly highlighted the potential roles of the methylation status of miR137 and IGFBP3 as diagnostic biomarkers in CRC patients. [score:1]
linear regression analysis comparing tumor methylation of sept9 (a), twist1 (b), igfbp3 (c), alx4 (d), gas7 (e) and mir137 (f) vs age of crc patients (years). [score:1]
0104285.g001 Figure 1Bisulfite pyrosequencing results for methylation of SEPT9 (A), TWIST1 (B), IGFBP3 (C), ALX4 (D), GAS7 (E) and miR137 (F) genes comparing normal mucosa from healthy controls (N–N) and primary tumors from CRC patients. [score:1]
[1 to 20 of 22 sentences]
28
[+] score: 24
In glioblastoma multiforme cells, expression of microRNA-137 could inhibit cancer cell proliferation [130]. [score:5]
Balaguer suggested that methylated microRNA-137 might have a therapeutic use as reverse expression of microRNA-137 in colorectal cancer cell could inhibit proliferation of colorectal cancer cells [131]. [score:5]
Downregulation of microRNA-137 by DNA methylation is an early event in colorectal cancer [131]. [score:4]
Downregulation of microRNA-137 has been reported in head and neck malignancies [128]. [score:4]
The association between microRNA-137 downregulation and microRNA-137 methylation has been reported in a number of solid cancers including head and neck squamous cell carcinoma [129]. [score:4]
Head and neck squamous cell carcinoma patients with methylated microRNA-137 have poor survival rate [129]. [score:1]
In laryngeal carcinoma, however, the functional roles of microRNA-137 remained to be elucidated. [score:1]
[1 to 20 of 7 sentences]
29
[+] score: 23
The interplay between the reported opposing alterations involving miR-137 and miR-182 might represent a molecular mechanism able to orchestrate the complex modulation of MITF expression that appears to be required during CM "lifespan", including its up-regulation in the initial phases of CM tumorigenesis and its down-regulation necessary for CM cells to acquire invasive and metastatic potential. [score:9]
MiR-137 was shown to be down-regulated in selected CM cell lines through the amplification of a Variable Number of Tandem Repeats sequence in its 5' untranslated region, which altered the secondary structure of pri-miR-137, preventing the production of the mature miRNA. [score:6]
This lack of inhibition by miR-137 resulted in the over -expression of MITF in CM cells [64]. [score:5]
Along this line, the transcription factor MITF, a master regulator of melanocytes biology, was found to be regulated by at least 2 different miRNAs, miR-137 and miR-182, which showed opposite alterations. [score:3]
[1 to 20 of 4 sentences]
30
[+] score: 22
Ectopic expression of miR-137 strongly reduced the expression of both AURKA and p-ATM/Chk2, but resulted in upregulation of p53 and p21. [score:8]
Interestingly, overexpression of miR-137 in myeloma treated with bortezomib significantly inhibited tumor growth in a human-in-mouse xenograft mo del. [score:5]
Taken together, these studies revealed that miR-137 is epigenetically silenced in MM, and overexpression of miR-137 may reduce drug resistance and overcome chromosomal instability in MMCs via affecting the apoptosis and DNA damage pathways [37, 38]. [score:3]
Furthermore, overexpression of miR-137 in myeloma cells, designated miR-137 [OE], enhanced their sensitivity to bortezomib and eprirubicin in vitro. [score:3]
Qin et al. showed that miR-137 is significantly decreased in MM and associated with poor outcome. [score:1]
Moreover, certain high-risk genetic abnormalities in MM, such as deletion of chromosome 1p22.2, 14q or 17p13 and gain of chromosome 1p22.2, were detected in parental myeloma cells (NCI-H929 cells transfected with “empty” vector) treated with drugs, but not in miR-137 [OE] cells. [score:1]
[96, 97] microRNAs miR-137 Epigenetically silenced in MM. [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 22
As miR-137 targets and suppresses CDK6 expression, a positive mediator of cell cycle progression, its downregulation enhances glioma cell proliferation, and lower miR-137 levels indicate a poorer prognosis [23, 24]. [score:10]
Chen L. Wang X. Wang H. Li Y. Yan W. Han L. Zhang K. Zhang J. Wang Y. Feng Y. miR-137 is frequently down-regulated in glioblastoma and is a negative regulator of Cox-2 Eur. [score:5]
For example, miR-137 is downregulated in grade III and IV human gliomas. [score:4]
Silber J. Lim D. A. Petritsch C. Persson A. I. Maunakea A. K. Yu M. Vandenberg S. R. Ginzinger D. G. James C. D. Costello J. F. miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells BMC Med. [score:3]
[1 to 20 of 4 sentences]
32
[+] score: 20
miR-137 which shares the least common downstream target and miR-181a-3p which don’t have interaction site with OIP5-AS1 and nor seed match for stemness TFs was upregulated in undifferentiated oral tumors. [score:6]
For experimental validation in oral tumors, we narrowed down that candidate miRNAs to six (miR-137, miR-148a-3p, miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p) by reviewing the functional evidence present in the literature, analyzing their expression in HNSCC datasets from TCGA and correlating with OIP5-AS1 expression (Supplementary Table  S2). [score:5]
However, except miR-137 other miRNAs target all the shortlisted genes. [score:3]
Out of the 8 selected miRNAs, miR-137, miR-140–5p, miR-148a-3p, miR-30a-5p and miR-338-3p were significantly downregulated in the tumors compared with normal tissue (P < 0.001, <0.001, 0.001, 0.001 and 0.0003, respectively) (Fig.   3a). [score:3]
Six miRNAs miR-137, miR-148a-3p, miR-338-3p, miR-30a/b-5p and miR-22-3p known to be associated with several cancers were chosen to study the expression levels in oral tumors 20, 25, 26. [score:3]
