sort by

123 publications mentioning hsa-mir-224 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-224. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 398
We used predicted miRNA target databases including “miRanda”, “DIANA-mT”, “miRDB” and “TargetMiner” to search for potential targets of miR224-3p, and multiple target genes were found. [score:9]
In conclusion, we identified hypoxia-down-regulated miR224-3p as a novel inhibitor of hypoxia -induced autophagy in GBM by directly targeting ATG5 and FIP200 (Figure 9B). [score:9]
Moreover, the up-regulated expression of ATG5 in cancers provides further evidence to indicate the potential role of down-regulated miR224-3p in tumorigenesis. [score:9]
By directly suppressing the expression of the critical ATGs, ATG5 and FIP200, miR224-3p inhibits the autophagic activity of GBM. [score:8]
These data allowed us to hypothesize that, in glioma, hypoxia-regulated miR224-3p acts as a diagnostic miRNA or a tumor suppressor mainly by suppressing FIP200 and inhibiting ATG5. [score:8]
Through screening, we found that miR224-3p, the most significantly down-regulated miRNA, played an inhibitory role in the regulation of autophagy in GBM cells. [score:7]
To further define the involvement of ATG5 and FIP200 in the suppression of autophagy by miR224-3p, both ATG5 and FIP200 overexpressing-plasmids were co -transfected into miR224-3p -overexpressing U251 and U87 cells. [score:7]
MiR224-3p down-regulation enhances hypoxia -induced autophagy by releasing the expression of target genes, including ATG5 and FIP200. [score:7]
To reduce the number of target genes, we performed a Western blot assay to distinguish whether miR224-3p inhibited hypoxia -induced autophagy by targeting the ERK/AKT/mTOR pathway, which is the main regulator of autophagy. [score:7]
MiR224-3p is down-regulated under hypoxia, indicating that miR224-3p plays an important role in inhibiting the hypoxia -induced autophagy of GBM cells. [score:6]
To further determine whether miR224-3p regulates target genes via direct interactions with binding sites in their 3′ untranslated regions (UTRs), we performed a dual-luciferase reporter assay. [score:6]
Accordingly, we focused on the inhibitory effects of hypoxia-down-regulated miR224-3p on the autophagic activity of GBM cells. [score:6]
In this study, we screened a miRNA microarray of GBM cells cultured under hypoxic conditions and identified hypoxia-down-regulated miR224-3p as a novel inhibitor of autophagy in GBM. [score:6]
Hypoxia induces miR224-3p down-regulation in glioblastoma cell lines, and miR224-3p expression is low in human glioma. [score:6]
MiR224-3p targets the expression of ATG5 and FIP200, which in turns suppresses the formation of autophagosomes. [score:6]
miR224-3p is down-regulated under hypoxia in glioblastoma cell and expressed at low levels in human glioma. [score:6]
Therefore, we propose that miR224-3p potentially inhibits hypoxia -induced autophagy and is expressed at low levels in human glioma. [score:5]
At the same time, hypoxia -induced GFP-LC3 puncta accumulation was dramatically suppressed by transfecting miR224-3p mimic into U251 and U87 cells that stably expressed GFP-LC3, reflecting a decrease in autophagic activity (Figure 4C, 4D). [score:5]
The expression of LC3B-II increased and that of p62 decreased (Figure 3A), suggesting that the miR224-3p inhibitor enhanced autophagy in the transfected cells. [score:5]
Both ectopic expression of ATG5 and FIP200 significantly rescued miR224-3p -induced inhibition of autophagy (Figure 5D). [score:5]
MiR224-3p inhibitors used to inhibit the level of endogenous miR224-3p were transfected into U251 and U87 cells. [score:5]
The data shown are the mean ± SD of independent experiments, n = 3. MiR224i, miR224-3p inhibitor; NCi, miRNA inhibitor negative control. [score:5]
At the same time, we also examined the location of GFP-LC3 by fluorescence microscopy in miR224-3p inhibitor -transfected U251 and U87 cells stably expressing the GFP-LC3 fusion protein. [score:5]
Thus, it is not unexpected that miR224-3p regulates the hypoxia -induced autophagy of GBM cells by directly targeting pleiotropic ATGs. [score:5]
The consistency between the lower expression of miR224-3p and the higher expression of HIF1α and LC3B in glioma tissue in part validates the hypothesis. [score:5]
MiR224m, miR224-3p mimic; miR224i, miR224-3p inhibitor; NCm, miRNA mimic negative control; NCi, miRNA inhibitor negative control. [score:5]
Overexpression of miR224-3p inhibits hypoxia -induced autophagy. [score:5]
In the same way, miRNA224-3p mimic was transfected into both cell lines, and autophagy was slightly inhibited, as indicated by the decreased LC3B-II expression and increased accumulation of p62 (Supplementary Figure S3B). [score:5]
The targets of miR224-3p were obtained from the following target prediction programs: http://microRNA. [score:5]
Similarly, there were no changes in the ERK/AKT/mTOR pathway between the miR224-3p inhibitor and negative control inhibitor groups (Supplementary Figure S2C). [score:5]
B. U251 and U87 cells were transfected with miR224m or NCm and incubated for 48 h. mRNA expression levels of predicted targets of miR224-3p were determined by q-PCR. [score:5]
Furthermore, both targets inversely correlated with the expression of miR224-3p in glioma specimens. [score:5]
MiR224-3p overexpression significantly inhibited luciferase activity in the wild-type ATG5 and FIP200 3′ UTRs but not in the mutated 3′ UTR plasmids, demonstrating the specificity of the miR224-3p binding sites in their 3′ UTRs (Figure 6B). [score:5]
Patients were classified as high or low miR224-3p expression groups based on the miR224-3p -expression in tumors above or below the median values respectively. [score:5]
Notably, overexpression of miR224-3p suppresses tumor growth both in vivo and in vitro, implicating an anti-tumorigenesis role for miR224-3p in GBM. [score:5]
All miRNA (miR224-3p) mimics, inhibitors, negative control and miRNA inhibitor N. C were designed and purchased from Gene Pharma (Shanghai, China). [score:5]
Our data demonstrated that miR224-3p suppresses the expression of two ATGs, including ATG5 and FIP200. [score:5]
Recently, in a Drosophila study, overexpression of FIP200 enhanced autophagy in an Atg1 -dependent manner [34], which may explain why knocking down endogenous miR224-3p increased autophagic activity in normoxia. [score:4]
When exposed to hypoxia, miR224-3p was significantly down-regulated in a time -dependent manner in both GBM cell lines (Figure 2B, lower panel). [score:4]
In our previous study, we hypothesized that hypoxia significantly down-regulates miR224-3p in response to increase autophagic activity. [score:4]
MiR224-3p expression levels correlate with ATG5 and FIP200 expression in glioma tissues. [score:4]
The results demonstrated that miR224-3p was down-regulated independent of HIF (Supplementary Figure S3A). [score:4]
miR224-3p directly targets both ATG5 and FIP200. [score:4]
These results demonstrate the crucial importance of decreasing the expression of endogenous miR224-3p in regulating autophagy under hypoxia. [score:4]
miR224-3p regulates autophagy by targeting multiple ATGs. [score:4]
Moreover, SIRT1 and AMPK1α were also putative direct targets of miR224-3p. [score:4]
In addition, the changes in FIP200 protein levels suggested that FIP200 is also a miR224-3p target (Figure 5C). [score:3]
miR224-3p suppresses glioblastoma cell proliferation and promotes hypoxia -induced apoptosis. [score:3]
To further validate the expression of miR224-3p, we measured miR224-3p expression in U251 and U87 cells under hypoxic conditions at 24 h and 48 h by q-PCR. [score:3]
C. Associations between ATG5 and miR224-3p, FIP200 and miR224-3p expression in 30 glioma tissue specimens were analyzed by Fisher's exact test. [score:3]
miR224-3p inversely correlates with ATG5 and FIP200 expression in human glioma tissues. [score:3]
At 48 h after hypoxia treatment, miR224-3p expression decreased more than 5-fold. [score:3]
In the present study, we observed that miR224-3p suppressed GBM cells proliferation and increased hypoxia -induced apoptosis. [score:3]
We confirmed that miR224-3p targeted both of ATG5 and FIP200. [score:3]
We then examined the mRNA levels of the putative miR224-3p targets by q-PCR in GBM cells transfected with miR224-3p mimic. [score:3]
We examined the expression of miR224-3p, HIF1α and LC3B in clinical glioma specimens and normal brain tissues. [score:3]
BAF treatment significantly increased LC3B-II in both miR224-3p mimic- and inhibitor -transfected cells. [score:3]
The data shown are the mean ± SD of independent experiments, n = 3. C. miR224-3p expression in glioma and normal brain tissues was determined by q-PCR analysis and grouped according to WHO I, II grade (n = 14), III, IV grade (n = 16) and normal brain tissue (n = 6). [score:3]
miR224-3p inhibits growth of GBM in vivo. [score:3]
U251 and U87 GFP-LC3 stable cell lines were transfected with miR224-3p mimics or inhibitors under hypoxia or normoxia and fixed in 4% paraformaldehyde. [score:3]
MiR224-3p directly targets ATG5 and FIP200 by interacting with 3′ UTRs. [score:3]
Consistent with our findings, FIP200 expression in glioma and brain tissues is inversely associated with miR224-3p levels. [score:3]
Western blotting with specific antibodies showed that the SIRT1 and ATG3 protein levels had not decreased in miR224-3p -overexpressing cells (Supplementary Figure S2D). [score:3]
B. U251 and U87 cells were exposed to hypoxia (1% O [2]) for 24 h and 48 h. Cells were collected for q-PCR to quantify miR224-3p expression. [score:3]
In contrast, the expression levels of miR224-3p were low under normoxic culture conditions. [score:3]
Here, we used DMOG, a HIF1α stabilizer, in normoxia to examine the effects of HIF1α on the expression of miR224-3p. [score:3]
However, other predicted miR224-3p target genes did not show significant changes in either U251 or U87 cells (Figure 5B). [score:3]
We observed that miR224-3p overexpression attenuated cell proliferation in both U251 and U87 cells, and neutralizing the endogenous miR224-3p improved proliferation (Figure 8A, 8B). [score:3]
Consistent with the alteration of ATG5 mRNA levels, transfection of the miR224-3p mimic and inhibitor resulted in the reduction and increase, respectively, of ATG5 protein levels. [score:3]
After tumor formation, we carried out intratumoral injections of miR224-3p mimic -expressing lentivirus. [score:3]
There were no pronounced differences in the expression of ERK1/2, p-ERK1/2, AKT, p-AKT and p-mTOR between the miR224-3p mimic and negative control mimic groups. [score:3]
MiR224-3p regulates autophagy by targeting ATGs in glioblastoma cells. [score:3]
This phenomenon may be related to the inhibitory role of miR224-3p in autophagy. [score:3]
In addition, we discovered that overexpression of miR224-3p attenuates GBM cell proliferation and promotes hypoxia -induced apoptosis. [score:3]
Furthermore, we observed that miR224-3p levels inversely correlated with the protein levels of ATG5 and FIP200 (P < 0.01) (Figure 7C), which definitely indicated that miR224-3p regulates ATG5 and FIP200 in glioma tissues. [score:2]
Deregulation of miR224-3p has been reported in plasma from CRC patients [50] and peripheral blood mononuclear cells from patients with non-segmental vitiligo [51]. [score:2]
Finally, we performed an LC3 turnover assay in both miR224-3p mimic -transfected and inhibitor -transfected cells to exclude the possibility of a block in the downstream steps during autophagic flux. [score:2]
To document the effects of miR224-3p on hypoxia -induced autophagy, we overexpressed miR224-3p in both U251 and U87 cells to reverse its low levels during hypoxia treatment and repeated the above validation assays. [score:2]
Taken together, our results suggest that miR224-3p plays an important role in the regulation of hypoxia -induced autophagy in glioma tissues. [score:2]
More importantly, the effects of miR224-3p on ATG5 and FIP200 were direct, as miR224-3p-response elements (MREs) were found in the 3′ UTRs of the ATG5 and FIP200 genes. [score:2]
MiR224-3p overexpression markedly reversed hypoxia -induced autophagy. [score:2]
Therefore, at both the mRNA and protein levels, we demonstrated that miR224-3p regulates autophagy independent of the ERK/AKT/mTOR pathway, SIRT1 and ATG3. [score:2]
Compared with the negative control, LC3B-II expression and p62 degradation during hypoxia treatment were markedly reduced upon miR224-3p mimic transfection (Figure 4A, 4B). [score:2]
Further work is required to define the mechanisms of hypoxia in down -regulating miR224-3p and to illuminate whether miR224-3p could be a diagnostic marker for glioma. [score:2]
MiR224-3p was down-regulated in human glioma tissues compared with normal brain tissues (P < 0.001). [score:2]
There was a significant increase in GFP-LC3 puncta in miR224-3p inhibitor -transfected cells compared with the negative control cells (Figure 3C, 3D, 3E). [score:2]
The data shown are the mean ± SD, n = 5. B. Schematic diagram of miR224-3p regulation of hypoxia -induced autophagy. [score:2]
However, the specific mechanism by which hypoxia down-regulates miR224-3p requires further investigation. [score:2]
Furthermore, knockdown of endogenous miR224-3p highly induced GBM cell autophagic activity. [score:2]
In addition, the miR224-3p inhibitor group exhibited higher levels of LC3BII compared with the NCi group (Figure 3B). [score:2]
After screening the hypoxia GBM cell miRNA microarray, we detected miR224-3p as a novel autophagy-related miRNA. [score:1]
The mice were randomly divided into two groups (negative control lentivirus group, n = 5; miR224-3p mimic lentivirus group, n = 5). [score:1]
In our study, miR224-3p attenuated ATG5 mRNA and protein levels in both U251 and U87 transfected cells. [score:1]
In both U251 and U87 cells, the transfection of miR224-3p mimic, but not the negative control mimic, significantly reduced ATG5 mRNA levels. [score:1]
MiR224-3p mimic and inhibitor were transfected into both GBM cell lines, which were then harvested for the assay. [score:1]
Then, we designed pmirGLO-luciferase plasmids containing either the wild-type (WT) or mutated (MUT) miR224-3p binding sequences in the 3′ UTRs of ATG5 and FIP200. [score:1]
However, besides autophagy, the function of miR224-3p in cancer is not clear. [score:1]
To evaluate the clinical significance of miR224-3p, thirty glioma specimens [sixteen high-grade tissues (World Health Organization (WHO); WHO III-IV) and fourteen low-grade tissues (WHO I-II)] and six normal brain specimens were collected to detect miR224-3p expression by q-PCR. [score:1]
miR224-3p influences glioblastoma cell autophagic activity. [score:1]
Taken together, our data show that miR224-3p demonstrated antioncogenic activities in glioma. [score:1]
A. Predicted binding sequences for miR224-3p and matches in the ATG5 and FIP200 3′ UTRs. [score:1]
We also examined the effects of miR224-3p on cell apoptosis both under hypoxia and normoxia. [score:1]
A 290-bp fragment of the wild-type (WT) ATG5 3′ UTR (Supplementary Table S2) containing one conserved miR224-3p binding site (position 1874–1880) or a mutant ATG5 3′ UTR sequence was cloned into the pmirGLO vector (E133A, Promega, WI, USA). [score:1]
For FIP200, a 290-bp fragment of the 3′UTR sequence containing two conserved miR224-3p binding sites (position 6036–6042 and 6153–6159) and a mutant sequence were cloned as for ATG5 (Supplementary Table S2). [score:1]
MiR224m, miR224-3p mimic; NCm, miRNA mimic negative control. [score:1]
Interestingly, there was a significant decrease in LC3B-II in miR224-3p -transfected cells (Supplementary Figure S2B). [score:1]
C. miR224-3p overexpression was performed for 24 h, and then U251 cells were incubated under hypoxia and normoxia for 48 h. Transfected cells were fixed and stained with propidium iodide (PI) and FITC for flow cytometry to measure the apoptosis rate. [score:1]
As we had established the vital role of miR224-3p in the hypoxia -induced autophagy of GBM cells, we next evaluated the effects of miR224-3p on potential targets related to autophagy. [score:1]
Moreover, miR224-3p confers anti-tumorigenicity abilities on GBM cells in vivo. [score:1]
The data shown are the mean ± SD of independent experiments, n = 3. MiR224m, miR224-3p mimic; NCm, miRNA mimic negative control. [score:1]
In contrast, the accumulation of LC3B-II in the miR224-3p mimic group was lower than in the control group after BAF treatment (Supplementary Figure S3B). [score:1]
Therefore, the mechanisms underlying the physiological functions of miR224-3p should be further illustrated. [score:1]
The pmirGLO-luciferase plasmids were co -transfected with either miR224-3p mimic or negative control mimic. [score:1]
Transfection of miR224-3p mimic did not change the rate of apoptotic cells (Figure 8C) or the activity of caspase3 (Figure 8D) under normoxia. [score:1]