[1 to 20 of 5 sentences]
33
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Uptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
OsmoticUptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
Wienholds et al. (2005) let-7a,b,c, miR-9, miR-34, miR-92b, miR-124, miR-128, miR-135c, miR-137,miR-138, miR-153a, miR-219, miR-222 Zebrafish ISH ? [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 19
The aims of the present study were to: 1) perform a systematic investigation of the expression of ten candidate miRNAs (miR-22, miR-24, miR-31, miR-106a, miR-125b, miR-137, miR-205, miR-214, miR-221, miR-410) in human HF samples; 2) correlate these data with corresponding HF mRNA expression levels; and 3) test the identified target genes for enrichment in pathways and protein networks in order to delineate regulatory interactions in the human HF. [score:6]
While miR-137 has been described in the determination of murine coat colour [5], no data are available concerning the expression pattern of miR-137 in the human HF or skin. [score:3]
For instance, miR-137 is reported to be responsible for coat colour determination in mice [5], while the inhibition of miR-31 in murine skin has been shown to result in accelerated anagen progression and abnormal hair shaft morphology [4]. [score:3]
The present analyses failed to confirm the expression of miR-137, miR-214 and miR-410 in the human HF. [score:3]
Using the present criteria, no expression was observed for miR-137 (log [2]_value = -1.77 ± 1.72); miR-214 (log [2]_value = 1.50 ± 0.56); or miR-410 (log [2]_value = -1.08 ± 0.61) (data not shown). [score:3]
Further studies are required to determine whether miR-137 is involved in the determination of human hair colour and whether miR-214 plays a role in human HF embryogenesis. [score:1]
[1 to 20 of 6 sentences]
35
[+] score: 19
More and more numbers of miRNAs including miR-21, miR-125b, let-7, miR-9, and miR-137, as tumor suppressors or oncogenes by negatively regulating oncogenes or tumor-suppressor genes, have been verified to expose aberrant expression in glioma [5– 9]. [score:8]
For example, we have recently reported that forced expression of miR-137 suppresses proliferation and invasiveness in cultured glioma cells by directly targeting Rac1. [score:8]
Till now, it has been verified that miR-137 directly regulates a wide variety of genes such as CDC42, CDK6, KIT, and AEG-1 in several cancer tissues [10– 12]. [score:3]
[1 to 20 of 3 sentences]
36
[+] score: 16
Glioma pathogenesis-related protein 1(GLIPR1) or RTVP-1 is a direct target of miR-137 and this is another mechanism by which miR-137 inhibits stemness in GSCs [79]. [score:6]
miR-124 and miR-137 are two oncosuppressors whose overexpression can induce differentiation and G1 cell cycle arrest of GSCs [77]. [score:5]
Using high throughput RNA sequencing (RNAseq) and RNA -binding protein immunoprecipitation sequencing (RIPseq), the authors have predicted miR-137 targets such as c-KIT, YBX1, Akt2, CDC42, CDK6, and TGF β2 [80]. [score:3]
A recent report shows the broader impact of miR-137 by regulating multiple genes in GBM. [score:2]
[1 to 20 of 4 sentences]
37
[+] score: 15
Other miRNAs from this paper: mmu-mir-137
Further analysis using STRING identified four main gene networks (IL-6, BCL2, PTGS2 and CXCR4) that were downregulated in glioma cells silenced for RTVP-1. The identification of CXCR4 as a major signaling molecule in these cells further confirmed our recent findings that miR-137 inhibited GSC self-renewal and promoted their differentiation by targeting RTVP-1 which downregulated CXCR4 [29]. [score:11]
Indeed, we recently demonstrated that RTVP-1 regulates the stemness of GSCs as determined by increased self-renewal and expression of the stemness genes Oct4 and Nanog and decreased differentiation ability downstream of miR-137 and upstream of the CXCR4-Shh-Gli pathway [29]. [score:4]
[1 to 20 of 2 sentences]
38
[+] score: 14
The ectopic transfection of miR-137 or miR-193a into OSCC lines lacking their expressions significantly reduced cell growth, with downregulation of the translation of cyclin -dependent kinase 6 or E2F transcription factor 6, respectively [27]. [score:8]
These observations are consistent with previous findings in which tumor-suppressing roles have been suggested for miR-137 in glioblastoma [84] and melanoma [85], and for miR-193a in hepatocarcinoma, lung epithelial carcinoma, and cervical adenocarcinoma cell lines [86]. [score:3]
These include miR-21, miR-184, miR-133a/133b, miR-137, and miR-193a. [score:1]
This epigenetic event has also been observed in glioblastoma for silencing miR-137 [84]. [score:1]
It has been suggested that both miR-137 and miR-193a are silenced by DNA hypermethylation in HNOC [27]. [score:1]
[1 to 20 of 5 sentences]
39
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
Several classes of mRNAs encoding SR proteins are known to be targeted by miRNAs; miR7, miR-10a, miR10b are known to target SRSF1, miR-193a-3p regulates SRSF2 and miR-1 targets SRSF9 in several cell types [63] and the genes encoding hnRNPA1 and hnRNPA0 are known to be targets of miR-124, miR-137 and miR-340 in colon cancer cells [64]. [score:10]
Sun Y. Zhao X. Zhou Y. Hu Y. miR-124, miR-137 and miR-340 regulate colorectal cancer growth via inhibition of the Warburg effect Oncol. [score:4]
[1 to 20 of 2 sentences]
40
[+] score: 14