Figure 6 A. Predicted binding sequences for miR224-3p and matches in the ATG5 and FIP200 3′ UTRs. [score:1]
The hypoxia markers miR210 and miR224-3p are tagged by a red circle. [score:1]
GBM cells were co -transfected with the luciferase reporters together with miR224-3p mimic or NCm using Lipofectamine 2000. [score:1]
These data suggest that miR224-3p indeed affected autophagic activity in the GBM cell lines. [score:1]
[1 to 20 of 118 sentences]
2
[+] score: 276
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-221
IPA reported that the top one disease regulated by miR-224 was “Cancer” and the top three molecular and cellular functions of the genes regulated by miR-224 were “Gene Expression”, “Cell Cycle”, and “Cell Death”, and the top two ranked canonical pathways of the genes regulated by miR-224 were reported to be “Regulation of Actin -based Motility by Rho” and “Cell Cycle Regulation by BTG Family Proteins” (Table 1). [score:10]
2006.02.057 16762633 9. Wang Y. Lee A. T. Ma J. Z. Wang J. Ren J. Yang Y. Tantoso E. Li K. B. Ooi L. L. Tan P. Lee C. G. Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224-specific target J. Biol. [score:10]
The IPA reports places “Cancer” as the top one disease regulated by miR-224, while the top three molecular and cellular functions associated with the list of genes regulated by miR-224 were listed as “Gene Expression”, “Cell Cycle”, and “Cell Death”, and the top two ranked canonical pathways of the genes regulated by miR-224 were reported to be “Regulation of Actin -based Motility by Rho” and “Cell Cycle Regulation by BTG Family Proteins”. [score:10]
Furthermore, according to the cDNA array, after the network between genes and diseases regulated by miR-224 was constructed, it demonstrated that many genes regulated by miR-224 were involved in cancer and liver diseases. [score:7]
In the current study, based on the mRNA microarray data, IPA was applied to dissect the miR-224 function and we found the top-ranked disease regulated by miR-224 was cancer, and the top three ranked molecular and cellular functions related by miR-224 were “gene expression”, “cell cycle”, and “cell death”. [score:6]
Others reported miR-224 to be upregulated in the hepatocellular cell line HepG2 and involved in cellular migration and invasion [20], and a recent study reported miR-224 may be a unique biomarker for the early detection of liver malignancies as well as a novel therapeutic target for HCC treatment [21]. [score:6]
Overexpression of miR-224 decreased p21 protein expression. [score:5]
Figure 5 Protein expression of miR-224 target genes decrease upon miR-224 stimulation. [score:5]
PGL4 luciferase plasmid construction: According to TargetScan [16], miR-224 has a binding site in p21 3′-untranslated region (3′-UTR) at the position of 1524–1530. [score:5]
miR-224 was found to be upregulated in HCC (regardless of the etiology, including alcohol, hepatitis B, hepatitis C, hemochromatosis, idiopathic), hepatocellular adenomas (in a background of contraceptive use, beta-catenin mutations, and others), and focal nodular hyperplasia. [score:5]
The expression of miR-224 was linked with expression of enhanced green fluorescence protein (eGFP) via internal ribosome entry site 2 (IRES2). [score:5]
To verify whether miR-224 impacts the protein levels of these targets, H69, HuCCT1, CAK1, Huh7, and Hep3B cells, respectively, were treated with miR-224 mimic, and Western blotting was performed in these cell lines for the putative targets. [score:5]
This increases the expression level changes caused by treatment with a miR mimic at least two-fold [18] and, hence, we chose HCT Dicer (-) cells to obtain better sensitivity of miR-224 -targeted mRNAs. [score:5]
However, we noted that following transfections, miR-224 was upregulated to levels that were un-physiologically high. [score:4]
The list of genes identified to be downregulated upon miR-224 stimulation was then filtered and input into Ingenuity Pathway Analysis (IPA, Ingenuity Systems Incorporated, Redwood City, CA, USA), with the purpose of identifying general mechanisms of miR function. [score:4]
It was observed that miR-224 is upregulated in HCC patients and acts as an oncogene [9]. [score:4]
To accomplish a lower, more physiological level of miR-224 upregulation than in transfection experiments, we inserted the genomic locus of miR-224 in a retrovirus, MSCV-IRES-Enhanced-GFP-3 (MIEG3). [score:4]
We then infected HuCCT1, H69, Huh7, and HCT116 Dicer (-) with MIEG3-EV (empty vector, EV) and MIEG3-miR-224V (miR-224V), respectively, and determined the level of miR-224 upregulation. [score:4]
In addition, we characterized the function of miR-224 based on mRNA targets that were experimentally downregulated rather than predicted based on web -based search engines. [score:4]
Furthermore, a different study found upregulation of miR-224 in dysplastic liver nodules, along with HCC [11]. [score:4]
A recent study of chemoresistance to cisplatin in human lung adenocarcinoma also demonstrates p21 as a direct target of miR-224, confirming our observations [26]. [score:4]
We therefore concluded that the treatment of cancer cells with miR-224 releases the G1/S checkpoint through the coordinated downregulation of p15, p21, and CCNE1, resulting in increased phosphorylation of Rb and, finally, enhanced cell cycle progression. [score:4]
To investigate if miR-224 actions are exerted through direct binding to conserved binding sites in the 3′UTR of the targets identified in the current study, we first performed an in silico complementarity search by employing TargetScan [16]. [score:4]
The impact of targeting miR-224 in CCA on normal cholangiocytes remains to be investigated as p-Rb levels did not change upon miR-224 stimulus, but an effect of further downregulation of miR-224 cannot be excluded. [score:4]
In the current study, we found miR-224 was upregulated in a large cohort of human CCA vs. [score:4]
In addition, miR-224 is the sole miR species to be upregulated in a variety of benign and malignant liver tumors, arising in a variety of predisposing liver conditions [10]. [score:4]
3.1. miR-224 is Upregulated in Human CCA vs. [score:4]
We found that miR-224 induces a G1/S checkpoint release through the downregulation of p21, p15, and CCNE1, resulting in increased phosphorylation of Retinoblastoma (Rb). [score:4]
Figure 2Cells display increased growth upon modest miR-224 upregulation through infection with MIEG3-miR-224. [score:4]
We found that miR-224 is upregulated in human CCAs. [score:4]
It is of note that this analysis was performed on mRNA species that are reported to be downregulated by miR-224 on the cDNA arrays, irrespective of the presence of the binding site in the 3′UTR or in silico search engine prediction. [score:4]
Although there is no information regarding its levels in human CCA, in a profiling study followed by a quantitative real-time polymerase chain reaction (qRT-PCR), miR-224 was found to be the most significantly overexpressed miR species in HCC [9]. [score:3]
Luciferase activity in the cells co -transfected with miR-224 mimic was down-regulated by ~40% (p < 0.001, unpaired Student’s t-test) compared with cells co -transfected with NSM. [score:3]
Figure 4 HuCCT1 cells display G1 release upon reinforced miR-224 expression. [score:3]
We did not identify HOXD10 as a target of miR-224 as shown in HCC [22]. [score:3]
Wang H. Zhu L. J. Yang Y. C. Wang Z. X. Wang R. MiR-224 promotes the chemoresistance of human lung adenocarcinoma cells to cisplatin via regulating G(1)/S transition and apoptosis by targeting p21(WAF1/CIP1) Br. [score:3]
Compared to cells infected with MIEG3 alone (EV), cells infected with miR-224V displayed a 3.4- and 3.6-fold upregulation of miR-224 in HuCCT1 and Huh7 cells, respectively (Supplementary Figure 1A,B). [score:3]
Y-axis: qRT-PCR expression of miR-224 vs. [score:3]
As seen in Figure 5, the expression of miR-224 results in the decreased protein levels of p15, p21 and CCNE1. [score:3]
In addition to the bioinformatics analysis above, we further verified that miR-224 targeted the p21 mRNA 3′UTR in both HuCCT1 cells and Huh7 cells, using the Dual-Glo Luciferase analysis system. [score:3]
It is possible miR-224 targets differ in different tumor types, but it is more likely that the different bioinformatics approaches led to the difference. [score:3]
Li Q. Wang G. Shan J. L. Yang Z. X. Wang H. Z. Feng J. Zhen J. J. Chen C. Zhang Z. M. Xu W. MicroRNA-224 is upregulated in HepG2 cells and involved in cellular migration and invasion J. Gastroenterol. [score:3]
This experiment revealed a noticeable decrease in G0 to G1 phase and a corresponding increase in G2 to M phase in miR-224 overexpressed HuCCT1 cells (Figure 4). [score:3]
Then, we got the cells stably expressing miR-224 (MIEG3-224V), and the empty MIEG3 virus was used as control (MIEG3-EV). [score:3]
As such, this finding invites the conclusion that miR-224 regulates CCA cell growth by suppressing p21 directly, but how it impacts the other molecules remains to be investigated. [score:3]
MSCV -based bicistronic retroviral vectors MIEG3 [14] were used to express miR-224. [score:3]
Another group was able to demonstrate that increased miR-224 levels in HCC cell lines MHHC97H and MHCC97L targeted HOXD10 and confirmed reduced HOXD10 protein levels in human HCC samples, although the group did not examine miR-224 levels in these samples [22]. [score:3]
Figure 3 Genes with altered expression upon miR-224 stimulation are involved in the G1/S checkpoint. [score:3]
The average expression of miR-224 vs. [score:3]
Li Q. Ding C. Chen C. Zhang Z. Xiao H. Xie F. Lei L. Chen Y. Mao B. Jiang M. miR-224 promotion of cell migration and invasion by targeting Homeobox D 10 gene in human hepatocellular carcinoma J. Gastroenterol. [score:3]
In conclusion, our results suggest that miR-224 enhances G1/S release in CCA via p21 targeting. [score:3]
In the current study, we focused on the role of miR-224 in cell cycle regulation and subsequent cell growth in cancers arising from liver cells, including HCC and CCA. [score:2]
Molecules Number indicates the number of molecules that were regulated by miR-224 involved in functions and signal pathways. [score:2]
To study the precise cell cycle-related molecules impacted by miR-224, the network between miR-224 and mRNA was constructed and it showed that miR-224 appears to regulate several molecules involved in the G1/S checkpoint. [score:2]
As Figure 3 shows, based on cDNA microarray data, miR-224 appears to regulate several molecules involved in the G1/S checkpoint. [score:2]
With the exception of p21, the other molecules including p15, CCNE1, and p-Rb have no direct binding sites for miR-224. [score:2]
We assayed the expression of miR-224 in a large cohort of 62 human specimens, including 28 CCAs and 34 normal liver tissues. [score:2]
For the 3'UTR mutant, the miR-224 binding site was mutated by substituting the eight nucleotides of the miR-224 binding sites using the Gene Tailor site-directed mutagenesis system (Cat# 4500239; Invitrogen, Carlsbad, CA, US). [score:2]
Combined, our findings implicate miR-224 as a salient regulator of cell growth in liver cancers, with potential therapeutic implications. [score:2]
We conceived our hypothesis that miR-224 plays a regulatory role in CCA based on the findings above. [score:2]
3.5. miR-224 Regulates Multiple Proteins Involved in G1/S Checkpoint. [score:2]
These data confirmed that miR-224 can bind directly to the 3′UTR of p21 in human liver cancer cells. [score:2]
P15, p21, and CCNE1 were identified to be regulated by miR-224. [score:2]
We next assessed a potential direct interaction between miR-224 and p21 in vitro using HuCCT1 and Huh7 cells that were transfected with luciferase reporter plasmids containing the wild-type p21 mRNA 3′UTR as well as miR-224 mimic or NSM. [score:2]
This supported our hypothesis that miR-224 plays important roles in CCA, and further supplied us with the possibility that miR-224 is involved in cell cycle regulation in CCA. [score:2]
The figure displays the mean and standard deviation of qRT-PCR-measured expression of miR-224 normalized to RNU6B for human CCA (filled circles) and normal liver tissues (open circles). [score:1]
3.3. miR-224 Functions and Signaling Pathways Analysis. [score:1]
3.4. miR-224 Induces G1/S Checkpoint Release in Normal and Cancer Cells. [score:1]
qRT-PCR was used to evaluate the expression of miR-224. [score:1]
Wang Y. Lee C. G. Role of miR-224 in hepatocellular carcinoma: A tool for possible therapeutic intervention? [score:1]
The mRNA levels of p15 (INK4), p21(Cip1), and Cyclin E1 (CCNE1) together with their respective protein levels decreased and p-Rb (phospho-Rb) increased in cells following miR-224 stimulation. [score:1]
To obtain a mechanistic view into the effects of miR-224 in cancer cells, and since miR -induced destabilization of mRNA is the main reason for decreased protein levels [17], we stimulated HCT116 Dicer (-) with a miR-224 mimic and performed cDNA microarray analysis to quantify changes in mRNA levels. [score:1]
From this point on, we focused on the cell cycle effects of miR-224. [score:1]
The mRNA levels of p15 (INK4), p21(Cip1), and Cyclin E1 (CCNE1) decreased following miR-224 stimulation. [score:1]
The synthesized miR-224 mimic (miR-224M, Cat# C-300676-05) and non-specific mimic (NSM, Cat# CN-001000-01-10) were purchased from Dharmacon (Lafayette, LA, USA). [score:1]
19E--01 7 Biliary Hyperplasia 3.20E-02–3.20E--01 1 Liver Degradation 3.20E-02–3.20E--02 1 To study the molecular mechanisms responsible for the miR-224 -induced cell cycle dysfunction, we queried IPA in regards to genes impacted by miR-224 that are also involved in the G1/S checkpoint. [score:1]
In accordance with our hypothesis, we found an increasing level of p-Rb in cells treated with miR-224. [score:1]
We therefore determined whether cells treated with miR-224 showed increased phosphorylation of Rb (p-Rb). [score:1]
3.2. miR-224 Induces Cell Growth. [score:1]
Genes that demonstrated less than 20% decrease upon stimulation with miR-224 were eliminated. [score:1]
H-69 (a), HuCCT1 (b), Huh7 (c), and HCT116 (-) (d); cells were counted at different days after plating of MIEG3-miR-224 (miR-224V) or MIEG3-EV (EV) cells, respectively. [score:1]
normal liver tissues, and further study demonstrated miR-224 promotes the growth of cancer cells including cholangiocarcinoma HuCCT1 cells. [score:1]
miR-224 induces a statistically significant decrease in luminescence (p-value < 0.001, Student’s t-test) of the forward p21 3′UTR fragment vs. [score:1]
Similar experiments were conducted in Huh7 cells, where miR-224 decreased the luciferase activity by ~20% (p < 0.001, unpaired Student’s t-test), an effect that was lost upon mutating the miR-224 binding site (Figure 6b). [score:1]
To identify the precise effects of miR-224 on the cell cycle in CCAs, HuCCT1 cells were cultured in growth media without serum (serum-starved) for 72 h and then cultured with the growth media for another 30 h; then the cells were collected and cell cycle analysis was performed by PI staining. [score:1]
Flow cytometric analysis of cell cycle via PI staining of HuCCT1 cells infected with MIEG3-miR-224 (224V, lower panels), or MIEG3 only (EV, upper panels). [score:1]
We started exploring the function of miR-224 by performing cell line transfections. [score:1]
3.6. miR-224 Binds to p21 mRNA 3′UTR. [score:1]
Taken together, these data suggest that miR-224 might be involved at an early hepatic carcinogenetic stage and that its levels might be relevant to the liver cell growth potential. [score:1]
Eight micrograms (μg) of plasmid DNA of miR-224 together with 10 μg MLV gag-pol plasmid and 3 μg Vesicular stomatitis virus envelope glycoprotein (VSV-G) plasmid were co -transfected using Lipofectamine 2000 (Cat# 11668-019; Invitrogen, Carlsbad, CA, USA). [score:1]
We then hypothesized that if the effects of miR-224 on these proteins are significant, the final step in the G1 to S transition checkpoint should also be affected. [score:1]
It was further confirmed by flow cytometry that miR-224 induces G1/S release and promotes the cell cycle process. [score:1]
As shown in Figure 2, miR-224 induces increased growth in H69, HuCCT1, and Huh7, as well as in HCT116(-) cells. [score:1]
NSM: non-specific mimic, 224M: miR-224 mimic; WT 3′UTR: correct orientation fragment of p21 3′UTR containing miR-224 binding site; Mut 3′UTR: fragment of p21 3′UTR containing a mutated miR-224 binding site. [score:1]
In addition, we set out to precisely determine pathways downstream of miR-224. [score:1]
Transfection with miR-224 Mimic or Non-Specific Mimic. [score:1]
Interestingly, the level of miR-224 paralleled the tumor growth potential, with normal levels in normal liver as well as in cirrhotic liver or liver infected with hepatitis B or C but statistically significantly higher levels in benign tumors and even higher levels in malignant tumors [10]. [score:1]
[1 to 20 of 97 sentences]
3
[+] score: 216
Other miRNAs from this paper: hsa-mir-328, hsa-mir-449b