Moreover, Silber et al. also found that the expression of miR-124 and miR-137 was associated with neuronal-like opposed to astrocyte-like differentiation, while the most up-regulated miRNAs in our study (miR-21, miR-29a, miR-29b, miR-221 and miR-222) are associated to the GBM subclass showing a miRNA expression profile evocative to that of astrocytic precursors, according to the five subgroups of GBM defined by Kim et al. based on miRNA expression profiles [34]. [score:10]
On the contrary, we found that in our miRNA microarray data these miRNAs were expressed at very low levels (miR-124) or none at all (miR-137). [score:3]
Probably due to this methodological difference, we did not confirm previous findings that reported a pro-differentiation role for miR-124 and miR-137 on human GICs [14]. [score:1]
[1 to 20 of 3 sentences]
41
[+] score: 14
Very recently, expression of a miR-137 gain-of-function construct, first in cell lines, and then in the mouse hippocampal dentate gyrus, was shown to downregulate three well-known presynaptic proteins: complexin-1 (Cplx1), N-ethylmaleimide-sensitive fusion protein (Nsf), and synaptotagmin-1 (Syt1) (136). [score:6]
Unlike examples of differentially expressed miRNAs, miR-137 suggests a direct genetic-miRNA association with schizophrenia. [score:4]
These findings and rescue in the mouse brain are particularly promising, given the vast data implicating miR-137 SNPs in schizophrenia (136). [score:1]
A genome-wide study of over 40,000 schizophrenic patients identified a SNP within the putative coding region of miR-137 resulting in decreased efficiency of miR-137 function (153). [score:1]
Excitingly, some of these defects were rescued by co delivery of a miR-137 sponge construct, which sequestered endogenous miR-137. [score:1]
This is further supported by additional studies that have shown variation of miR-137 affects brain activation and function (154– 156). [score:1]
[1 to 20 of 6 sentences]
42
[+] score: 14
The minor C allele of rs550067317 disrupts the formation of the typical stem-loop structure during base pairing of miR-137 with the predicted target sequence at the 3′-UTR, consequently reversing inhibition of EFNB2 expression. [score:7]
Recently, a negative correlation between miR-137 and EFNB2 expression was shown [56]. [score:3]
Importantly, the SNP rs550067317 (A>C) is located at the predicted target site of miR-137 in the 3′-UTR of EFNB2. [score:3]
EFNB2 | miR-137. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 14
Other miRNAs from this paper: hsa-mir-675
MicroRNA miR-137 regulates neuronal maturation by targeting ubiquitin ligase mind bomb-1. Stem Cells 28, 1060– 1070. [score:4]
MIR137HG is a precursor to the miRNA, MIR137, known to have regulatory properties important for proper neuronal and dendritic development (Smrt et al., 2010; Szulwach et al., 2010; Tarantino et al., 2010; Sun et al., 2011). [score:3]
Transcriptional targets of the schizophrenia risk gene MIR137. [score:3]
A direct molecular link between the autism candidate gene RORa and the schizophrenia candidate MIR137. [score:2]
miR-137 forms a regulatory loop with nuclear receptor TLX and LSD1 in neural stem cells. [score:2]
[1 to 20 of 5 sentences]
44
[+] score: 13
In addition, TCF4 is upregulated by loss of function mutations in the SZ candidate MIR137, and overexpression in the forebrain of mice leads to cognitive impairments and deficits in pre-pulse inhibition [128– 130]. [score:9]
For example, the SZ and BD candidate gene MIR137 has been found to target other candidates: CSMD1, C10orf26, CACNA1C, and TCF4 [34]. [score:3]
Genome-wide supported variant MIR137 and severe negative symptoms predict membership of an impaired cognitive subtype of schizophrenia. [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 12
Disease Origin References of iPSC lines Phenotype of iPSC-derived neurons miRNAs of interest Fragile X syndrome Loss of function of FMRP (FMR1 gene) Urbach et al. (2010), Sheridan et al. (2011) Hyper-excitability of glutamatergic synapses DICER and AGO-1 complexes Rett’s syndrome Loss of function of MeCP2 transcriptional repressor Marchetto et al. (2010), Kim et al. (2011c), Cheung et al. (2012) Decreased soma size, neurite atrophy, decreased efficiency of glutamatergic synapses miR-132, miR-184, miR-483-5p, miR-212 Schizophrenia Multifactorial Urbach et al. (2010); Brennand et al. (2011), Paulsen Bda et al. (2012), Robicsek et al. (2013) Diminished neuronal connectivity miR-17-5p, miR-34a, miR-107, miR-122, miR-132, miR-134, miR-137 Down’s syndrome Additional copy of chromosome 21 Briggs et al. (2013), Weick et al. (2013) Reduced synaptic activity, increased sensitivity to oxidative stress miR-99a, miR-125b, miR-155, miR-802, Ret 7c Micro -RNAs, as fine regulators of protein translation, influence directly the level of gene expression. [score:9]
Interestingly, a single-nucleotide polymorphism in miR-137, a miRNA previously reported as a regulator of neuronal maturation, was consistently found to be one of the common alleles associated with a high risk of developing schizophrenia (Whalley et al., 2012). [score:2]
Impact of a microRNA MIR137 susceptibility variant on brain function in people at high genetic risk of schizophrenia or bipolar disorder. [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 12
In addition, five genes associated with schizophrenia (ZNF804A, CACNA1C, TCF4, CSMD1, and C10orf26) have all been validated as targets of miR-137 (Kwon et al., 2011; Kim et al., 2012), suggesting that genes involved in schizophrenia susceptibility can be affected by either cis-acting mutations at the gene or via alterations in the miRNA regulatory system. [score:5]
Validation of schizophrenia -associated genes CSMD1, C10orf26, CACNA1C and TCF4 as miR-137 targets. [score:3]
Experimental validation of candidate schizophrenia gene ZNF804A as target for hsa-miR-137. [score:3]
A very large genome-wide association study of over 50,000 individuals identified a SNP in miR-137 as strongly (p = 1.6 × 10 [−11]) associated with schizophrenia (Ripke et al., 2011). [score:1]
[1 to 20 of 4 sentences]
47
[+] score: 12
Several miRNAs have been documented to directly inhibit TWIST1, including miR-1-1 [26], miR-33a [27, 28], miR-137 [29], miR-186 [30], miR-300 [31], miR-520d-5p [32], miR-539 [31], miR-543 [31], miR-675 [33], and miR-720 [34]. [score:4]
The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
0168171.g007 Fig 7The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
Among these miRNAs, the data obtained from TCGA reveal that like miR-151, miR33a and miR-137 are significantly higher expression levels in breast cancers as compared with the paired normal tissues (Fig 7). [score:2]
[1 to 20 of 4 sentences]
48
[+] score: 11
In addition, miR-451, miR-27a, miR-21, miR-130a, miR-let-7, miR-137, miR-200c, miR-122, miR-138 and miR-10a/b were suggested to regulate ABCB1 gene expression indirectly by targeting other mRNAs that code the proteins associated with the activation of ABCB1 gene expression [72, 73, 74, 75, 76, 77, 78, 79]. [score:9]
Zhu X. Li Y. Shen H. Li H. Long L. Hui L. Xu W. MiR-137 restoration sensitizes multidrug-resistant MCF-7/ADM cells to anticancer agents by targeting YB-1 Acta Biochim. [score:2]
[1 to 20 of 2 sentences]
49
[+] score: 11
Moreover, miR-124 and miR-137 have functioned in a tumor-suppressive fashion in GBM and caused differentiation when re-expressed in GBM cells [24]. [score:5]
The first one (Figure 3C) included one hub TF (SP1) and one hub miRNA (miR-137), which together regulated 10 genes. [score:2]
In summary, based on the network topological analysis of the GBM Notch regulatory network and its subnetworks, we identified 32 human miRNAs that might be involved in the Notch signaling pathway, and six of them (miR-124, miR-137, miR-219-5p, miR-34a, miR-9, and miR-92b) might play important roles in this pathway. [score:2]
Using the same method to identify the hubs above, we identified four GBM hub genes (NOTCH1, FURIN, NOTCH2, and EP300), four hub miRNAs (miR-9, miR-92b, miR-137 and miR-295-5p) and four hub TFs (EP300, SP1, TEAD1, and TBX5). [score:1]
Using the same method to define hubs, we identified four hub genes (NRP1, FOXO3, SMAD4, and TNFRSF1B), six hub miRNAs (miR-495, miR-9, miR-137, miR-30d, miR-181c, and miR-30e), and three hub TFs (TEAD1, SP1, and ZBTB7A). [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 11
In a previous study, two miRNAs were shown to directly target PAK2, and among these, miR-137 inhibited proliferation in melanoma cells [26]. [score:6]
Hao S miR-137 inhibits proliferation of melanoma cells by targeting PAK2Exp. [score:5]
[1 to 20 of 2 sentences]
51
[+] score: 11
In addition, a deletion of 1p21.3 containing a miRNA MIR137 has recently been reported by Willemsen et al. [19], and resulted in downregulation of the miRNA, and upregulation of three targets in subjects with ID and congenital abnormalities. [score:9]
Considering the role of MIR137 and its targets in brain function (synapse maturation, morphogenesis of young neurons, and axon growth), their dysfunction is considered causative of the patients’ phenotype [19]. [score:2]
[1 to 20 of 2 sentences]
52
[+] score: 11
Ectopic expression of miR-137 was shown to downregulate MITF, c-Met, and CDK6 and to induce cell cycle arrest. [score:6]
miR-137 is a tumor suppressor and a regulator of the transcription factor microphthalmia -associated transcription factor (MITF) in uveal melanocytes. [score:4]
These results suggest that loss of miR-137 activity may be a component of uveal melanoma tumorigenesis [57]. [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 10
Silber J miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cellsBMC Med. [score:3]
Our results showed that MIR137 expression is almost same in SCZ and controls, and MIR181b is 1.2-fold higher than SCZ. [score:3]
GWAS studies based on blood showed that MIR137 mediated dysregulation as a previously unknown etiologic mechanism in SCZ [52]. [score:2]
MIR137 and MIR181b were based on GWAS results rather than brain tissues, and MIR181b was reported in Chinese population rather than in Caucasian 52– 54. [score:1]
Finally, we note that several previously reported SCZ -associated miRNAs, including MIR137, 181b, 19, 219, and MIR9, did not replicate in this study. [score:1]
[1 to 20 of 5 sentences]
54
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
MicroRNA-137/181c regulates serine palmitoyltransferase and in turn amyloid beta, novel targets in sporadic Alzheimer’s disease. [score:5]
Several studies demonstrated that miRNA-148a, miRNA-17-5p, miRNA-137, miRNA-181c, miRNA-101, miRNA-184, miRNA-15a, miRNA-185, and miRNA-210 are few of those miRNAs that are expressed in AD (Lukiw, 2007; Cogswell et al., 2008; Hébert et al., 2008; Geekiyanage and Chan, 2011; Wang et al., 2011). [score:3]
The levels of Aβ in AD patients have been speculated to be regulated by miRNA-137, miRNA-146a, and miRNA-181c (Delay et al., 2011; Geekiyanage and Chan, 2011; Li Y. Y. et al., 2011; Hu et al., 2013). [score:2]
[1 to 20 of 3 sentences]
55
[+] score: 10
Likewise, miR-26a and miR-137 are silenced by promoter CpG island hypermethylation, which induces the up-regulation of the target gene LSD1 in colorectal adenomas and EZH2 in prostate cancer. [score:6]
The miR-137 is another important mediator, which is silenced by promoter CpG island hypermethylation and targets lysine-specific demethylase 1 (LSD1) in colorectal adenomas [42]. [score:3]