Furthermore, miR-224 expression levels were significantly up-regulated in the tissues of CRC patients with disease relapse compared with those without disease relapse, and the CRC patients with up-regulated miR-224 in tumor tissues had a high risk of relapse. [score:12]
Using the samples from the second cohort, we found that the miR-224 expression levels were significantly up-regulated in the tissues of CRC patients with disease relapse (n=40) compared with those without disease relapse (n=68) (P<0.01, Figure 1B). [score:9]
In the present study, we demonstrated that miR-224 was significantly up-regulated in CRC tissue samples and associated with disease relapse and a relative poorer disease-free survival rate. [score:8]
Secondly, over -expression of miR-224 suppressed SMAD4 protein levels without any change in SMAD4 mRNA expression. [score:7]
Using chi-square test and Kaplan-Meier analysis, the results demonstrated that high miR-224 expression was significantly associated with disease relapse and a relative poorer disease-free survival rate (Figure 1B). [score:7]
Thus, SMAD4 is likely to be suppressed by miR-224 through translational inhibition. [score:7]
Furthermore, the over -expression of miR-224 in CRC cell lines decreased SMAD4 expression at the translational level and decreased SMAD4 -driven luciferase-reporter activity. [score:7]
Recently, Fellenberg et al. showed that the miR-224 functions as an important regulator of stem cells induction by targeting the apoptosis inhibitor, API5 [31]. [score:6]
In our study, restoration of miR-224 promoted CRC cell proliferation, migration and invasion, this could possibly be due to miR-224 -mediated down-regulation of SMAD4 expression. [score:6]
Figure 5 MiR-224 down-regulates SMAD4 protein expression but not mRNA level. [score:5]
Recently, miR-224 has been shown to be up-regulated in cervical cancer and pancreatic ductal adenocarcinomas [10, 11], and the involvement of miR-224 in the tumorigenesis and development of breast cancer and hepatocellular carcinoma has also been reported [12, 13]. [score:5]
Moreover, we also demonstrated miR-224 promoted proliferation, migration and invasion of SW480 cells, at least partially through suppression of SMAD4 expression. [score:5]
demonstrated that high expression of miR-224 dramatically suppressed the endogenous protein level of SMAD4 (P<0.01, Figure 5B), while mRNA remained unchanged (P>0.05, Figure 5A). [score:5]
We have discovered a novel target of miR-224 (Smad4), which has key function in TGF-β signaling, providing the possibility that miR-224 may mediate CSC by suppressing TGF-β/Smad4 activity. [score:5]
Among patients with miR-224 high expression, 27 patients relapsed (27/48, 56.3%), while only 13 patients relapsed (13/60, 21.7%) among patients with miR-224 low expression. [score:5]
Correlations between miR-224 expressions and disease relapse. [score:5]
Moreover, miR-224 is one of the most highly differentially expressed miRNAs in methotrexate-resistant cells, and its over -expression induces the resistant phenotype in HT29 colon cancer cells [16]. [score:5]
The reporter constructs harboring mutation of the miR-224 target sites were generated similarly (MUT1, MUT2 and MUT3) (Figure 4A). [score:4]
Previous reports revealed that miR-224 was upregulated in CRC by miRNA microarray analysis [14, 15]. [score:4]
Firstly, the luciferase reporter assay demonstrated its down-regulation was mediated by the direct binding of miR-224 to the SMAD4 3′-UTR, because the alteration of this region abolished this effect. [score:4]
Figure 1 miR-224 is up-regulated in CRC tissues and associated with the relapse of CRC. [score:4]
MiR-224 inhibits SMAD4 protein expression but not mRNA level. [score:4]
Therefore, in the current study, we further determined whether SMAD4 gene was an authentic target gene of miR-224 in CRC. [score:3]
In this study, we found that miR-224 expression in tumor tissues was significantly higher than that in normal tissues (P<0.01, Figure 1A). [score:3]
We performed a luciferase reporter assay to verify that miR-224 directly targets SMAD4. [score:3]
These data indicate that miR-224 may target SMAD4 gene through the seeding region of wild type 3′UTR (site1, site2). [score:3]
However, the luciferase reporter activity was not inhibited by miR-224 when the seeding sites were mutated. [score:3]
The expression levels of the miR-224 were categorized as low or high in relation to the cutoff value (25.72) on the basis of ROC curve analysis. [score:3]
MiR-224 was upregulated in CRC, implicating its potential role in CRC cells biological properties. [score:3]
To address the molecular mechanisms involved in miR-224 -mediated changes of biological properties, SMAD4 was selected for further study because it was predicted to be a target of miR-224 by bioinformatics analysis. [score:3]
To further confirm that SMAD4 was the downstream target of miR-224, we analyzed SMAD4 mRNA and protein levels in transfected SW480 cells by qRT-PCR and Western blot. [score:3]
Ectopic expression of miR-244 in cells was achieved by transfection with Pre-miR-224 precursor (pre-miR-224) (Ambion, Foster City, CA, USA) using Lipofectamine 2000 (Invitrogen). [score:3]
Moreover, ectopic expression of miR-224 potently promoted tumor cell proliferation, migration and invasion in vitro. [score:3]
do), indicates that SMAD4 is theoretically the target gene of miR-224 (Figure 4A). [score:3]
Figure 2. (A) miR-224 expression in SW480 cells transfected with pre-miR-224 or pre-miR-nc. [score:3]
Abnormally expressed miR-224 was found to play a fundamental role in several types of cancer. [score:3]
The present data showed that miR-224 had oncogenic effects, including the promotion of CRC cell proliferation, migration and invasion, at least in part by targeting the anti-oncogene SMAD4, highlighting the function of miR-224 in the process of tumor progression. [score:3]
To test whether miR-224 was differentially expressed between paired tumor and adjacent normal tissue in the same subject, we recruited a second cohort comprising 20 CRC patients. [score:3]
Our study suggested that SMAD4 was a possible target of miR-224. [score:3]
Therefore, we proposed that the main mechanism of miR-224 -induced SMAD4 suppression was post-transcriptional. [score:3]
In summary, the association between increased levels of miR-224 and disease relapse in CRC patients indicated that miR-224 was a potential biomarker for identifying high-risk CRC patients after radical resection. [score:3]
We observed that overexpression of miR-224 significantly promoted the proliferation of SW480 cells, at 24, 48, 72 h after transfection (P<0.05, Figure 2B). [score:3]
In addition, SMAD4 has been confirmed as a target gene of miR-224 in Granulosa Cells [28]. [score:3]
In the current study, we confirmed that miR-224 expression in CRC tumor tissues was significantly higher than that in normal tissues. [score:3]
Figure 4 SMAD4 is a validated target of miR-224. [score:3]
We then examined the effect of miR-224 on cell invasion across an extracellular matrix and showed that in SW480 cells, the overexpression of miR-224 markedly enhanced the invasive potential compared with the control (P<0.05, Figure 3A, 3B). [score:2]
Compared to pre-miR-nc, transfection with pre-miR-224 in SW480 cells led to an approximately 6-fold increase in miR-224 expression as detected by qRT-PCR (Figure 2A). [score:2]
Our results revealed that miR-224 promoted CRC cells growth, migration and invasion in vitro. [score:1]
The roles of miR-224 in cell proliferation, migration and invasion were analyzed with pre-miR-224 transfected cells. [score:1]
These observations suggest that miR-224 plays an important role in promoting migration and invasive ability of CRC cells. [score:1]
Thus, we investigated the relationship between expression level of miR-224 and prognosis in CRC, and further studied the possible function of miR-224 in the CRC cell line. [score:1]
MiR-224 regulates CRC cell invasion and migration in vitro. [score:1]
2×10 [4] SW480 cells were plated onto 96-well plates for 24 h. The cells were then transfected with 50 nM pre-miR-224 or pre-miR-nc. [score:1]
Sequences of the 3′UTR of the SMAD4 mRNA surrounding the two close miR-224 potential binding sites (site 1 and site 2) containing the wild-type (WT1). [score:1]
Our data suggest that miR-224 could play an oncogenic role in the cellular processes of CRC and represent a novel biomarker for tumor relapse of CRC patients. [score:1]
Quantitative RT-PCR (qRT-PCR) was used to evaluate expression levels of miR-224. [score:1]
Thus, miR-224 could function as a potential predictive marker for relapse following radical surgery of colorectal cancer. [score:1]
The luciferase reporter constructs were transfected into HEK 293T cells, along with pre-miR-224 or pre-miR-nc. [score:1]
Receiver operating characteristic (ROC) curve was used to determine the cut off value of miR-224 expression. [score:1]
Taken together, these studies suggest that miR-224 functions as an oncogenic miRNA. [score:1]
we cloned the regions of 3′UTR each containing one putative miR-224 binding site into the psicheck-2 vector and named as WT1 (site1, site2) and WT2 (site3) (Figure 4A). [score:1]
[1 to 20 of 61 sentences]
4
[+] score: 214
Other miRNAs from this paper: hsa-mir-221
These data confirm that both TCF21 protein and miR-224 are expressed in the diseased vessel wall in vivo, and their expression is inversely regulated during atherosclerosis, consistent with our observations in HCASMC. [score:8]
In complementary studies reported herein we provide evidence that the 3′-untranslated region (3′-UTR) of TCF21 binds miR-224 to regulate expression of this gene, and that this regulation is obviated by the minor allele which confers a seed mismatch to disrupt miR-224 binding and accessibility of this region of the TCF21 3′-UTR. [score:7]
Further, miR-224 has been shown to be upregulated by the WNT signaling pathway in meduloblastoma where it was linked to inhibition of proliferation, increased radiation sensitivity and reduced anchorage-independent growth of tumor cells [35]. [score:6]
While a potential role for miR-224 in regulating vascular disease has not been defined, this miRNA has been studied in association with multiple cancer cell types and other cellular systems, and these data provide some insight into upstream pathways that might affect TCF21 expression and thus CHD risk [24], [31]– [36]. [score:6]
Intriguingly, this variant is shown to disrupt the seed binding sequence for microRNA-224, and through altered RNA secondary structure and binding kinetics, leads to dysregulated TCF21 gene expression in response to disease-relevant stimuli. [score:6]
Given the critical role of bZip domain TF families (e. g. AP-1, ATF and CREB) in various cancers, inflammation and developmental processes [26], concurrent miRNA binding to mRNA regions overlapping these sites (e. g. miR-224- TCF21) may represent an exquisite fine-tuning control of target gene expression. [score:6]
Distinct in vitro annealing kinetics between miR-224 and TCF21 3′UTR variantsA striking positive relationship exists between the extent of regulation and the annealing kinetics of the RNA regulator and its target RNA [19], [20]. [score:5]
miR-224 dependent post-transcriptional regulation of TCF21 3′UTR at rs12190287We first evaluated the possibility that the TCF21 3′-UTR variants at rs12190287 differentially regulate protein expression through miR-224 targeting using a pmiR-GLO luciferase reporter system. [score:5]
It is important to consider that transcription factor and miR-224 pathways are regulated by multiple upstream pathways, which can regulate expression and/or activation of TFs and miR-224. [score:5]
The former may be explained by increased transcription of the rs12190287 risk “C” allele resulting in overall increased TCF21 expression, or the miRNA mechanism by which the “C” allele interacts with miR-224 to decrease overall TCF21 expression. [score:5]
For expression analyses with miR-224 overexpression, HCASMC were cultured as described above under normal conditions. [score:5]
These results identify PDGF-BB and particularly TGF-β1 as potential upstream mediators of miR-224 directed allele-specific TCF21 expression at rs12190287. [score:4]
Here, we employed reporter gene studies in HeLa cells, rat and human SMCs with both gain and loss of function approaches to demonstrate that miR-224 regulates TCF21 expression at the protein level. [score:4]
TGF-β and PDGF-BB signaling mediate inverse-correlated miR-224 and TCF21 expression and ASE in HCASMCNext, we investigated the regulatory pattern of endogenous TCF21 and miR-224 gene expression levels in HCASMC. [score:4]
Interestingly, miR-224 was significantly downregulated in stable and unstable atherosclerotic plaques (P = 1.5×10 [−5] and P = 8.2×10 [−6], respectively), as determined by TaqMan qPCR (Fig. 7C). [score:4]
Combining these data with that derived here for miR-224 provides compelling evidence for multiple signaling pathways, operating by transcriptional and post-transcriptional mechanisms, by which rs12190287 regulates TCF21 expression (Fig. 8). [score:4]
We first evaluated the possibility that the TCF21 3′-UTR variants at rs12190287 differentially regulate protein expression through miR-224 targeting using a pmiR-GLO luciferase reporter system. [score:4]
Alternatively, loss-of-function studies were carried out by co-transfecting 50 nmol/L anti-miR-224 or negative control anti-miR inhibitors (Ambion/Life Technologies). [score:3]
Expression of TCF21 and miR-224 in human atherosclerotic lesions. [score:3]
Importantly TCF21 and miR-224 expression levels were perturbed in human atherosclerotic lesions. [score:3]
TCF21 and miR-224 expression in human atherosclerotic coronary artery lesions. [score:3]
We also observed pre-miR-224 to attenuate both PDGF-BB and TGF-β1 stimulated allele-specific TCF21 expression (shown as the normalized ratio of C/G at rs12190287) (Fig. 6D). [score:3]
However, these data showing that the CHD causal variant rs12190287 can disrupt miR-224 binding provides the first evidence for this type of mechanism for coronary disease associated genes. [score:3]
NFκB is a well-characterized transcription factor and mediator of cellular activation by inflammatory cytokines and chemokines, and in the context of hepatocellular carcinoma, miR-224 was shown to be upregulated by tumor necrosis-α (TNF-α) and miR-224 regulation linked to hepatocellular migration and invasion [31]. [score:3]
Alternatively, using a loss-of-function approach with a selective miR-224 inhibitor, we observed increased reporter activity only by the C variant. [score:3]
1004263.g006 Figure 6Correlation of endogenous TCF21 and miR-224 expression levels in HCASMC. [score:3]
In addition, we also demonstrate that miR-224 is reciprocally decreased in these carotid diseased tissues, suggesting that miR-224 may function as a repressor of aberrantly elevated TCF21 levels, but is blunted in the process. [score:3]
TGF-β and PDGF-BB signaling mediate inverse-correlated miR-224 and TCF21 expression and ASE in HCASMC. [score:3]
Probing the TCF21 3′-UTR variants (positions 1040–1075) with Pb [2+] revealed unique cleavage sites proximal to the miR-224 target site (positions 1042–1061) and rs12190287 (position 1058) (Fig. 5A). [score:3]
Taken together, these data support a functional role of miR-224 in various cell types including HCASMC, by preferentially targeting the TCF21 3′UTR C variant, leading to post-transcriptional repression. [score:3]
Further, both PDGF-BB and TGF-β upstream stimuli in HCASMC may account for the miR-224 mediated allele-specific expression at rs12190287. [score:3]
These results further suggest that the C variant of the TCF21 3′-UTR can be directly regulated by miR-224, while the G variant cannot. [score:3]
We synthesized miR-224 guide and passenger strands using miRBase sequences to generate double-stranded miR-224, which has a matched seed sequence of mature miR-224 to the C allele of the TCF21 3′-UTR target site but a mismatch to the G allele of TCF21 3′-UTR (Supplementary Fig. S2, top). [score:3]
As expected, PDGF-BB treatment led to increased total TCF21 expression levels, whereas TGF-β1 led to reduced TCF21, which was blunted in all cases by pre-miR-224 (Fig. 6C). [score:3]
Correlation of endogenous TCF21 and miR-224 expression levels in HCASMC. [score:3]
For instance, both TCF21 and miR-224 are weakly expressed in A7r5 and HeLa cells relative to HCASMC (unpublished observations). [score:3]
Briefly, 5′ radioactively labeled miR-224 or miR-224_SNP (0.5 nM final concentration) was incubated with the TCF21 3′-UTR-C or TCF21 3′-UTR-G target mRNA at 5 nM final concentration in hybridization buffer (100 mM NaCl, 20 mM Tris–HCl, pH 7.4, and 10 mM MgCl [2]) in the presence of 10 mM CTAB at 37°C. [score:3]
Interestingly, we observed a modest negative correlation (r = −0.3287) of endogenous TCF21 and miR-224 expression levels in HCASMC treated with PDGF-BB, although this result did not reach statistical significance (Fig. 6A). [score:3]
However, TGF-β1 treatment resulted in significant and highly inverse-correlated endogenous TCF21 and miR-224 expression levels, r = −0.7061, P = 0.0015 (Fig. 6B). [score:3]
TCF21 and miR-224 expression levels were normalized to 18S and RNU44, respectively. [score:3]
We first explored a potential link between relevant pathways upstream of miR-224 and TCF21 that may account for miR-224- TCF21 3′-UTR allele-specific regulation in HCASMC. [score:2]
1004263.g003 Figure 3Allele-specific miR-224 regulation of TCF21 3′UTR at rs12190287. [score:2]
cDNA templates were used to measure endogenous human miR-224 and TCF21 variant 1 (TCF21 v1) expression levels using predesigned TaqMan gene expression assay probes (Applied Biosystems/Life Technologies) according to the manufacturer's instructions. [score:2]
Additionally, both NFκB and Wnt upstream signals have been proposed to regulate miR-224 in tumor cells, and may potentially participate in the described mechanisms in HCASMC. [score:2]
Next, we investigated the regulatory pattern of endogenous TCF21 and miR-224 gene expression levels in HCASMC. [score:2]
Herein we describe a post-transcriptional cis-regulatory mechanism by which the minor protective allele alters a perfect seed match of miR-224 in the 3′-UTR of TCF21. [score:2]
Thus, differential regulation of TCF21 3′UTR variants by miR-224 could result from altered kinetics of mRNA:miRNA complex formation. [score:2]
In order to test the specificity of the miRNA -mediated regulation of the C variant we restored base-pairing in the seed region by synthesizing a miR-224 guide strand with a G>C substitution (referred to as miR-224_SNP, Supplementary Fig. S1, bottom). [score:2]
In summary, these significant allelic structural differences implicate differences in miR-224 accessibility, binding kinetics, and binding affinity, which may impact miR-224 mediated regulation of TCF21. [score:2]
miR-224 dependent post-transcriptional regulation of TCF21 3′UTR at rs12190287. [score:2]
Allele-specific miR-224 regulation of TCF21 3′UTR at rs12190287. [score:2]
Sequence analysis predicts that rs12190287 alters the core miR-224 binding sequence, and folding algorithms that identify lowest energy conformations of the native and variant sequences suggest that the minor G allele at rs12190287 produces a less favorable configuration of mRNA folding for miR-224 binding. [score:1]
Figure S2(Top) Alignment of endogenous miR-224 with major and minor alleles of TCF21 3′-UTR demonstrating a seed match and seed mismatch, respectively. [score:1]
We monitored the annealing kinetics of miR-224 binding to the TCF21 3′-UTR C and G variants in vitro under experimental conditions that are assumed to mimic known cellular facilitators of RNA:RNA annealing [21]. [score:1]
1004263.g002 Figure 2Predicted interaction of miR-224 with TCF21 variant 1 3′-UTR and secondary structural changes at rs12190287. [score:1]
Single-stranded miRNA guide and passenger strands (miR-224 and miR-224_SNP, Fig. 2B; miR-224 guide: 5′-CAA GUC ACU AGU GGU UCC GUU-3′, miR-224_SNP guide: 5′-CAA CUC ACU AGU GGU UCC GUU-3′ and miR-224 passenger: 5′- AAA AUG GUG CCC UAG UGA CUA CA -3′) were synthesized by biomers. [score:1]
Both tools identified rs12190287 (position 1058 from 5′-UTR) residing within a 7-mer mammalian conserved binding site for mature miR-224 (Fig. 2A). [score:1]
Distinct in vitro annealing kinetics between miR-224 and TCF21 3′UTR variants. [score:1]
miR-224 binding site is highlighted in green and rs12190287 is shown in red. [score:1]
Alternatively, miRNA specific cDNA was prepared using the TaqMan miRNA Reverse Transcription kit (Applied Biosystems/Life Technologies, #4366596) and predesigned RT probes for human miR-224 or human control miRNA RNU44 (Applied Biosystems/Life Technologies). [score:1]
The day after plating the cells were transfected with either miR negative control (miR Con) or miR-224 mimic using Lipofectamine RNAiMAX (Life Technologies, #13778150) for 5 hrs. [score:1]
Predicted interaction of miR-224 with TCF21 variant 1 3′-UTR and secondary structural changes at rs12190287. [score:1]
However, the observation that miR-224_SNP did not completely block the allele-specific reporter activity in HeLa, may suggest cell type differences in endogenous miR-224 levels. [score:1]
We also localized endogenous miR-224 in these sections using in situ hybridization, which identified miR-224 in both the neointimal and adventitial layers, but not the medial layer (Fig. 7A, lower panel). [score:1]
Grey shaded bases highlight miR-224 seed region. [score:1]
1004263.g008 Figure 8Proposed mo del of signaling pathways converging on miR-224- TCF21 interaction at rs12190287. [score:1]
Proposed mo del of signaling pathways converging on miR-224- TCF21 interaction at rs12190287. [score:1]
The full-length TCF21 3′-UTR variants were generated by in vitro transcription (IVT) and incubated in 10-fold excess with [32]P-labeled miR-224 for various time points, followed by autoradiography detection. [score:1]
TGF-β stimulation of miR-224 expression has been characterized in ovarian granulosa cells where it has been implicated in cellular proliferation and estradiol release in this cell type [32]. [score:1]
In situ hybridizationUnlabeled miR-224 locked nucleic acid (LNA) and scrambled LNA control oligo probes were purchased from Exiqon and 100 pmol oligos were labeled using the digoxigenin (DIG) Oligonucleotide Tailing Kit, 2 [nd] generation (Roche, #3-353-583) according to the manufacturer's instructions. [score:1]
Predicted miR-224 binding and altered TCF21 3′-UTR secondary structure at rs12190287Recent studies using allelic imbalance sequencing demonstrate that SNPs frequently alter microRNA -mediated repression, by creating or disrupting complementary miRNA binding sites [12]. [score:1]
Negative control miRNA (miR Con), miR-224, miR-224_SNP, anti-miR negative control (anti-miR Con) or anti-miR-224 inhibitors were co -transfected with 3′-UTR reporters for 24 hrs and the relative luciferase activity (ratio of firefly/ Renilla luciferase activity) was measured and normalized to C-3′-UTR+miR Con or anti-miR Con, shown as fold change. [score:1]
Resulting double-stranded miR-224, miR-224_SNP or negative control miRNAs (Ambion/Life Technologies) were co -transfected at 50 nmol/L along with TCF21 C-3′-UTR or G-3′UTR reporter constructs in HeLa, HCASMC or A7r5 using Lipofectamine 2000 (Invitrogen/Life Technologies, #11668-019) according to the manufacturer's instructions. [score:1]
Alignment of rs12190287 major and minor alleles demonstrated a perfect seed match between the TCF21 3′-UTR containing the major risk allele (C) and miR-224 (nucleotides 2–8; positions 1042–1061), with ΔΔG = −2.43 and a seed mismatch between the minor protective allele (G) and miR-224 (ΔΔG = 4.67) (Fig. 2B). [score:1]
In contrast, the miR-224 binding sequence segment of the G variant is located in a local structure that does not seem to be accessible, i. e., the seed-matching element is located near a stem-loop junction within an intra-molecular duplex element (Fig. 2C). [score:1]
For gain-of-function studies, single-stranded, unmodified oligonucleotides for miR-224 (seed-matching TCF21 C allele) and miR-224_SNP (seed-matching TCF21 G allele) were first annealed at an equimolar concentration at 95°C for 3 min and allowed to gradually cool to room temperature. [score:1]
miRNA annealing [18] Single-stranded miRNA guide and passenger strands (miR-224 and miR-224_SNP, Fig. 2B; miR-224 guide: 5′-CAA GUC ACU AGU GGU UCC GUU-3′, miR-224_SNP guide: 5′-CAA CUC ACU AGU GGU UCC GUU-3′ and miR-224 passenger: 5′- AAA AUG GUG CCC UAG UGA CUA CA -3′) were synthesized by biomers. [score:1]
Predicted miR-224 binding and altered TCF21 3′-UTR secondary structure at rs12190287. [score:1]
The C variant TCF21 3′-UTR:miR-224 complexes also formed at a faster rate (k [obs] = 2.2×10 [6] M [−1] s [−1]) than the G variant (k [obs] = 1.4×10 [6] M [−1] s [−1]) as determined from second-order reactions (Fig. 4B and 4C). [score:1]
Unlabeled miR-224 locked nucleic acid (LNA) and scrambled LNA control oligo probes were purchased from Exiqon and 100 pmol oligos were labeled using the digoxigenin (DIG) Oligonucleotide Tailing Kit, 2 [nd] generation (Roche, #3-353-583) according to the manufacturer's instructions. [score:1]
These hypotheses were confirmed by kinetic studies showing decreased rate and extent of miR-224 binding, and RNA structural probing studies that revealed decreased availability of the miR-224 binding region in the mRNA containing the minor G allele. [score:1]
1004263.g004 Figure 4 In vitro annealing kinetics between miR-224 and TCF21 3′UTR variants. [score:1]
In vitro annealing kinetics between miR-224 and TCF21 3′UTR variants. [score:1]
TCF21 v1 and miR-224 levels were quantitated on a ViiA 7 Real-Time PCR system (Applied Biosystems) and normalized to 18S and RNU44 levels, respectively. [score:1]
For instance, the seed matching sequence of the C variant seems to be mostly located within a loop structure and overall, the segment complementary to miR-224 (shaded grey) are located in a structurally accessible local structure (Fig. 2C). [score:1]
For TaqMan based analysis, miRNA-specific cDNA was prepared as described above, and TaqMan qPCR was performed in triplicates using predesigned TaqMan probes for miR-224 and normalized to the RNU44 internal control. [score:1]
[1 to 20 of 86 sentences]
5
[+] score: 213
Previous research has identified many oncogenes or tumor suppressor genes as direct targets of miR-224, such as apoptosis inhibitor 5 (API5) [19], Homeobox D10 (HOXD10) [20], SMAD family member 4 (SMAD4) [33], SMAD family member 5 (SMAD5 [18], sarcolemma -associated protein (SLMAP) [18], Type 1 iodothyronine deiodinase (DIO1) [21], tumour protein D52 (TPD52) [17], tribbles homolog 1 (TRIB1) [25], chemokine (C-X-C motif) receptor 4 (CXCR4) [34], hypoxia-inducible factor 1 (HIF1A) [35], Raf kinase inhibitor protein (RKIP) [30], and cell division control protein 42 (CDC42) [36]. [score:10]
The expression level of miRNA-224 was downregulated in oral cancer [15], ovarian cancer [16], prostate cancer [17], malignant giant cell tumor [18], and glioblastoma [19]; while it was upregulated and functioned as an oncogene in hepatocellular carcinoma [20], clear cell renal cell carcinoma [21], pancreatic cancer [22], and cervical cancer [23]. [score:9]
The associations of miR-224 expression with various clinicopathological parameters of NSCLC tissues were summarized in Table  1. Using the median miR-224 expression in all 115 NSCLC patients as a cutoff, the patients were divided into high miR-224 expression group and low miR-224 expression group. [score:9]
Furthermore, miR-224 upregulation enhances radiation sensitivity of medulloblastoma cells [27], and a 13-gene miRNA signature including increased miR-224 levels would predict good response of lung cancer cells to EGFR inhibitor erlotinib treatment [28]. [score:6]
The miR-224 expression in four NSCLC cell lines was also clearly downregulated (Figure  1B). [score:6]
Forced expression of miR-224 suppressed prostate cancer cell proliferation, invasion and migration, and promoted cell apoptosis [17, 25]. [score:5]
Finally, in vitro functional assays demonstrated that upregulation of miR-224 expression in A549 cells was able to reduce cell proliferation, invasion, and migration, and promote cell apoptosis. [score:5]
Using the Kaplan–Meier method and logrank test, we found that the survival rate of patients with high miRNA-224 expression was higher than that of patients with low miRNA-224 expression (P <0.001; Figure  2). [score:5]
B miR-224 expression was down-regulated in NSCLC cell lines A549, H460, 95D, and H358, compared to normal human bronchial epithelial cell line 16HBE. [score:5]
Upregulation of miR-224 was found to reduce clonogenic potential of glioblastoma cells and enhance radiation sensitivity. [score:4]
Upraity et al. reported that miR-224 was downregulated in glioblastoma tumor tissues and cell lines [19]. [score:4]
MiR-224 expression levels were significantly down-regulated in NSCLC compared to the corresponding noncancerous lung tissues (P <0.001). [score:4]
Multivariate regression analysis corroborated that down-regulation of miR-224 was an independent unfavourable prognostic factor for patients with NSCLC. [score:4]
In addition, the upregulation of miR-224 was also shown in breast cancer [30], clear cell renal cell carcinoma [31], pancreatic ductal adenocarcinoma [22], and bladder cancer [32]. [score:4]
In conclusion, our results revealed that miRNA-224 was down-regulated in NSCLC cell lines and clinical samples. [score:4]
Down-regulation of miR-224 confers poor prognosis in patients with NSCLC. [score:4]
Figure 1 Expression of miR-224 in non–small cell lung cancer (NSCLC) tissues and cell lines. [score:3]
In contrast to the tumor-suppressive properties mentioned above, miR-224 also acts as an oncogene in some other cancers. [score:3]
In the present study, we examined miR-224 expression in NSCLC tissues and cell lines using real-time PCR. [score:3]
Aberrant expression of miR-224 in human malignancies has been demonstrated to play various roles in tumorigenesis. [score:3]
Restored miR-224 expression in A549 cells exhibited anti-tumor effects in vitro. [score:3]
In the current study, we firstly observed that miR-224 was down-regulated in NSCLC compared with adjacent noncancerous tissues. [score:3]
Overexpression of miR-224 in human hepatocellular carcinoma was associated with promoted cell migration and invasion and poorer patient survival [20, 29]. [score:3]
As in Figure  1A, the results showed that the expression levels of miR-224 were significantly lower in NSCLC specimens (mean ± SD: 8.1 ± 2.1) than those in the corresponding adjacent non-cancerous tissues (mean ± SD: 19.5 ± 3.9; P <0.001). [score:3]
Decreased miRNA-224 expression was associated with aggressive progression and poor prognosis. [score:3]
These findings demonstrate that miRNA-224 could not only be useful as a novel biomarker but also serve as a potential target for gene therapy of NSCLC. [score:3]
As shown in Figure  3D and E, up-regulation of miR-224 impeded cell invasion/migration compared with control. [score:3]
The A549 cell line, which possessed the lowest levels of miR-224 expression among all tested cell lines, was selected for further studies. [score:3]
So, miR-224 plays diverse functions in cancer pathogenesis and progression, and the role of miR-224 should be tumor specific and possibly dependent on its targets in different cancer types. [score:3]
Moreover, the Kaplan-Meier analysis revealed that NSCLC patients with low miR-224 expression tend to have shorter OS. [score:3]
Decreased expression of miR-224 in NSCLC tumor samples and cell lines. [score:3]
qRT-PCR was done to detect the expression of miR-224. [score:3]
The association of miR-224 expression with clinicopathological factors and prognosis was also statistically analyzed. [score:3]
Lower miR-224 expression showed significant correlation with poorer survival. [score:3]
No significant difference was observed between miR-224 expression and patients’ age, gender, smoking status, cell types, T stage, and tumor differentiation. [score:3]
In cervical cancer, miR-224 expression was significantly higher in the cancerous tissues of patients with poor differentiation, lymph node metastasis, vascular invasion, advanced FIGO stage, and shorter overall survival [23]. [score:3]
Lin et al. revealed that reduced expression of miR-224 in prostate cancer was associated with metastasis, high PSA level, high Gleason scores, and poor biochemical recurrence-free survival [25]. [score:3]
miR-224 expression and clinicopathologic features in NSCLC. [score:3]
Low miR-224 expression levels were significantly associated with poor outcome (P <0.001, log-rank test). [score:3]
also confirmed the inhibitory effect of miR-224 on A549 cell migration (Figure  3F). [score:3]
In addition, decreased miR-224 expression was significantly associated with lymph node metastasis (P = 0.002), advanced TNM stage (P <0.001), and shorter overall survival (P <0.001). [score:3]
Figure 2 Overall survival curves for two groups defined by low and high expression of miR-224 in patients with non–small cell lung cancer (NSCLC). [score:3]
Multivariate Cox regression analysis identified miR-224 expression level as an independent prognostic factor for OS of NSCLC patients. [score:3]
Then, decreased miR-224 expression was significantly correlated with aggressive clinicopathological features. [score:3]
Using real-time quantitative RT-PCR, we detected miR-224 expression in NSCLC cell lines and primary tumor tissues. [score:3]
The expression levels of miR-224 in primary NSCLC, corresponding adjacent normal lung tissues, human NSCLC cell lines A549, H460, 95D, and H358, and normal human bronchial epithelial cell line 16HBE were detected by qRT-PCR and normalized to U6 small nuclear RNA. [score:3]