Among them, miR-9, miR-148, miR-124, miR-137, miR-34, miR-127 and miR-512 reportedly can be silenced by CpG hypermethylation in at least three types of cancers [6]. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 10
Other miRNAs from this paper: rno-mir-137
Although their particular role in aging remains to be established, two promising new targets involved in regulating degradation of damaged mitochondria are the micro RNA miR137 and the AAA ATPase p97. [score:4]
MicroRNA-137 is a novel hypoxia-responsive microRNA that inhibits mitophagy via regulation of two mitophagy receptors FUNDC1 and NIX. [score:3]
miR137 has been identified to inhibit mitophagy occurring in response to hypoxia, through reducing the interaction of LC3 with two mitophagy receptors, FUNDC1 and NIX (Li et al., 2014). [score:3]
[1 to 20 of 3 sentences]
57
[+] score: 10
Down-regulated miRNAs (cfa-miR-29 cluster, cfa-miR-19a, cfa-miR-101 and cfa-miR-137) in adult canine testis treated with DMSO, RA (Group 1) or CYP26B1 inhibitor (Group 2). [score:6]
Species of miRNA which were significantly down-regulated were cfa-miR-19a, cfa-miR-29b, cfa-miR-29c, cfa-miR-101 and cfa-miR-137 (Figure 6). [score:4]
[1 to 20 of 2 sentences]
58
[+] score: 9
Other miRNAs from this paper: hsa-mir-125b-1, hsa-mir-125b-2
miR-137 up-regulation could be important to maintain tumor state [76]. [score:4]
Svoboda M. Izakovicova Holla L. Sefr R. Vrtkova I. Kocakova I. Tichy B. Dvorak J. Micro -RNAs miR125b and miR137 are frequently upregulated in response to capecitabine chemoradiotherapy of rectal cancerInt. [score:4]
Increased levels of miR-125b and miR-137 were observed. [score:1]
[1 to 20 of 3 sentences]
59
[+] score: 9
For miRNA overexpression, the cells were grown to 90% confluence, transfected with plasmid constructs (1 µg/ml) expressing miRNA precursors (pri-miR-182 (Open Biosystems), pri-miR-191, pri-miR-137 or pri-miR-206 (System Biosciences)), and harvested 24 hours after transfection. [score:5]
The ∼40 nt intermediate product was also not detected in cells transfected with vectors expressing pri-miR-137 and pri-miR-206 (Figure 4C) and in the case of the other 14 vector-encoded pri-miRNAs studied earlier [14]. [score:3]
The black bar on the right side marks the miRNA and pre-miRNA fractions; (B) The same as in A, but antisense probes for miR-139 (3′-arm) and miR-132 (5′-arm) were used; (C) Northern blotting analysis with probes detecting miRNA derived from the 3′-arms of precursors after transfection of HeLa cells with vectors encoding pri-miR-137 and pri-miR-206. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 9
Regarding the number of target mRNAs; miR-944, miR-141-3p, and miR-203a ranked top three among down-regulated miRNAs, while miR-140-3p, miR-452-5p, and miR-137 located top three of up-regulated miRNAs (Figure 1). [score:9]
[1 to 20 of 1 sentences]
61
[+] score: 9
Further analysis revealed that five of the miRNAs (miR-137, −214-3p, −301a-3p, −330-3p and −383-5p) are known to target genes affecting all of these four categories (Additional file 2: Figure S3), implying their relevance for leukemia as well as the possibility to therapeutically target gene regulation via these miRNAs. [score:6]
Five of the miRNAs (miR-137, −214-3p, −301a-3p, −330-3p and −383-5p) emerged to possess target genes affecting all of these four categories, which may imply their relevance for leukemia. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 9
Seven miRNAs had different expression levels between active TB and healthy controls: six miRNAs (hsa-miR-16, hsa-miR-137, hsa-miR-140-3p, hsa-miR-193a-3p, hsa-miR-501-5p, and hsa-miR-598) were upregulated while hsa-miR-95 was down-regulated. [score:9]
[1 to 20 of 1 sentences]
63
[+] score: 9
These microRNAs are also found downregulated in XXL-USSC, as well as miR-137 and miR-214 (Fig. S2), which both target CDK6 [61], [62] In addition to miR-17 [37], miR-20a, and miR-106b (this study), miR-214 also downregulates PTEN [63]. [score:9]
[1 to 20 of 1 sentences]
64
[+] score: 9
Six miRNAs, 3 less expressed (miR-324-3p, miR-516a-3p, miR-659-3p) and 3 more expressed (miR-137, miR-301a-3p, miR-873-5p) in BM-infiltrating cells than in primary tumors, were significantly differentially expressed also in this new set of samples (Table 2). [score:7]
To validate the differential expression of the selected 20 miRNAs, reverse-transcribed and pre-amplified miRNA fractions from 10 additional BM-infiltrating and 10 primary tumors were amplified in a 96 well plate in triplicate using the specific TaqMan [©] human microRNA assays (hsa-miR-324-3p, catalog #002161; hsa-miR-516-3p, catalog #001149; hsa-miR-628-5p, catalog #002433; hsa-miR-659-3p, catalog #001514; hsa-miR-10b, catalog #002218; hsa-miR-128, catalog #002216; mmu-miR-137, catalog #01129; mmu-miR-140, catalog #001187; hsa-miR-16, catalog #000391, hsa-miR-191, catalog #002299; hsa-miR-301, catalog #000528; hsa-miR-361-3p, catalog #002116; hsa-miR-365, catalog #001020; hsa-miR-548d-3p, catalog #001605; hsa-miR-572, catalog #001614; hsa-miR-576-5p, catalog #002350, hsa-miR-616, catalog #001589; hsa-miR-628-3p, catalog #002434; hsa-miR-873, catalog #002356; hsa-miR-98, catalog #000577; U6 snRNA, catalog #001973, Life Technologies). [score:2]
[1 to 20 of 2 sentences]
65
[+] score: 8
The rs2660302 locus may mediate allele -dependent transcriptional regulation of miR-137, thereby altering the expression status of genes underlying the etiology of schizophrenia. [score:4]
Two previous studies demonstrated that miR-137 is a candidate regulatory hub in the schizophrenia gene network [2011; Potkin et al., 2010]. [score:2]