These findings indicate that miR-224 may act not only as a novel diagnostic and prognostic marker, but also as a potential target for miR -based therapy of NSCLC. [score:3]
As shown in Table  1, miR-224 expression level was lower in samples with lymph node metastasis (P = 0.002) and advanced TNM stage (P <0.001). [score:3]
MiR-224 expression has also been found to correlate inversely with tumor stage and lymph node metastasis as well as survival times in colorectal cancer patients [26]. [score:2]
As shown in Figure  3A, the expression level of miR-224 in miR-224 mimics transfected cells was significantly higher compared with NC transfected cells (P <0.001). [score:2]
A MiR-224 expression was significantly lower in NSCLC tissues than in the corresponding non-cancerous tissues. [score:2]
Therefore, the potential regulatory circuitry afforded by miR-224 is enormous, and the accurate mechanisms on how miR-224 influences NSCLC progression need further clarification. [score:2]
MiR-224 has been shown its tumor-suppressor functions in several cancers. [score:2]
Thus, the aim of this study was to explore the effects of miR-224 in NSCLC tumorigenesis and development. [score:2]
When the cells transfected with miR-224 mimics or NC were grown to confluence, a scratch in the cell monolayer was made with a cell scratch spatula. [score:1]
was also performed to confirm the influence of miR-224 on NSCLC cell migration. [score:1]
At last, we assessed the biological role of miR-224 in A549 cells. [score:1]
The association of miR-224 levels with clinicopathologic features and prognosis was also analyzed. [score:1]
Notably, a previous study by Yanaihara et al. detected decreased miR-224 levels in human lung cancer tissues using miRNA microarray analysis [24]. [score:1]
Effects of miR-224 on the proliferation, apoptosis, invasion and migration of A549 cells. [score:1]
showed that cell proliferation was significantly impaired after miR-224 mimics transfection (Figure  3B). [score:1]
The transfection efficiency of miR-224 mimics was confirmed by real-time PCR analysis. [score:1]
For RNA transfection, the cells were seeded into each well of 24-well plate and incubated overnight, then transfected with either miR-224 mimics (GenePharma, Shanghai, China) or negative control (NC) RNA-oligonucleotides (GenePharma) using Lipofectamine 2000 (Invitrogen, California, USA) in accordance with the manufacturer’s procedure. [score:1]
To the authors’ knowledge, this is the first report regarding the clinical significance and functional attributes of miR-224 in NSCLC. [score:1]
MicroRNA-224 has been proven dysregulated in some human malignancies and correlated with tumor progression. [score:1]
One of the cancer-related miRNAs is miR-224. [score:1]
Furthermore, transfection of miR-224 mimics in NSCLC A549 cells was able to reduce cell proliferation, invasion, and migration, and promote cell apoptosis. [score:1]
Metastatic colorectal cancer cells (SW620) transfected with miR-224 mimics had reduced migration and motility in vitro and formed smaller tumors with fewer metastases in mice mo del. [score:1]
We also observed promoted cell apoptosis in miR-224 mimics transfected cells (Figure  3C). [score:1]
Figure 3 Effects of miR-224 mimics transfection on cell proliferation, apoptosis, invasion, and migration of A549 cells. [score:1]
We further evaluated whether miR-224 expression had prognostic potential for OS of NSCLC patients. [score:1]
[1 to 20 of 71 sentences]
6
[+] score: 187
Interestingly, in the case of combinational transfection with miR-224 and -452, expression of these target genes was further down-regulated (Figure 5B). [score:8]
In this study, to validate multiple-to-multiple relationships between miRNAs and targets in cancer cells, we demonstrated that two pairs of multiple miRNAs, miR-224 and -452, and miR-181c and -340, had multiple target genes and synergistically decreased cell proliferation through regulation of their targets in human GC cells. [score:8]
We also examined the expression levels of other five genes, MECP2, MYC, JUNB, MUC1 and SETDB1, which were not shown as targets for miR-224 or -452 by TargetScan. [score:7]
KATO-III cells with low-dose 5-aza-CdR treatment exhibited up-regulation of the miR-224/−452 cluster, whereas TSA alone did not cause up-regulation. [score:7]
It is likely that aberrant methylation decreases the expression of multiple tumor-suppressive miRNAs, such as miR-224, -452, -340 and -181c, which then induce over -expression of multiple oncogenic genes, like KRAS, DPYSL2, and MECP2. [score:7]
Expression of miR-224, let-7f and miR-516a is decreased in ovarian cancer, and they synergistically regulate expression of kallikrein-related peptidase 10 (KLK10) [18]. [score:6]
miR-224- and/or -340 -expression -negative GC cell lines exhibited hypermethylation signals on MSP analysis and the expression of miR-224 and -340 restored on demethylating agent treatment. [score:5]
Seventy-two hours after transfection, we observed that ectopic expression of miR-224 or -452 suppressed the growth of two cell lines, KATO-III and AGS (Figure 5A). [score:5]
We also analyzed the expression change of the miR-224/−452 cluster in KATO-III cells treated with a low dose of 5-aza-CdR (0.2 µmol/l), a histone deacetylase inhibitor, trichostatin A (TSA, 0.3 µmol/l), or a combination of these two drugs. [score:5]
GC cell lines without miR-224 expression exhibited only methylation signals, whereas expression -positive cell lines exhibited strong unmethylation patterns (Figure 2B). [score:5]
We examined the effect of knockdown of DPYSL2, which was shown to be a target of the miR-224/−452 cluster, on cell proliferation. [score:4]
DPYSL2 was Associated with GC Cell ProliferationWe examined the effect of knockdown of DPYSL2, which was shown to be a target of the miR-224/−452 cluster, on cell proliferation. [score:4]
miR-224 and -452 specifically down-regulated DPYSL2 and KRAS, but not other five genes examined, which are consistent with the results of database analysis (Figure 3). [score:4]
We found that the miR-224/−452 cluster was aberrantly down-regulated in GCs through hypermethylation. [score:4]
These data strongly indicate that aberrant DNA methylation is one of the key mechanisms underlying down-regulation of miR-224 and -340 in GC cells. [score:4]
These data suggest that miR-224 and -452 specifically down-regulated DPYSL2 and KRAS. [score:4]
The miR-224/−452 cluster was synergistically up-regulated in KATO-III cells with combined 5-aza-CdR and TSA treatment (Figure 1D). [score:4]
The miR-224/−452 Cluster Co-operatively Decreased Expression of DPYSL2 and KRAS To investigate whether or not the miR-224/−452 cluster is actually related to the regulation of DPYSL2 and KRAS, we analyzed the expression of DPYSL2 after transfection of KATO-III and AGS cells with the miR-224/−452 cluster alone or together. [score:4]
These results indicate that miR-224 and miR-452 may be down-regulated through DNA methylation in GC cell lines as the same transcription unit. [score:4]
DPYSL2 was shown to be down-regulated by miR-224 and -452. [score:4]
For instance, DPYSL2 (dihydropyrimidinase-like 2, also known as collapsing response mediator protein 2, CRMP2) is targeted by miR-224, -452, and -181c, KRAS by miR-224, -452, -181c, -340 and -152, and MECP2 (methyl CpG binding protein 2) by miR-181c and -340, respectively (Figure 3). [score:3]
As expected, no expressional changes of these five genes were found in KATO-III cells after transfection with miR-224 or -452 (Figure S2). [score:3]
The expression of miR-224, -340 and -152 was increased by 5-aza-CdR treatment in several GC cell lines (Figure 1B). [score:3]
In contrast, miR-224 is up-regulated in hepatocellular carcinomas [20] and medulloblastomas [21] compared with in the normal tissues. [score:3]
To examine the possibility of multiple-to-multiple relationships between miRNAs and targets in cancer cells, we focused on two combinations of miRNAs in GC cells, the miR-224/−452 cluster, and miR-181c and -340, in this study. [score:3]
Taken together, miR-224 plays an important role as a tumor-suppressive miRNA in GC as well as in several other cancers. [score:3]
Thus, there is a correlation between the methylation status of miR-224 and DPYSL2 expression in GC tissues. [score:3]
We quantitatively analyzed mature miR-224 expression in 9 GC cell lines and a colorectal cancer (CRC) cell line. [score:3]
Thus, the effects of miR-340 and -181c may be specific to their common target genes as well as miR-224 and -452. [score:3]
0062589.g007 Figure 7Methylation analysis of miR-224/−340 and expression of DPYSL2 in human gastric cancer tissues. [score:3]
We found that the two sets of miRNAs, miR-224 and -452, and miR-181c and -340, had multiple target genes, DPYSL2 and KRAS, and KRAS and MECP2, respectively, and synergistically decreased cell proliferation in human GC cell lines. [score:3]
Methylation analysis of miR-224/−340 and expression of DPYSL2 in human gastric cancer tissues. [score:3]
No expression of miR-224 was detected in 7 of 10 cancer cell lines (Figure 1C). [score:3]
miR-224 is down-regulated in methotrexate-resistant CRC cell lines compared with in sensitive cells [19]. [score:3]
Aberrant expression of miR-224 has also been reported in other tumors. [score:3]
Expression and Methylation Status of miR-224 and -340 in Primary GC Cases. [score:3]
The miR-224/−452 Cluster Co-operatively Decreased Expression of DPYSL2 and KRAS. [score:3]
In miR-224 methylation -positive cases, expression of miR-224 was significantly lower than in methylation -negative ones. [score:3]
Expression of miR-224, -452, -152 and -340 Decreased on DNA Hypermethylation in GC Cell Lines. [score:3]
A significant reduction of miR-224 expression in GC tissues was observed in methylation -positive cancer cases compared with in methylation -negative ones and non-cancerous gastric mucosae (Figure 7C). [score:2]
To investigate whether or not the miR-224/−452 cluster is actually related to the regulation of DPYSL2 and KRAS, we analyzed the expression of DPYSL2 after transfection of KATO-III and AGS cells with the miR-224/−452 cluster alone or together. [score:2]
The relative levels of miR-224 expression in gastric tissues were determined by real-time RT-PCR and then compared with the miR-224 methylation status in gastric tissues: N miR-224 Un (non-cancerous without miR-224 methylation; n = 20), Ca miR-224 Un (GC tissues without miR-224 methylation; n = 10), and Ca miR-224 Mt (GC tissues with miR-224 methylation; n = 15). [score:2]
The relative levels of DPYSL2 expression in gastric tissues were determined by real-time RT-PCR, normalized as to GAPDH, and then compared with the miR-224 methylation status in gastric tissues: N miR-224 Un (non-cancerous without miR-224 methylation, n = 6), Ca miR-224 Un (GC tissues without miR-224 methylation, n = 8), and Ca miR-224 Mt (GC tissue with miR-224 methylation, n = 7). [score:2]
Notably, combinational transfection of the miR-224 and -452 mimics extensively decreased the growth of the two GC cell lines (Figure 5A). [score:1]
Figure 2a also reveals that miR-452 is clustered with miR-224. [score:1]
According to the results of computational analysis, the miR-224/−452 cluster and miR-340 are located in intron 6 in GABRE and intron 2 in RNF130, respectively, both of which contain dense CpG islands only in the promoter regions of their host genes (Figure 2A and C). [score:1]
Next, we quantitatively examined the miR-224 levels in primary GC tissues and corresponding non-cancerous mucosae by TaqMan RT-PCR. [score:1]
Figure S2 Effects of transfection of miR-224 and -452 in KATO-III cells. [score:1]
Furthermore, hypermethylation of miR-224 and -340 was more frequently observed in primary GCs than corresponding noncancerous mucosae. [score:1]
Thus, further studies are required to clarify the role of miR-224 in carcinogenesis. [score:1]
We examined the methylation status of miR-224 and -340 in primary GC cases. [score:1]
Here we also revealed that the methylation status of miR-224 was correlated with the DPYSL2 level in human GCs. [score:1]
MSP analysis of miR-224/−340 in GC, CRC cell lines and normal stomach. [score:1]
Methylated patterns of miR-224 were detected in 15 of 26 (57.7%) primary GC tissues (Figure 7A and Table 1). [score:1]
Effects of combinational transfection of miR-224 and-452 in GC cell lines. [score:1]
The DPYSL2 mRNA level in the “Ca miR-224 Mt” group was significantly higher than those in the “N miR-224 Un” and “Ca miR-224 Un” groups, p = 0.049 and p = 0.035, respectively (Figure 7D). [score:1]
The DPYSL2 and KRAS mRNA levels were decreased after transfection with the miR-224 or miR-452 mimic (Figure 5B). [score:1]
RT-PCR analyses after transfection with miR-224 and/or -452. [score:1]
Representative results of miR-224 (A) and miR-340 (B) MSP analyses in primary GC tissues. [score:1]
Combinational Transfection of miR-224 and -452 Repressed GC Cell Proliferation. [score:1]
KATO-III and AGS cells were transfected with a Precursor Molecule mimicking miR-224, -452, -340 or -181c, or scrambled sequence miRNA (Sigma) to give a final concentration of 25-50 nmol/l by using an electroporator, Neon (Invitrogen), according to the manufacturer’s instructions. [score:1]
Paired non-cancerous gastric mucosae hardly exhibited a methylation pattern of miR-224. [score:1]
[1 to 20 of 62 sentences]
7
[+] score: 184
This idea is supported by results of luciferease experiments in which induced miR-383 expression resulted in only 25% reduction of luciferase activity in comparison with the effect of miR-224 which caused 45% downregulation of expression. [score:8]
Since altered expression of miR-224 and miR-383 was observed in tumors of tissues expressing type 1 iodothyronine deiodinase it suggests that these tumors may also present disturbed expression of DIO1. [score:7]
Binding of miR-224 to DIO1 3′UTR results in downregulation of endogenous DIO1 expression in renal cancer cells. [score:6]
The 3′UTR of DIO1 is a direct target for miR-224 and miR-383Computational analysis of DIO1 3′UTR with TargetScan5.1 revealed two putative binding sites for miR-224 and miR-383, located at nucleotides 1788–1794 and 898–904 of DIO1 transcript (NM_00792.5), respectively (Figure S2 in Supplemental Data). [score:6]
Transfection with miR-224 decreases expression of endogenous DIO1 To determine the functional effect of miR-224 and miR-383 on endogenous DIO1 mRNA, Caki-2 cells were transfected with pre-miR-224, pre-miR-383 (microRNA precursors), anti-miR-224, anti-miR-383 (microRNA inhibitors), or scrambled control. [score:5]
We observed differing expression of miR-224 and miR-383, whereas expression of the five other candidate miRNAs: miR-610, miR-637, miR-659, miR-1202 and miR-1266 did not differ significantly between ccRCC and control tissue (Figure S1, Supplemental Data). [score:5]
miR-224 was shown to increase apoptotic cell death and proliferation in hepatocellular carcinoma (54) while overexpression of miR-383 inhibited proliferation of testicular embryonic carcinoma cells (55). [score:5]
Indeed, in papillary thyroid cancers, expression of miR-224 was significantly elevated (39) while our studies revealed that in this cancer, expression of DIO1 is reduced (3). [score:5]
Caki-2 cells were seeded at 0.5×10 [5] cells per 12-well dish and transfected 24 hours later using Lipofectamine 2000 reagent (Invitrogen, USA) as described by the manufacturer with 37.5 pmoles of miRNA precursors: pre-miR-224 and pre-miR-383 (Pre-miR [™] miRNA Precursor Molecule, Ambion, USA), miRNAs inhibitors: anti-miR-224 and anti-miR-383 (Anti-miR™ miRNA Inhibitor Molecule, Ambion, USA) or control scrambled microRNA (Negative microRNA Control, Ambion, USA). [score:5]
Successful transfection was confirmed in SQ PCR analysis by a large induction of miR-224 and miR-383 after transfection with microRNA precursors and significant decrease of miRNAs expression when inhibitors were used (Figure 3). [score:5]
The expression is shown as percentage of control C. B. Mean fold T: C change of expression of miR-224 224 in samples divided according to tumor differentation grades (G1, G2, G3). [score:5]
These studies revealed statistically significant (p = 0.0002) over four fold increase in the expression of miR-224 and nearly two fold increase (p = 0.0236) in the expression of miR-383, in samples T compared to control samples C (Figure 1). [score:4]
To check whether miR-224 -mediated downregulation of DIO1 affects DIO1 activity product, T3, we analyzed the correlation between tumor-specific changes of miR-224 and T3 levels. [score:4]
0024541.g004 Figure 4The DIO1 3′UTR is the direct target for miR-224 and miR-383. [score:4]
The 3′UTR of DIO1 is a direct target for miR-224 and miR-383. [score:4]
In this study we have shown for the first time that type 1 iodothyronine deiodinase transcript is a direct functional target for microRNA miR-224. [score:4]
The DIO1 3′UTR is the direct target for miR-224 and miR-383. [score:4]
Site-directed mutagenesis of the miR-224 and miR-383 target sites: GTGACTT of miR-224 within nt 1788–1794 and TCTGATCT of miR-383 within nt 898–904 in the DIO1 3′UTR was performed using Quick change-mutagenesis kit (Stratagene, Germany). [score:4]
miR-224 regulates endogenous DIO1 expression in Caki-2 cell line. [score:4]
Indeed, as we demonstrate in the present study, the tumor-specific changes in intracellular T3 concentration correlate with changes of miR-224 expression. [score:3]
The second possibility is that the other factors (including miR-224) may exert stronger effect on DIO1 expression in ccRCC. [score:3]
Although these changes between the respective tumor differentiation grades are not statistically significant they may possibly suggest that as tumor progress the impact of miR-224 on DIO1 expression lowers and perhaps other posttranscriptional mechanisms are involved. [score:3]
In summary, we demonstrated that DIO1 3′UTR is targeted by two microRNAs: miR-224 and miR-383. [score:3]
Interestingly, among microRNAs differently expressed in control and tumor samples miR-224 has been repeatedly found by independent studies (30, 33, 50). [score:3]
E and F. Scatter plots of T3 concentration T: C ratio versus T: C miR-224 (E) and miR-383 (F) expression ratios. [score:3]
An interesting observation made in the present study is that the expression of miR-224 tends to change with tumor differentiation grades and is highest in G1 and lowest in G3 (Fig. 2). [score:3]
The luciferase activity in cells transfected with DIO1-3′UTR383mut was inhibited by 40% after pre-miR-224 addition, whereas transfection with DIO1-3′UTR224mut and pre-miR-383 resulted in ∼23% decrease in luciferase activity (Figure 4). [score:3]
As shown in Figure 2, statistically significant negative correlation was observed between miR-224 and DIO1 mRNA tumor-specific changes of expression (Spearman r [s] = −0.556 at p = 0.001). [score:3]
These data show that endogenous DIO1 mRNA expression in Caki-2 cells is modulated by miR-224. [score:3]
Moreover, tumor-specific changes in concentration of product of DIO1 activity, T3, correlate negatively with changes of miR-224 expression. [score:3]
Thus, disturbed expression of miR-224 and miR-383 in ccRCC was confirmed by two different analytical approaches. [score:3]
Expression of miR-224, miR-383, miR-610, miR-637, miR-659, miR-1202 and miR-1266 was analyzed in 32 matched pairs of tumor (T) and control (C) samples. [score:3]
C and D. Scatter plots of the T: C ratios of DIO1 mRNA versus T: C miR-224 (C) and T: C miR-383 (D) expression ratios. [score:3]
We identified 7 potential miRNAs targeting the 3′UTR of human DIO1 (Table 1): miR-224, miR-383, miR-610, miR-659, miR-637, miR-1202 and miR-1266. [score:3]
The luciferase activity of the reporter constructs: DIO1-3′UTR224mut and DIO1-3′UTR383mut, in which target sites recognised by the microRNA were mutated, was unaffected by transfection with pre-miR-224 or pre-miR-383, respectively (Figure 4). [score:3]
miR-224 expression negatively correlates with DIO1 mRNA and T3 in ccRCC. [score:3]
To determine the functional effect of miR-224 and miR-383 on endogenous DIO1 mRNA, Caki-2 cells were transfected with pre-miR-224, pre-miR-383 (microRNA precursors), anti-miR-224, anti-miR-383 (microRNA inhibitors), or scrambled control. [score:3]
Transfection with miR-224 decreases expression of endogenous DIO1. [score:3]
Expression of miR-224 (A and B) and miR-383 (C and D) in ccRCC. [score:3]
miR-224 and miR-383 are overexpressed in ccRCC. [score:3]
of DIO1 3′UTR with TargetScan5.1 revealed two putative binding sites for miR-224 and miR-383, located at nucleotides 1788–1794 and 898–904 of DIO1 transcript (NM_00792.5), respectively (Figure S2 in Supplemental Data). [score:3]
Transfection of Caki-2 cells with anti-miR-224 resulted in increase of DIO1 expression, by 45%, p<0.01, when compared with scrambled control. [score:2]
0024541.g001 Figure 1 A. Increased miR-224 expression in ccRCC tumor samples (T) compared with control samples (C). [score:2]
Induced expression of miR-224 and miR-383 in ccRCC was confirmed in a specific TaqMan microRNA assay. [score:2]
A. Increased miR-224 expression in ccRCC tumor samples (T) compared with control samples (C). [score:2]
To study the direct interaction between the miR-224, miR-383 and DIO1 transcript we cloned the 3′UTR of DIO1 downstream of the luciferase reporter gene in the pGL3-control vector – (DIO1-3′UTR). [score:2]
The question whether miR-224 and miR-383 are involved in ccRCC proliferation awaits future studies. [score:1]
Whether impaired expression of DIO1 truly results from altered miR-224 and miR-383 levels in these cancers needs to be evaluated by separate studies. [score:1]
This has been supported by the negative correlation between tumor-specific changes in miR-224 and DIO1 mRNA levels and loss of DIO1 protein in ccRCC samples. [score:1]
Cells were cotransfected with obtained constructs and precursors of microRNAs: pre-miR-224, pre-miR-383 or control (scrambled miRNA). [score:1]
Binding sites of miR-383 and miR-224 are indicated and their positions (miR-383: nt 898-904, miR-224: nt 1788–1794) are given according to DIO1 mRNA sequence (NM_00792.5). [score:1]
Mean fold change of miR-224 and miR-383 was analyzed in different tumor gradings but did not depend on the differentiation grade of tumor sample. [score:1]
Taken together, these data show that the 3′UTR of DIO1 contains specific binding sites for microRNAs miR-224 and miR-383. [score:1]
However, mean fold change of miR-224 tended to decrease when differentiation grades increased from G1 to G3 (Figure 1). [score:1]
miR-224 mediates loss of DIO1 in renal cancer, what results in decreased intratumoral T3 concentration. [score:1]
Both microRNAs, miR-224 and miR-383 are believed to be implicated in control of proliferation or apoptosis. [score:1]
We found a statistically significant (Pearson r = −0.624, p = 0.04) negative correlation between T: C ratios of miR-224 and intratumoral T3 (Fig. 2). [score:1]
B and C. The level of miR-224 (B) and miR-383 (C) in cells transfected with pre-miRs or anti-miRs. [score:1]
This suggests the possible use of miR-224 as a marker differentiating ccRCC tumors from healthy tissues. [score:1]
miR-224 negatively correlates with DIO1 and T3 levels in ccRCC. [score:1]
[1 to 20 of 60 sentences]
8
[+] score: 178
Other miRNAs from this paper: hsa-mir-21, hsa-mir-205, hsa-mir-143, hsa-mir-145, hsa-mir-424
The median expression level of miR-224 (5.4) was used as a cutoff point to divide all 126 patients into two groups: cervical cancer patients who express miR-224 at levels less than the cutoff value were assigned to the low expression group (mean expression value 4.6, n = 60), and those with expression above the cutoff value were assigned to the high expression group (mean expression value 6.1, n = 66). [score:15]
Observations mentioned above of upregulation or downregulation of miR-224 in different tumor types suggest that miR-224 may have different functions in cancer development depending on the cell type involved. [score:8]
In breast cancer cell lines, Huang et al. [31] found that the overexpression of miR-224 which plays an important role in metastasis of cancer cells to the bone by directly suppressing the RKIP tumor suppressor. [score:8]
Figure 2 Kaplan-Meier curves for survival time in patients with cervical cancers divided according to miR-224 expression: significantly shorter survival times for patients with high miR-224 expression than for those with low miR-224 expression (P < 0.001). [score:7]
Exogenous expression of miR-224 was found to inhibit proliferation, increase radiation sensitivity and reduce anchorage-independent growth of medulloblastoma cells [30]. [score:5]
As shown in Figure  2, cervical cancer patients with high miR-224 expression tend to have shorter overall survival than those with low miR-224 expression (log-rank test: P < 0.001). [score:5]
As shown in Figure  1, after normalization to RNU6B expression levels, the expression level of miR-224 in cervical cancer tissues (mean ± SD: 5.4 ± 0.9) was significantly higher than that in adjacent normal tissues (mean ± SD: 3.2 ± 0.9, P < 0.001). [score:5]
miR-224 expression was significantly upregulated in cervical cancer tissues when compared with corresponding adjacent normal tissues (P < 0.001). [score:5]
In addition, miR-224 expression was also proved to be associated with histological grade, FIGO stage, HPV status, lymph node metastasis, and vascular invasion for high miR-224 expression was more frequently detected in cervical cancer with poor differentiation, advanced FIGO stage, positive HPV infection, lymph node metastasis, and vascular invasion, which strongly suggested that miR-224 was involved in the invasion and metastasis of cervical cancer. [score:5]
In cervical cancer tissues, miR-224 was found to be one of the upregulated miRNAs (2.7221-fold higher than in adjacent normal cervical tissues). [score:4]
For example, miR-224 is one of the most commonly up-regulated miRNAs in hepatocellular carcinoma [28]. [score:4]
In contrast, a downregulation of miR-224 has been observed in ovarian cancer [36], prostate cancer [37] and oral carcinoma [38]. [score:4]
In addition to these, the upregulation of miR-224 was also shown in aggressive pancreatic ductal adenocarcinoma [32], clear cell renal cell carcinoma [33], thyroid cancer [34] and bladder cancer [35]. [score:4]
In conclusion, our data indicated that miR-224 upregulation was associated with aggressive progression and poor prognosis in cervical cancer. [score:4]
Our data indicated that miR-224 upregulation was associated with aggressive progression and poor prognosis in cervical cancer. [score:4]
The previous microarray detection also shown that miR-224 was one of miRNAs with significant upregulation in cervical cancer tissues relative to adjacent normal tissues. [score:4]
In support of this, Kaplan-Meier analysis of overall survival showed that patients with tumors of high miR-224 expression tend to have a significantly shorter overall survival compared with patients whose tumors do not, indicating that high miR-224 expression is a marker of poor prognosis for patients with cervical cancer. [score:4]
Up-regulated miR-224 was also identified in a subtype of medulloblastomas. [score:4]
More importantly, we proved that miR-224 expression was significantly associated with overall survival of patients with cervical cancer. [score:3]
Overexpression of miR-224 in liver cells was reported to increase cell proliferation and apoptosis as well as cell migration and invasion [29]. [score:3]
Multivariate analysis using the Cox proportional hazards mo del for all variables that were significant in the univariate analysis showed that FIGO stage (P = 0.01), the status of lymph node metastasis (P = 0.02) and vascular invasion (P = 0.04), and miR-224 expression (P = 0.009) were independent prognostic factors for patients with cervical cancer (Table  2). [score:3]
miR-224 expression was significantly higher in the cancerous tissues of patients with advanced FIGO stage cervical cancer than those with early FIGO stage (P = 0.02, Table  1). [score:3]
MiR-224 upregulation in human cervical cancer. [score:3]
Moreover, we found that lesser differentiated tumors expressed higher miR-224 (P = 0.03). [score:3]
was performed to detect the expression levels of miR-224 in human cervical cancer and matched adjacent normal tissues. [score:3]
Accumulating evidences for differential expression of miR-224 in various types of human cancer suggest that it may be play a crucial role in tumor biology. [score:3]
of cases miR-224 expression  P     High (n, %) Low (n, %)   Age    <506030 (50.0)30 (50.0)NS≥506636 (54.5)30 (45.5) Tumor size (cm)    <4.05830 (51.7)28 (48.3)NS≥4.06836 (52.9)32 (47.1) Histological grades    Well differentiated284 (14.3)24 (85.7)0.03Moderately differentiated3212 (37.5)20 (62.5)Poorly differentiated6650 (75.8)16 (24.2) FIGO stage    Ib~IIa6420 (31.3)44 (68.7)0.02IIb~IIIa6246 (74.2)16 (25.8) Lymph node metastasis    No7924 (30.4)55 (69.6)0.008Yes4742 (89.4)5 (10.6) Vascular invasion    No7220 (27.8)52 (72.2)0.01Yes5446 (85.2)8 (14. [score:3]
The clinicopathologic features of all the patients were summarized in Table  1. Table 1 Association between miR-224 expression and different clinicopathological features of human cervical cancers Clinicopathological features No. [score:3]
MiR-224 upregulation associates with poor prognosis in patients with human cervical cancer. [score:3]
The clinicopathologic features of all the patients were summarized in Table  1. Table 1 Association between miR-224 expression and different clinicopathological features of human cervical cancers Clinicopathological features No. [score:3]
Moreover, we found that lesser differentiated tumors expressed higher miR-224 (P = 0.03, Table  1). [score:3]
In addition, miR-224 was expressed at significantly higher levels in lymph node metastasis -positive patients than in lymph node metastasis -negative patients (P = 0.008). [score:3]
Accumulating evidence for differential expression of microRNA-224 (miR-224) in various types of human cancer suggests that it may be play a crucial role in tumor biology. [score:3]
Univariate analysis demonstrated that FIGO stage (P < 0.001), the status of lymph node metastasis (P = 0.006) and vascular invasion (P = 0.01), and miR-224 expression (P < 0.001) were significantly associated with overall survival of cervical cancer patients (Table  2). [score:3]
In addition, miR-224 was expressed at significantly higher levels in lymph node metastasis -positive patients than in lymph node metastasis -negative patients (P = 0.008, Table  1). [score:3]
Previous study has shown miR-224 to have increased expression in cervical cancer [16]. [score:3]
MiR-224 upregulation associates with aggressive clinicopatholigcal parameters of human cervical cancer. [score:3]
After normalization to RNU6B, the expression level of miR-224 in cervical cancer tissues (mean ± SD: 9.8 ± 0.9) was significantly higher than that in adjacent normal tissues [mean ± SD: 3.2 ± 0.9, ratio (cervical cancer/normal controls) =3.1, P < 0.001]. [score:3]
Table  1 summarized the association between miR-224 expression and clinicopathological parameters in cervical cancers. [score:3]
More importantly, Kaplan-Meier analysis showed that cervical cancer patients with high miR-224 expression tend to have shorter overall survival. [score:3]
MiR-224 expression was detected in 126 pairs of human cervical cancer and adjacent normal tissues by real-time quantitative RT-PCR. [score:2]
Our data proved that miR-224 expression was significantly higher in cervical cancer compared with that in adjacent normal tissues. [score:2]
miR-224 is a family of miRNA precursors found in mammals, including humans. [score:1]
In multivariate analysis stratified for known prognostic variables, miR-224 was identified as an independent prognostic marker. [score:1]
The aim of this study was to investigate the clinical significance of miR-224 expression in cervical cancer. [score:1]
The association between miR-224 expression and survival of cervical cancer patients was investigated by Kaplan–Meier analysis and log-rank test. [score:1]
The sequence of miR-224 maps to chromosome X [27]. [score:1]
Cox proportional hazards mo del adjusted for known prognostic variables such as histological grade, FIGO stage, HPV status, lymph node metastasis, and vascular invasion proved that miR-224 was an independent prognostic marker for cervical cancer. [score:1]
However, little is known about the function of miR-224 in human cervical cancer. [score:1]
Thus, miR-224 could be used as a molecular prognostic marker additive to the known prognostic indicator, in order to identify patients who are more likely to have higher risk of death, thus, should receive more aggressive treatment. [score:1]
Figure 1 MiR-224 expression in 126 pairs of cervical cancer and adjacent normal tissues were respectively detected by real-time quantitative RT-PCR assay. [score:1]
[1 to 20 of 51 sentences]
9
[+] score: 88
Taken together with our later observations that targeting of the liver-specific miR-122-5p or poorly abundant miR-195-5p, miR-25-3p, miR-200a/b/c-3p, miR182-5p and the mutant miR-224-5p mut2 by 2′OMe AMOs (but not their LNA/DNA AMO counterparts) also resulted in significant inhibition of immunostimulatory ssRNA sensing, our work establishes sequence -dependent and miRNA-independent off-target inhibitory activity of 2′OMe AMOs on the immune sensing of pathogenic RNA by human and mouse phagocytes. [score:9]
Mutation or deletion of part of this motif resulted in the loss of inhibitory activity for miR-200a-3p, miR-122-5p and NC1 2′OMe AMO variants, while introduction of this motif to the poorly inhibitory miR-224-5p AMO significantly increased the inhibitory activity of the AMO on TLR7. [score:8]