Following that report, another group implicated the miR-137 locus in schizophrenia (2011), though the molecular mechanism underlying the association remains unclear. [score:1]
Table S1), which occurs within the promoter of miR-137, and is in LD (1000G EUR, r [2] = 0.71) with an index SNP (rs1625579) for schizophrenia in a cohort of European ancestry. [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 8
Svoboda et al. [97] reported that median levels of miR-125b and miR-137 were upregulated in rectal cancer patients after a short-course of capecitabine -based chemoradiotherapy, and higher induction of miR-125b and miR-137 were associated with worse response to the treatment. [score:4]
Importantly, while a number of these miRNAs showed distinct variation two weeks after starting therapy, showing profound inter-tumoral variability, miR-125b and miR-137 demonstrated a significant induction and similar expression trends. [score:3]
The increased levels of both miRNAs correlated with minor response to therapy and with higher, post-surgery, tumor stage suggesting that higher induced levels of miR-125b and miR-137 might be associated with worse response to radiotherapy with capecitabine. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 8
Again, we identified 'transcriptional regulation by MITF family' as the most relevant pathway to both miR-137 (the score = 339; the score p-value = 1.19E-102) and miR-148b (the score = 40; the score p-value = 3.91E-142) target networks (Table 1 and Additional file 1). [score:4]
Recent studies indicate that MITF is a direct target of both miR-137 and miR-148b [21, 22]. [score:4]
[1 to 20 of 2 sentences]
68
[+] score: 8
Equally, we observe that a potential oncosuppressor gene, such as miR-137, is regulated negatively, whereas another one, such as miR-323, is regulated positively. [score:5]
The results presented in Fig.   1 confirm a drastic overexpression of miR-181, miR-137, miR-199, miR-706 and miR-719 and repression of miR-155 in Cbx7 KO MEFs in comparison with the WT ones. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 8
miR137 is a TLX target and an upstream regulator of LSD1. [score:4]
TLX is targeted by several miRs, among which miR137 displayed the highest degrees of gene variation in a GWAS study of SZ and BP [81]. [score:3]
By recruiting LSD1 to the genomic regions of miR137, TLX represses miR137 in NSCs [35]. [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
MiR-137 functions as a tumor suppressor in neuroblastoma by downregulating KDM1A. [score:5]
miR-137. [score:1]
Epigenetics, microRNAs, and carcinogenesis: functional role of microRNA-137 in uveal melanoma. [score:1]
When an anti-miR-137 is used, Jarid1b is not post-transcriptionally silenced and the differentiation of ESCs is blocked (Tarantino et al., 2010). [score:1]
[1 to 20 of 4 sentences]
71
[+] score: 8
Other miRNAs from this paper: mmu-mir-137
A further study showed that overexpression of miR-137 in transgenic mice results in altered coat color, thereby validating the functional role of miR-137 on MITF gene expression and indicating the complexity of the regulation mechanisms for melanogenesis and coat color gene expression post-transcriptionally [24]. [score:8]
[1 to 20 of 1 sentences]
72
[+] score: 7
Several other microRNAs that were significantly downregulated in neonatal CPCs also positively correlate with cell differentiation including microRNA-424[52] and microRNA-137[46]. [score:4]
Oct4 is known to bind at the promoter of miR-137[60], a microRNA which inhibits cell stemness [61], this microRNA was also significantly decreased with simulated microgravity in neonatal CPCs. [score:3]
[1 to 20 of 2 sentences]
73
[+] score: 7
miR-137 is a potential tumor suppressor miRNA, which negatively regulates the gene ERRα (estrogen-related receptor alpha) by targeting the two functional sites in the 3′-UTR of ERRα [40]. [score:6]
The top 20 miRNAs ranked by their degrees in the miRNA-mRNA interaction network of the BRCA data set were listed in Table 2. It can be seen that 70% (14/20) miRNAs were annotated to be associated with cancers and four out of them, namely, hsa-mir-9-3, hsa-mir-449a, hsa-mir-135a-1, and hsa-mir-137, were breast cancer-specific miRNAs. [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 7
Another miRNA, miR-137, down-regulates the expression of MITF, a master regulator of cell growth, maturation, and pigmentation in melanoma cells [16]. [score:7]
[1 to 20 of 1 sentences]
75
[+] score: 7
For example, miR-137 inhibits mitophagy via regulation of two mitophagy receptors FUNC1 and NIX [28]. [score:4]
Li W. Zhang X. Zhuang H. Chen H. G. Chen Y. Tian W. Wu W. Li Y. Wang S. Zhang L. Microrna-137 is a novel hypoxia-responsive microrna that inhibits mitophagy via regulation of two mitophagy receptors fundc1 and nixJ. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 7
The 50 miRNAs that showed highest total reads (most abundant) in the exosomes of the 36 patient samples were then subjected to unsupervised hierarchal clustering with the expression heat maps of the individual patient samples shown in Figure 1. The twenty most variable miRNAs among all samples were then further validated by qPCR analysis to examine their differential expression within the four patient cohorts described in Table 1. These miRNAs included let-7b, let-7g, miR-17, miR-19a, miR-19b, miR-20b, miR-21, miR-23a, miR-29a, miR-92a, miR-125b, miR-126, miR-128, miR-137, miR-148a, miR-149, miR-199a, miR-221, miR-222 and miR-423 (Table 2). [score:5]
hsa-let-7b TGAGGTAGTAGGTTGTGTGGTT hsa-let-7g-5p TGAGGTAGTAGTTTGTACAGTT hsa-miR-125b TCCCTGAGACCCTAACTTGTGA hsa-miR-126 TCGTACCGTGAGTAATAATGCG hsa-miR-128 TCACAGTGAACCGGTCTCTTT hsa-miR-137 TTATTGCTTAAGAATACGCGTAG hsa-miR-148a AAAGTTCTGAGACACTCCGACT hsa-miR-149 TCTGGCTCCGTGTCTTCACTCCC hsa-miR-17 CAAAGTGCTTACAGTGCAGGTAG hsa-miR-199a-5p CCCAGTGTTCAGACTACCTGTTC hsa-miR-19a TGTGCAAATCTATGCAAAACTGA hsa-miR-19b TGTGCAAATCCATGCAAAACTGA hsa-miR-20b TAAAGTGCTTATAGTGCAGGTAG hsa-miR-21 TAGCTTATCAGACTGATGTTGA hsa-miR-221 AGCTACATTGTCTGCTGGGTTTC hsa-miR-222 AGCTACATCTGGCTACTGGGT hsa-miR-23a ATCACATTGCCAGGGATTTCC hsa-miR-29a TAGCACCATCTGAAATCGGTTA hsa-miR-423-5p TGAGGGGCAGAGAGCGAGACTTT hsa-miR-92a TATTGCACTTGTCCCGGCCTGT Since there are no known control or house-keeping microRNAs in exosomes, we adopted the strategy of using spiked-in C. elegans miRNAs directly into Qiazol prior to RNA extraction as normalizing controls [20]. [score:2]
[1 to 20 of 2 sentences]
77
[+] score: 7
e. m. value of hsa-miR-137, hsa-miR-376c-3p, hsa-miR-203a-3p and hsa-miR-146a-5p relative expression level in two series of biological replicates from the first microfluidics arrays (five control and five FD hOE-MSCs) and the second arrays (four healthy control and four FD hOE-MSCs), respectively normalized by hsa-miR-320a (for both hsa-miR-137 and hsa-miR-376c-3p), hsa-miR-330-3p and hsa-miR-324-5p. [score:3]
Nevertheless, two miRNAs were similarly dysregulated in our two microfluidics arrays experiments, hsa-miR-345-5p and hsa-miR-137, emphasizing a concordance of our two studies. [score:2]
We validated a significant underexpression in FD compared to control hOE-MSCs for all four miRNAs: miR-137, miR-376c-3p, miR-203a-3p and miR-146a-5p (Fig.  2). [score:2]
[1 to 20 of 3 sentences]
78
[+] score: 7
Since many miRNAs were identified as targets of methylation regulation, such as miR-9, miR-34b/c and miR-148a in metastatic carcinomas [16], and miR-137 and miR-193a in oral cancer [17], miR-193b and miR-145 in prostate cancer [18], [19], we decided to analyze the regulatory mechanism of miR-219-2-3p expression from its genomic methylation. [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
Down-regulation of miR-137 in melanoma was strongly associated with MITF up-regulation, one of the most important gene involved with melanoma risk (for review see [20]). [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
miR-137 and -181c are also downregulated in AD [161, 162], and their downregulation promotes APP processing into neurotoxic forms of Ab. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196a-2, hsa-mir-196b
Four other genes associated with schizophrenia (TCF4 (transcription factor 4), CACNA1C (calcium channel, voltage -dependent, L type, alpha 1C subunit), CSMD1 (CUB and Sushi multiple domains 1) and C10orf26 (chromosome 10 open reading frame 26) contain predicted target -binding sites for miR-137, what indicates that the expression levels of these genes could also be affected by the mechanisms described above [17, 19]). [score:5]
Another SNP, rs1625579, located in the intron of a putative primary transcript for the mir-137 gene, has been associated with schizophrenia [19], This SNP alters the seed sequence of miR-137 that is involved in neuronal development. [score:2]
[1 to 20 of 2 sentences]
82
[+] score: 7
In addition, the study demonstrated that transfection of AGC and MKN-45 gastric cancer cell lines with pre-miR-137 inhibited the cell cycle at the G1-S phase and induced apoptosis, which demonstrates that may be involved in GC carcinogenesis. [score:3]
Furthermore, cells transfected with pre-miR-137 exhibited reduced expression levels of Cdc42 and Cyclin D1. [score:3]
miR-137. [score:1]
[1 to 20 of 3 sentences]
83
[+] score: 7
MicroRNA-137/181c regulates serine palmitoyltransferase and in turn amyloid beta, novel targets in sporadic Alzheimer’s disease. [score:5]
Geekiyanage and Chan (2011) showed by miRNA qRT-PCR a decrease in miR-137, miR-181c, miR-9, and miR-29a/b levels in the neocortical region of controls (n = 7) and AD subjects (n = 7), which negatively correlated with Aβ42 levels in post-mortem brain tissues. [score:1]
Significant negative correlations were observed between Aβ42 peptides and miR-137 (r = -0.75, P = 0.003), miR-181c (r = –0.57, P = 0.037), miR-9 (r = –0.7, P = 0.007), miR-29a (r = –0.64, P = 0.01), and miR-29b-1 (r = –0.569, P = 0.037), and this, in both control and AD patients. [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 6
Prior studies focus on the shRNA targeting YB-1, however, there is little known about the endogenous miRNA that may negatively regulates YB-1. MiR-137 restored the sensitivity of the multidrug-resistant MCF-7/ADM cells to anticancer agents by targeting YB-1 in breast cancer 27. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
Another 11 miRNAs (miR-206, miR-34a, miR-374, miR-424, miR-100, miR-101, miR-323, miR-368, miR-137, miR-138 and miR-377) were abundantly expressed in transdifferentiated neuronal progenitors. [score:3]
In contrast, 11 miRNAs (hsa-miR-206, hsa-miR-34a, hsa-miR-374, hsa-miR-424, hsa-miR-100, hsa-miR-101, hsa-miR-323, hsa-miR-368, hsa-miR-137, hsa-miR-138 and hsa-miR-377) were abundantly expressed in day 9 neuronal progenitors (Figures 1B and 2A). [score:3]
[1 to 20 of 2 sentences]
86
[+] score: 6
MiRNAs down-regulated in gliomas include miR-7, miR-124, miR-128, miR-137, and miR-181a/b [9], [14], [15], [18], [19]. [score:4]
miR-128, miR-124, and miR-137 are all enriched in the brain and have been shown to regulate neuronal differentiation, maturation, and/or survival [15], [20]– [23]. [score:2]
[1 to 20 of 2 sentences]
87
[+] score: 6