The above results led us to assess whether base changes to the poorly inhibitory miR-224-5p 2′OMe AMO, introducing the consensus inhibitory motif, could increase its inhibitory activity on TLR7. [score:7]
We also observed significant inhibition of immunostimulatory ssRNA sensing by select LNA/DNA phosphorothioate AMOs from Classes 3 and 4. Although miRNA -based mechanisms could be at play for LNA/DNA AMOs targeting abundant miRNAs (such as miR-191-5p, miR-16-5p, miR-29a-3p or miR-100-5p), such effects can be ruled out for other AMOs of Class 3 targeting poorly abundant miR-224-5p, miR-331-3p, miR-134-5p or miR-31-5p. [score:7]
The inhibitory effect was dose dependent, with a maximum IC [50] around 2 nM for miR-195-5p 2′OMe AMO (Supplementary Figure S1), while other 2′OMe AMOs (for example, miR-224-5p, not shown) showed only minor inhibitory activity when used at concentrations as high as 80 nM. [score:5]
Next, dose-response studies comparing the activity of highly inhibitory AMOs (miR-182-5p 2′OMe and miR-331-3p LNA/DNA) and that of poorly inhibitory AMOs (miR-224-5p 2′OMe and miR-195-5p LNA/DNA) on both TLR7 and TLR8 sensing were conducted in human PBMCs (Figure 3C and D). [score:5]
In line with an essential role for the motif in the inhibitory activity of 2′OMe AMOs, the miR-224-5p mut2 2′OMe AMO was significantly more inhibitory than the native sequence on the sensing of two different immunostimulatory ssRNAs (B-406AS-1 and β-Gal-656-REV) in mouse primary BMMs (Figure 5B). [score:5]
miR-224-5p 2′OMe AMO was selected for its low inhibitory activity, while its LNA/DNA variant significantly inhibited TLR7 in mouse BMMs (Figure 2). [score:5]
The miR-182-5p 2′OMe AMO had a strong inhibitory effect on both TNF-α and IFN-α, and was significantly more inhibitory than the miR-224-5p 2′OMe AMO in a dose -dependent manner (Figure 3C). [score:5]
To directly implicate TLR7 in sequence -dependent activity of 2′OMe AMOs, we further demonstrated that NF-κB activation was impaired by an inhibitory variant of miR-224-5p 2′OMe AMO, in HEK293 TLR7 cells stimulated with the TLR7/8 chemical agonist R848. [score:4]
Arrows point to mutations introduced in miR-224–5p AMOs to create the inhibitory motif in miR-224–5p mut2. [score:4]
However, even at 200–400 nM, miR-224-5p mut2 had a stronger inhibitory effect on TLR7 than the native miR-224-5p AMO (Figure 5 and not shown), underlining detectable sequence -dependent effects between AMOs used at high doses. [score:3]
To confirm the specific activity of the miR-224-5p mut2 2′OMe AMO variant on TLR7, the impact of these AMOs was studied in HEK293 cells stably expressing TLR7 or TLR9, and a reporter of downstream NF-κB activity. [score:3]
Given a previous report that the inhibitory activity of LNA/DNA AMOs could be related to the phosphorothioate (PS) backbone of these molecules (30), we studied a variant of miR-224-5p 2′OMe synthesized with a PS backbone (miR-224-5p 2′OMe PS) in human PBMCs. [score:3]
As shown in Figure 5, miR-224-5p mut2 AMO is more stable than the native miR-224-5p and miR-224-5p mut1 AMOs, and displayed the strongest TLR7 inhibitory activity. [score:3]
Importantly, we also observed inhibitory activity with the native miR-224-5p 2′OMe in HEK293 TLR7 cells, with doses ≥200 nM. [score:3]
Transfection of the miR-224-5p mut2 but not the mut1 2′OMe AMO resulted in a significantly increased inhibition of NF-κB activation by the chemical TLR7/8 agonist R848 in HEK293 TLR7 cells, but not with polyI:C treatment, compared to the native miR-224-5p 2′OMe AMO (Figure 5D). [score:2]
The inhibitory effect of miR-224-5p mut2 was also seen on TLR8 in human PBMCs, with reduced TNF-α levels compared to the native 2′OMe AMO (Figure 5C). [score:2]
miR-224-5p 2′OMe PS increased inhibition of TNF-α production compared to the parent phosphodiester molecule (miR-224-5p 2′OMe), similar to that of the miR-224-5p LNA/DNA variant (also synthesized with a PS backbone), in human PBMCs (Supplementary Figure S2A). [score:2]
Ordinary one-way (A and B) or two-way (C and D) ANOVA with Dunnett's multiple comparison tests to the RD+B-406AS-1 (A and B), the miR-224-5p+B-406AS-1 (C) or the miR-195-5p+B-406AS-1 (D) conditions are shown. [score:1]
Two variants of the miR-224-5p 2′OMe AMO were synthesized, with one or two base changes restoring the most highly conserved residues of the motif otherwise lacking in miR-224-5p (Figure 5A). [score:1]
In addition, transfection of the miR-224-5p mut2 2′OMe AMO had no impact on TLR9 stimulation by ODN 2006. [score:1]
[1 to 20 of 22 sentences]
10
[+] score: 39
Besides the most commonly used DNMT inhibitors and HDAC inhibitors, C646 is a novel HAT inhibitor that is able to inhibit histone acetyltransferase EP300 and suppress the upregulated miR-224 [36]. [score:14]
Considering that miR-224 overexpression could not be totally attenuated by inhibition of histone acetylation, other factors might also contribute to miR-224 upregulation. [score:8]
The miR-224 is the most significantly upregulated miRNA in HCC and was found to target apoptosis inhibitor-5 (API-5) to promote tumorigenesis [35]. [score:8]
However, the regulatory mechanism of miR-224 in liver disease is mostly obscure. [score:4]
Actually, miR-224 overexpression can be attributed to histone acetylation rather than genomic amplification or DNA hypomethylation. [score:3]
Most of the miRNAs deregulated by aberrant patterns of histone modification in cancer cells are silenced, but some miRNAs, such as miR-224, miR-615 and miR-155, are activated by histone modification. [score:2]
[1 to 20 of 6 sentences]
11
[+] score: 29
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224-specific target. [score:10]
Inverse relationship with its downstream target Stathmin 1. Microtubules stabilization (G1-M transition)Gramantieri et al., 2007, 2008; Jiang et al., 2008; Wong et al., 2008; Liu et al., 2009; Xu et al., 2011; Karakatsanis et al., 2013 miR-224 Promotes proliferation and inhibits apoptosis inhibitor-5 (API-5) transcript expressionMurakami et al., 2006; Meng et al., 2007; Gramantieri et al., 2008; Ladeiro et al., 2008; Li et al., 2008; Wang et al., 2008; Chen, 2009; Huang et al., 2009; Liu et al., 2009; Su et al., 2009; Pineau et al., 2010; Wong et al., 2010 miR-296-5p It is still unknown if contribute to HCC development and tumor progressionBorel et al., 2012b; Katayama et al., 2012; Vaira et al., 2012; Wei et al., 2013b miR-338/-3p Associated with clinical HCC aggressiveness. [score:10]
A significantly high expression of miR-224 in HCC patients promotes proliferation and inhibits apoptosis inhibitor-5 (API-5) transcript expression (Wang et al., 2008). [score:9]
[1 to 20 of 3 sentences]
12
[+] score: 27
Upregulation of miR-455-3p and miR-33a was found to be associated with chemosensitivity while upregulation of miR-224, miR-1236, and miR-520d-3p was associated with chemoresistance [21]. [score:7]
Interestingly, among the 736 miRNAs analyzed in the first study, upregulation of miR-455-3p and miR-33a was associated with chemosensitivity while upregulation of miR-224, miR-1236, and miR-520d-3p was associated with chemoresistance [21]. [score:7]
On the other hand, high expression of miR-224, miR-1236, and miR-520d-3p and low expression of miR-455-3p and miR-33a were found to be individually associated with unfavorable outcome and a score based on this five-miRNAs was proposed to predict the clinical outcome of DLBCL patients treated with R-CHOP regimen, independent from the IPI score [21]. [score:5]
In addition, a predictor score based on a signature of five miRNAs, among which high expression of miR-224, miR-1236, and miR-520d-3p and low expression of miR-455-3p and miR-33a were individually associated with unfavorable outcome, has been proposed to predict the clinical outcome of DLBCL patients, independent from the IPI score [21]. [score:5]
Five miRNAs were differentially expressed between both groups (miR-224, miR-1236, miR-520d-3p, miR-33a, and miR-455-3p) and were validated in an independent group of 133 patients. [score:3]
[1 to 20 of 5 sentences]
13
[+] score: 25
MiR-21 expression was statistically different between stage I and II HCC tumors, while miR-224 expression was not statistically different between different HCC tumor stages (Additional file 1: Figure S1). [score:5]
In addition, miR-224 was found to be 6.4-fold up-regulated in HCC relative to controls (Fig.   2c). [score:4]
Quantitative real-time RT-PCR was performed to determine the expression levels of miR-9, miR-21 and miR-224 in 24 human HCC (stage I n = 5; stage II n = 9; stage III n = 6; stage IV n = 4) and 11 liver control tissues. [score:3]
MiR-9, miR-21 and miR-224 were the top inducers of HCC invasiveness and also their expression was increased in HCC relative to control liver tissues. [score:3]
Next, we have examined if there is any correlation between miR-9, miR-21 and miR-224 expression levels and HCC tumor stage. [score:3]
Relative (A) miR-21 and (B) miR-224 expression levels in HCC tumors in different stages (I,II,III,IV) assessed by real-time RT-PCR analysis and normalized to control liver tissues. [score:3]
a MiR-9, (b) miR-21 and (c) miR-224 expression levels in 24 HCC tumors and 11 control liver tissues assessed by real-time RT-PCR analysis. [score:3]
The screen above revealed that the top three microRNAs as statistically significant inducers of liver cancer cell invasiveness were miR-9, miR-224 and miR-21. [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 23
Caspase 3 (CASP3) and caspase 7 (CASP7) are targets of miR-224 in NSCLC, and miR-224 partly promotes lung cancer cells proliferation and migration by directly targeting CASP7 and downregulating its expression; miR-224 attenuates TNF-α induced apoptosis by directly targeting CASP3, which results in a reduced cleaved parp1 expression in lung cancer cells and suggests a oncogenic role for miR-224 in lung cancer pathogenesis [47]. [score:16]
Regarding the analyzed miRNAs, the overexpression of miR-182, miR-31, miR135b, miR-199b, miR-224 and miR-196b and miR-34a have been detected in both the training and validation set. [score:3]
MiR-224 functions as an oncogene in NSCLC by directly targeting TNFAIP1 and SMAD4. [score:3]
Regarding miR-224, some studies in the same type [44] and different types of cancer support our results [45, 46]. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 22
Furthermore, miR-224 inhibits the tumor suppressor Raf kinase inhibitor protein (RKIP) gene expression, which protects against metastasis and genomic instability. [score:9]
For example, it was found that miR-224 expression is considerably upregulated in breast cancer cell lines, and is particularly invasive in MDA-MB-231 breast cancer cells [121]. [score:6]
Metastasis is also induced by ectopic expression of miR-224 and reduced by its downregulation. [score:6]
These findings show that miR-224 may function as an oncogenic miRNA. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 21
miR-224 also up-regulates cyclin-D1 and down-regulates cyclin -dependent kinase inhibitorsp27Kip1 and p21Cip1. [score:9]
Alone or in combination with SMAD4, miR-224 could be an independent prognostic marker for the survival of CRC patients [62, 63 MVc contains miR-155, an oncogenic microRNA that is significantly up-regulated by coculture with LC-MSCs and by S100A4 ectopic overexpression [39] (Table 1). [score:6]
Therefore, miR-224 promotes CRC tumor growth and metastasis viatargeting SMAD4. [score:3]
miR-224 accelerates the G [1]/S-phase transition through the activation of the protein kinase B/ Forkhead box O3 transcription factor (Akt/FOXO3a) signaled by targeting antagonists of Phosphatidylinositol-3-Kinase (PI3K)/Akt such as the proteinphosphatases PHLPP1 and PHLPP2. [score:3]
[1 to 20 of 4 sentences]
17
[+] score: 21
The forci formation was indicated; (C) MTT analysis of the IC [50] values of DDP in miR-224 inhibitor- or inhibitor NC -transfected 7901/DDP and parental 7901 cells; (D) Flow cytometric analysis of cell cycle in inhibitor NC- or miR-224 inhibitor -transfected 7901/DDP cells combined with DDP (0.0 and 4.0 ug/ml); (E) Flow cytometric analysis of apoptosis in miR-224 inhibitor- or inhibitor NC -transfected 7901/DDP combined with DDP (0.0 and 4.0 ug/ml); Data are expressed as the mean ± S. D. of three individual experiments. [score:15]
A FBXW7 3’UTR fragment containing wild-type or mutant miR-223 -binding sequence was cloned downstream of the luciferase reporter gene in pGL3-luc vector; (B) Relative luciferase activity was analyzed after wild-type or mutant 3’UTR reporter plasmids were co -transfected with miR-224 mimic or inhibitor in 7901 cells. [score:3]
The forci formation was indicated; (C) MTT analysis of the IC [50] values of DDP in 7901/miR-224 or 7901/NC cells; (D) Flow cytometric analysis of cell cycle in 7901/miR-223 or 7901/NC cells combined with DDP (0 and 2.0 ug/ml); (E) Flow cytometric analysis of apoptosis in 7901/miR-223 or 7901/NC cells combined with DDP (0 and 2.0 ug/ml); Data are expressed as the mean ± S. D. of three individual experiments. [score:3]
[1 to 20 of 3 sentences]
18
[+] score: 20
Amongst the most significantly down-regulated miRNAs with high read counts were miR-224-5p, miR-410, miR-409-3p and-5p, whilst the most up-regulated miRNAs were miR-3614-5p, miR-708-3p and-5p. [score:7]
Amongst the most dysregulated miRNAs that were expressed in relatively high amounts (threshold of mean miR count > 10), miR-224-5p (-11 log [2] FC), miR-452-5p and miR-887 (both -9 log [2] FC), were significantly down-regulated, whereas the greatest relative induction was seen for miR-708-5p/3p and 3614-5p (all ~2 log [2] FC) (Fig 2C). [score:7]
At 5 days post infection (5dpi), we found that 2 of these 4 miRNAs (miR-224-5p and miR-409-3p) were similarly down-regulated (n = 3) (Fig 3B). [score:4]
For miRNA expression, stem-loop qPCR was performed using TaqMan Universal master mix (Applied Biosystems) and the following microRNA assays: 000512 for miR-210-3p, 001274 for miR-410-3p, 002099 for miR-224-5p, 002331 for miR-409-5p, 002332 for miR-409-3p, 002341 for miR-708-5p, 002342 for miR-708-3p and 461775 for miR-3614-5p. [score:2]
[1 to 20 of 4 sentences]
19
[+] score: 19
Wang Y. Lee A. T. Ma J. Z. Wang J. Ren J. Yang Y. Tantoso E. Li K. B. Ooi L. L. Tan P. Lee C. G. Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224-specific target J. Biol. [score:10]
It was reported that miR-224 is significantly induced in HCC where it suppresses the activity of apoptosis inhibitor 5 [44]. [score:5]
However, we did not detect any up-regulation of miR-224. [score:4]
[1 to 20 of 3 sentences]
20
[+] score: 18
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-31
In HT29 cells with acquired resistance to methotrexate (a folate- and metabolism -targeting agent) chemotherapy, miR-224 was downregulated, resulting in upregulation of SLC4A4. [score:9]
Interestingly, in a study in HT29 human CRC cells, expression of SLC4A4 was shown to be negatively regulated by miR-224 (Mencia et al., 2011). [score:4]
Underexpression of miR-224 in methotrexate resistant human colon cancer cells. [score:3]
Notably, siRNA -mediated knockdown of SLC4A4 resulted in increased sensitivity to methotrexate treatment, and this was reversed upon anti-miR-224 transfection (Mencia et al., 2011). [score:2]
[1 to 20 of 4 sentences]
21
[+] score: 18
Finally, we find miR-224, associated with a human chromosome fragile site on Chr-Xq28 [18], is up-regulated in ccRCC and predicted to target ERBB4, a member of the EGFR family, a potential tumor suppressor known to be strongly down-regulated in ccRCC [78]. [score:11]
For instance, loss of miR-149, miR-200c and mir-141 causes gain of function of oncogenes (KCNMA1, LOX), VEGFA and SEMA6A respectively and increased levels of miR-142-3p, miR-185, mir-34a, miR-224, miR-21 cause loss of function of tumor suppressors LRRC2, PTPN13, SFRP1, ERBB4, and (SLC12A1, TCF21) respectively. [score:3]
As the p-values in Figure 4 indicate, we validate a strong anti-correlation signature between mRNA levels of (KCNMA1, LOX), VEGF, SEMA6A, (LRRC2, PTPN13), SFRP1, ERBB4, SLC12A1 and TCF21, and their identified regulators: miR-149, miR-200c, mir-141, miR-142-3p, miR-185, mir-34a, miR-224 and miR-21 respectively. [score:2]
In Figure 3B-E, we plot the qRT-PCR expression levels of ERBB4, SFRP1, SLC12A1 and VEGFA versus Agilent chip measured levels of their regulatory microRNA (miR-224, miR-34a, miR-21 and miR-200c) for the twelve samples of Figure 3A. [score:2]
[1 to 20 of 4 sentences]
22
[+] score: 17
We discovered that of these five miRNAs, miR-122 and miR-192 were upregulated at least 1.5-fold in both HES1 and HES2 cells, while miR-135b and miR-33a were upregulated only in HES2 cells, and miR-224 was upregulated only in HES1 cells. [score:10]
Downregulated only in HES2 in response to NaB MID363 CTGTACAGCCTCCTAGCTTTCC 2 Brain-Substantia nigra miR* of hsa-let-7a in hsa-let-7a-2 Upregulated only in HES1 in response to NaB MID39 (A)AAATGGTGCCCTAGTGACTAC(A) 3 Placenta miR* of hsa-miR-224. [score:7]
[1 to 20 of 2 sentences]
23