Several studies proved that down-regulated expression of miR-221, miR-137, miR-372, miR-182*, let-7 and miR-34a is associated with shorter survival in patients with lung cancer [41- 43]. [score:6]
[1 to 20 of 1 sentences]
88
[+] score: 6
with the Phylogibbs algorithmTo identify binding sites for protein cofactors of the miRNA pathway, we applied the Phylogibbs algorithm [57] to the 400 nucleotide upstream and downstream regions of the high-confidence sites of three miRNAs, which had a few hundred high-confidence predicted targets (miR-30a – 210 upstream/208 downstream regions, miR-19 – 126 upstream/154 downstream regions and miR-137 – 153 upstream/131 downstream regions). [score:3]
To identify binding sites for protein cofactors of the miRNA pathway, we applied the Phylogibbs algorithm [57] to the 400 nucleotide upstream and downstream regions of the high-confidence sites of three miRNAs, which had a few hundred high-confidence predicted targets (miR-30a – 210 upstream/208 downstream regions, miR-19 – 126 upstream/154 downstream regions and miR-137 – 153 upstream/131 downstream regions). [score:3]
[1 to 20 of 2 sentences]
89
[+] score: 6
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-184
miR-137 has been identified as a direct target of Sox2 and of another DNA methyl-CpG -binding protein, MeCP2, which inhibits neuronal differentiation and maturation in adult SGZ neural stem cells [205]. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
Similarly, high miR-137 expression in melanoma cell lines down-regulates microphthalma associated transcription factor (MITF), a transcription factor important for melanocyte cell growth, maturation, apoptosis, and pigmentation [32]. [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 6
The authors used two aptamers that bind to, and inhibit the receptor tyrosine kinases, Axl and PDGFRβ as carriers of miR-137 and antimiR-10b. [score:3]
They found that miR-137 and antimiR-10b synergize with the receptor inhibitory function of aptamers, effectively preventing GSC expansion. [score:3]
[1 to 20 of 2 sentences]
92
[+] score: 6
Knockdown of long non-coding RNA XIST increases blood-tumor barrier permeability and inhibits glioma angiogenesis by targeting miR-137. [score:6]
[1 to 20 of 1 sentences]
93
[+] score: 5
Alterations in miRNA expression have been observed in CRC, and several dysregulated miRNAs, including miR-625-3p [8], miR-99-5b [9], miR-361-5p [10], miR-17-5p [11], miR-137 [12], miR-95 [13], miR-23a [14, 15], miR-155 [16], miR-150 [17], miR-191[18], miR-339-5p [19], miR-429 [20], miR-345 [21], miR-22 [22], miR-638 [23] and miR-138 [24], have been shown to regulate CRC cell growth, apoptosis and metastasis. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
MiRNA target site/Species Human Mouse Cow Dog Chicken FrogTargeting Twist2 miR-15b-3p + − + + − − − miR-33-5p + + + + − + − miR-137-3p + + + + − + − miR-145a-5p + + + + − − + miR-151-5p + + + + − + − miR-214-5p + + + + − − − miR-326-3p + + + + − − − miR-337-3p + + + + − + − miR-361-5p + + + + − − − miR-378a-5p + + + + − − − miR-381-3p + + + + − + − miR-409-3p + + + + − − − miR-450b-5p + + + + − + − miR-508-3p + + + + − − − miR-543-3p + + + + − − − miR-576-5p + + + + − − − miR-580 + + + + − − − miR-591 + + + + − − − MicroRNAs underlined were tested in this study. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
A recent study reported that miR-137, a hypoxia-responsive miRNA, inhibits hypoxia -induced mitophagy by targeting two mitophagy receptors, FUNDC1 and NIX [31]. [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 5
Out of the 485 differentially stabilized transcripts, mRNA targets of miR-29, let-7, miR-137, and miR-130 were stabilized with quiescence while miR-17 and miR-200 targets were stabilized with proliferation. [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
MicroRNA-137/181c regulates serine palmitoyltransferase and in turn amyloid beta, novel targets in sporadic Alzheimer’s disease. [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
In accordance to being upregulated intracellularly in senescent fibroblasts [51, 52] we found miR-23a-5p and miR-137 to be more abundant per vesicle. [score:4]
Surprisingly, out of these, only two miRNAs (miR-23a-5p, miR-137) were more abundant in sEVs at both time points (Fig. 5C), while five miRNAs (miR-17-3p, miR-625-3p, miR-766-3p, miR-199b-5p, miR-381-3p) were less abundant in sEVs of senescent cells (Fig. 5D). [score:1]
[1 to 20 of 2 sentences]
99
[+] score: 5
An inverse correlation between expression of ZIC3 and miR-137, miR-152, miR-154 and miR-155; LIN28 and let-7c, miR-137 and miR-152 and NANOG and miR-199a and miR-199b expression was found in ASC and NTERA-2 cells (Figure 5). [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 5
0046647.g005 Figure 5(A) Example of ciliary lengthening produced by MIR137 mimic. [score:1]
This effect was visually striking in some of the transfected cells (Fig. 5A shows an example for the MIR137 mimic) and a significant, albeit moderate, increase in average cilia length (relative to the scrambled control) was verified for all of the hits in this group (Fig. 5B ). [score:1]
We also noticed increased % ciliation in cells transfected with the MIR137 mimic (green bars in Fig. 4A and B ). [score:1]
Average cilium length for the indicated experimental conditions is indicated by the bar, and error bar indicate S. E. M. (scrambled siRNA Control, N = 45; MIR137 Mimic, N = 43; siCCDC18-1, N = 31; siCCDC18-2, N = 46; siFOXP1-1, N = 38; siFOXP1-2, N = 27). [score:1]
Cells were transfected with scrambled siRNA control (‘siControl’, left column) or MIR137 mimic (right column). [score:1]
[1 to 20 of 5 sentences]