[+] score: 16
It is highly expressed in Mϕs and poorly expressed in DCs because of mir-224 inhibition. [score:7]
In Figure 5E, PFDN5 is regulated by YBX1 and mir-224, but mir-224 is expressed at higher levels in DCs than it is in Mϕs, causing higher expression of PFDN5 in Mϕs. [score:6]
mir-224 has been characterized as an inhibitor of ROS production through silencing SYK, but the low expression of mir-224 in Mϕs demonstrates that Mϕs still need SYK to produce ROS. [score:3]
[1 to 20 of 3 sentences]
24
[+] score: 16
Among the downregulated miRNAs in leiomyomas, the authors identified miR-16, miR-197 and miR-224, three miRNAs we observed to be downregulated in progestin -induced breast cancer [82], highlighting the importance of miR-16 as a tumor suppressor in different cellular contexts. [score:9]
The comparison between control- and MPA -treated cells revealed that 16 miRNAs were significantly modulated by more than two-fold (P < 0.05, Figure 1A), nine miRNAs were upregulated (miR-191*, miR-17*, miR- 470*, miR-451, miR-702, miR-434-3p, miR-493, miR-23a* and miR-485*) and seven were downregulated (miR-378*, miR-376a, miR-224, miR-190b, miR-16, miR-410 and miR-197) (Figure 1B). [score:7]
[1 to 20 of 2 sentences]
25
[+] score: 15
Changes in miRNA expression at 3 h ranged from 11-fold down-regulation (miR-224) to 3.8-fold up-regulation (miR-367), and at 24 h from 7-fold down-regulation (miR-222) to 20.6-fold up-regulation (miR-135a*; Figure 2). [score:15]
[1 to 20 of 1 sentences]
26
[+] score: 14
miRNAExpression change [a] miRbase accession numberExpression change [b] miR-132-5p Down MIMAT0004594 DownLi et al., 2013 miR-125b-1-3p Down MIMAT0004592 DownLi et al., 2013; Mar-Aguilar et al., 2013a miR-34c-5p Down MIMAT0000686 DownYang et al., 2013 miR-382-3p Down MIMAT0022697 DownLi et al., 2013; Mar-Aguilar et al., 2013b miR-485-5p Down MIMAT0002175 DownAnaya-Ruiz et al., 2013 miR-323b-3p Down MIMAT0015050 NA NA miR-598-3p Down MIMAT0003266 NA NA miR-224-5p Up MIMAT0000281 UpHuang et al., 2012 miR-1246 Up MIMAT0005898 UpPigati et al., 2010 miR-184 Up MIMAT0000454 NA NA a Expression change in this study. [score:7]
MicroRNA-224 targets RKIP to control cell invasion and expression of metastasis genes in human breast cancer cells. [score:4]
Notably, miR-382 (Mar-Aguilar et al., 2013b), miR-224 (Huang et al., 2012), and miR-1246 (Pigati et al., 2010) were also reported as valuable potential biomarkers of breast cancer and diseases. [score:3]
[1 to 20 of 3 sentences]
27
[+] score: 14
Overexpression of miR-224 and decreased expression levels of its target, apoptosis inhibitory protein 5 (API5), were also confirmed. [score:9]
T cells transfected with miR-224 in vitro were more susceptible to activation -induced apoptosis, indicating that SLE T cells overexpressing miR-224 may have an intrinsic defect that causes accelerated cell activation -induced apoptosis [64]. [score:3]
Another recent study found 7 abnormally expressed miRNAs (miR-145, miR-224, miR-150, miR-483-5p, miR-513-5p, miR-516a-5p, and miR-629) in SLE T cells compared to healthy controls. [score:2]
[1 to 20 of 3 sentences]
28
[+] score: 13
For example, PLAG1 was a potential target for both miR-224 and miR-200a, and the expression of miR-200a was lower in BCSCs than in MCF-7 cells. [score:5]
In contrast, the expression of miR-224 was higher in BCSCs than in MCF-7 cells. [score:3]
In the first group, there were 19 miRNAs with an expression level that was four times higher in BCSCs than in MCF-7 cells: miR-122a, miR-152, miR-212, miR-224, miR-296, miR-31, miR-373*, miR-489, PRED_MIR127, PRED_MIR154, PRED_MIR157, PRED_MIR162, PRED_MIR165, PRED_MIR191, PRED_MIR207, PRED_MIR219, PRED_MIR246, PRED_MIR88 and PRED_MIR90. [score:3]
The analysed miRNAs included miR-122a, miR-188, miR-200a, miR-21, miR-224, miR-296, miR-301, miR-31, miR-373* and miR-200C. [score:1]
We performed real-time RT-PCR for 10 miRNAs: miR-122a, miR-188, miR-200a, miR-21, miR-224, miR-296, miR-301, miR-31, miR-373* and miR-200C. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 13
Other miRNAs from this paper: hsa-let-7d, hsa-mir-107, hsa-mir-215, hsa-mir-15b, hsa-mir-324
They identified induction of cyclin -dependent kinase inhibitor 1A (p21) as a common target of urolithins and could link p21 induction with downregulation of onco-miR-224 or upregulation of tumour suppressor miR-215 [45]. [score:13]
[1 to 20 of 1 sentences]
30
[+] score: 12
In this analysis, only four miRNAs were differentially expressed in both human prostate cancer cell lines and tumor samples from TRAMP mice, including miR-34b-3p, miR-34c-5p, miR-138, and miR-224 (Fig 2C and 2D). [score:3]
Conversely, miR-452 and miR-224 were not differentially expressed between PCa and BPH or between PIN and BPH, respectively (Fig 4B). [score:3]
Expression analysis followed by unsupervised hierarchical clustering D) of miR-224, -34b-3p, -138 and miR-34c-5p reveals that androgen-independent prostate cancer cells are more similar to TRAMP tissues than to androgen -dependent or non-tumorigenic prostate human cells. [score:3]
MiR-31, miR-34b-3p, miR-205, miR-224 and miR-452 showed differential expression levels between normal, PIN and PCa matched samples (p<0.01 by Friedman test; Fig 3). [score:3]
[1 to 20 of 4 sentences]
31
[+] score: 12
He C Wang L Zhang J Xu H Hypoxia-inducible microRNA-224 promotes the cell growth, migration and invasion by directly targeting RASSF8 in gastric cancerMol. [score:4]
Given that this circRNA is overexpressed in tumor-adjacent and gastric cancer samples, and also may regulate hsa-miR-224–5p (Table  3), the interaction between hsa_circ_0000284 and hsa-miR-224 is possibly involved in gastric carcinogenesis. [score:4]
Circular RNAs Target microRNAs Name Gene Name Number of seed matches Refs in gastric cancer hsa_circ_0001340 TMCC1 hsa-miR-452–5p 1 [30,31] hsa_circ_0000419 RAB3IP hsa-miR-145–5p 1 [32–34] hsa_circ_0001112 DGKD hsa-miR-375 3 [35–37] hsa_circ_0000284 HIPK3 hsa-miR-224–5p 1 [31,38] hsa_circ_0000437 CORO1C hsa-miR-1 1 [39] Figure 3Simulation of the relation between CORO1C, hsa_circ_0000437 and hsa-miR-1. Pol II: RNA polymerase II. [score:3]
Hsa-miR-224 was also described in association to gastric cancer [45]. [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 11
Other miRNAs from this paper: hsa-mir-126
They also indicated that miR-224 may be downregulated in PCa, that miR-244 expression may be gradually decreased as malignancy progresses, and that miR-224 expression may be associated with favorable prognosis. [score:8]
Mavridis et al. [13] comprehensively profiled the expression of the mature miRNA-224 molecule in benign prostatic hyperplasia and PCa with a reliable and cost-efficient method based on quantitative real-time PCR. [score:3]
[1 to 20 of 2 sentences]
33
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Selected miRNAs were also analyzed in nasal biopsies from asthmatic patients and healthy donors, revealing differential expression of 10 miRNAs (miR-18a, miR-126, let-7e, miR-155, miR-224 were down-regulated, while miR-498, miR-197, miR-874, miR-143, miR-886-3p were up-regulated) [25]. [score:9]
Analysis of patients with asthma and allergic rhinitis showed further alterations in expression for six miRNAs: miR-224, miR-498, miR-187, miR-874, miR-143, miR-886-3p as compared to the control subjects. [score:2]
[1 to 20 of 2 sentences]
34
[+] score: 11
In four FET placenta-specific miRNAs, there was no significant correlation between miRNA expression and maternal age, whereas there were weak correlations between expression levels of miR-125a-5p, miR-224-3p, miR-331-3p, miR-365a-3p, miR-518b, miR-518f-3p, and miR-543 and maternal age (Additional file 7: Table S5). [score:5]
Nine (miR-125a-5p, miR-224-3p, miR-331-3p, miR-365a-3p, miR-495-3p, miR-518b, miR-518f-3p, miR-543, and miR-7977) were significantly downregulated in FET placentae compared with SP, but not ET (Fig. 2 and Additional file 5: Figure S1). [score:3]
The boxplots show the expression levels of miR-197-5p (a), miR-4697-5p (b), miR-4721 (c), miR-5006-5p (d), miR-575 (e), miR-6893-5p (f), miR-125a-5p (g), miR-1260b (h), miR-224-3p (i), miR-331-3p (j), miR-365a-3p (k), miR-495-3p (l), miR-518b (m), miR-518f-3p (n), miR-543 (o) and miR-7977 (p). [score:3]
[1 to 20 of 3 sentences]
35
[+] score: 11
5) 7 hsa-mir-19a dbDEMC 32 hsa-mir-30d dbDEMC 8 hsa-mir-92a HMDD, miR2Disease 33 hsa-mir-451 literature 9 hsa-mir-210 miR2Disease 34 hsa-mir-152 dbDEMC 10 hsa-mir-19b dbDEMC, miR2Disease 35 hsa-mir-215 dbDEMC 11 hsa-mir-224 dbDEMC, miR2Disease 36 hsa-mir-130a dbDEMC, HMDD 12 hsa-let-7f dbDEMC, miR2Disease 37 hsa-mir-499 higher RWRMDA (No. [score:11]
[1 to 20 of 1 sentences]
36
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-mir-122
Wang et al. indicated that miR-224 expression is reciprocally regulated by HDAC1, HDAC3, and EP300. [score:4]
Unlike hsa-miR-122, miR-224 is upregulated in HCC through epigenetic mechanisms and controls several crucial cellular processes [40]. [score:4]
Our result shows that P300 (encoded by EP300) is the TF candidate of miR-224, and its TFBS can be found in 227 coexpressed gene promoters. [score:3]
[1 to 20 of 3 sentences]
37
[+] score: 10
Recently, low cir-ITCH was associated with bladder cancer, and cir-ITCH plays a tumor suppressing role by directly binding miR-17 and miR-224, which if sponged lead to the inhibition of PTEN and p21 (53). [score:6]
Overexpression of circ-ITCH leads in vitro and in vivo to a less aggressive phenotype(49) Down CRC(50) Down Lung cancer(51) Down HCC Contains multiple SNPs which can modify the susceptibility to HCC(52) Down Bladder cancerPotentially anti-tumorigenic role, by sponging miR-17 and miR-224 positively regulates p21 and PTEN. [score:4]
[1 to 20 of 2 sentences]
38
[+] score: 10
Amongst the miRNAs with the greatest fold-change between ccRCC and normal kidney cortex were the upregulated miRNAs miR-122-5p, miR-224-5p, miR-210-5p, the downregulated miR409-3p, and the upregulated miR-21-3p. [score:10]
[1 to 20 of 1 sentences]
39
[+] score: 10
It is seen that the expression of miR-17, miR-18a, miR-19, miR-20a, miR-21, miR-31, miR-92a, and miR-224 is upregulated in lung cancer cells and inhibition of their expression can reduce cell growth and invasion capacities [7, 39– 41]. [score:10]
[1 to 20 of 1 sentences]
40
[+] score: 9
For example, miR-224 is commonly upregulated in HCC, and there is reportedly a positive correlation between miR-224 expression and histone acetylase protein EP300 in HCC tumors (Wang et al., 2012). [score:6]
MicroRNA-224 is up-regulated in hepatocellular carcinoma through epigenetic mechanisms. [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 8
The expression levels of 12 miRNAs, including miR-139-3p, miR-204, miR-760, miR-432, miR-524-5p, miR-136, miR-548d-3p, miR-206, miR-214, miR-383, miR-224, and miR-887 were significantly lower, whereas the expression level of miR-146a was significantly higher, in Jurkat cells after being cultured with TNF-α for 7 days (fold change > 4, p < 0.05, Fig.   1b). [score:5]
Lu MC Lai NS Chen HC Yu HC Huang KY Tung CH Decreased microRNA(miR)-145 and increased miR-224 expression in T cells from patients with systemic lupus erythematosus involved in lupus immunopathogenesisClin Exp Immunol. [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 8
CDC42, CDH1, PAK2, and BCL-2 are validated as targets of miR-224, which exhibits increased expression of both mRNA and protein levels in HCC cells as well as in HCC tissues [48]. [score:5]
Abnormal autophagy activity decreases miRNA-224 targeting of Smad4 to accumulate cell migration and tumor formation [80, 81]. [score:3]
[1 to 20 of 2 sentences]
43
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
Similarly, it is demonstrated that miR-106a and miR-224 are upregulated in the brains of PD patients, ultimately leading to impaired chaperone -mediated autophagy (CMA) and α-synuclein accumulation. [score:4]
Several research groups demonstrated that miRNA-548d, miRNA-224, miRNA-373, miRNA-198, miRNA-106a, miRNA-26b, and miRNA-301b show altered expression in PD patients (Alvarez-Erviti et al., 2013; Burgos et al., 2014; Cardo et al., 2014). [score:3]
miR-106a and miR-224 cause a dose -dependent reduction in heat shock 70 kDa protein (hsc70) and lysosome -associated membrane protein 2 (LAMP-2A), respectively, to impair autophagic mechanism in SH-SY5Y cells (Alvarez-Erviti et al., 2013). [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 8
Other miRNAs from this paper: hsa-mir-141, hsa-mir-200c, hsa-mir-452, hsa-mir-888, hsa-mir-877
All three microRNAs that are differentially expressed between the Xq tensor GSVD classes, and map to the same amplification, miR-888, miR-224, and miR-452, together with the gamma-aminobutyric acid (GABA) A receptor epsilon-encoding GABRE, which hosts mir-224 and mir-452 in its introns, are consistently overexpressed. [score:5]
Underexpression of miR-224 was implicated in OV pathogenesis [50]. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 8
By considering the fold-change threshold and percentage of incidence, among the 95 screened miRNAs which have functional significance with regard to potential roles in cancer, cell development and apoptosis, ten miRNAs (miR-205, miR-196a, miR-149, miR-183, miR-224, miR-210, miR-150, miR-136, miR-200c and miR-141) were identified which may play a putative role in cancer development, metastasis and have potential as biomarkers for the detection of NPC. [score:3]
The incidence of up and down regulation of these ten miRNAs, including miR-205 (94.1%), miR-196a (88.2%), miR-149 (82.4%), miR-183 (64.7%), miR-224 (58.8%), miR-210 (58.8%), miR-136 (47.1%), miR-200c (64.7%), miR-141 (52.9%) and miR-150 (82.4%) between non-NPC controls and NPC patients ranges from about 47% to 94% incidence rate. [score:2]
Zhang Y Involvement of microRNA-224 in cell proliferation, migration, invasion, and anti-apoptosis in hepatocellular carcinomaJ. [score:1]
Among these 10 miRNAs candidates, 6 (miR-196a, miR-183, miR-224, miR-136, miR-200c and miR-150) and 3 (miR-136, mi141 and 150) miRNAs have no data reported in HNSCC and ESCC, respectively. [score:1]
They were miR-205, miR-196a, miR-149, miR-183, miR-224, miR-210, miR-136, miR-200c, miR-141 and miR-150. [score:1]
[1 to 20 of 5 sentences]
46
[+] score: 8
Likewise, during breast cancer development, miR-224 inhibits cell invasion at the early non-invasive stage by targeting chemokine receptor CXCR4 and cell division cycle protein CDC42 [6]; while at the late invasive stage, miR-224 promotes tumor cell’s bone metastasis by targeting phosphatidylethanolamine binding protein RKIP [7]. [score:8]
[1 to 20 of 1 sentences]
47
[+] score: 8
miR-106a, miR-17, miR-19b and miR-224, were highly expressed during secondary muscle fiber formation (Stg2) and then decreased significantly during the subsequent phases of development (Fig. 3A), suggesting that they may be functionally related to the phase of secondary muscle fiber formation. [score:4]
We also detected some differentially expressed miRNAs during human skeletal muscle development, such as miR-224, and miR-381, which have not yet been associated with muscle formation. [score:4]
[1 to 20 of 2 sentences]
48
[+] score: 8
For example, hypoxia-inducible microRNA-224 promotes the GC cell growth, migration and invasion by directly targeting RASSF8 [15], but miR-34a can act as a tumor suppressor targeting IGF2BP3 in gastric carcinogenesis [16]. [score:8]
[1 to 20 of 1 sentences]
49
[+] score: 7
In contrast, for those down-regulated, the top ten were miR-224, 126, 7a, 128, 455, 452, 135b, 145, 18a and 196a (Figure 2B). [score:4]
miR-224 expression decreased most (< -5-fold). [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 7
2011.331 21915098 [91] Guo X, Xue H, Guo X, Gao X, Xu S, Yan S, Han X, Li T, Shen J, Li G. MiR224-3p inhibits hypoxia -induced autophagy by targeting autophagy-related genes in human glioblastoma cells. [score:4]
[37] For example, ULK1 (unc-51 like autophagy activating kinase 1) is targeted by MIR20A and MIR106; [85] BECN1/beclin 1 by MIR30A, MIR376B and MIR519A; [86-89] RAB5A (RAB5A, member RAS oncogene family) by MIR101 and MIR630; [89,90] RB1CC1/FIP200 (RB1 inducible coiled-coil 1) by MIR224; [91] and ATGs by MIR30A, MIR181A, MIR374A, MIR630, MIR376B, MIR204, MIR224, MIR375, MIR519A, MIR885, and MIR-101. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 7
Interestingly, miR-139-5p, the most down-regulated in the T vs N comparison, has very recently been identified as a member of a signature predictive of the clinical aggressiveness of stage II CRC [29]; in addition, miR-224, the most up-regulated together with miR-183 in the same comparison, has been identified for its ability to distinguish CRC by means of proficient or deficient DNA mismatch repair machinery [30]. [score:7]
[1 to 20 of 1 sentences]
52
[+] score: 7
We also tested miR-204 and miR-224 because they are reported to be expressed in mouse RPE [29, 30]. [score:3]
Although all the tested miRNAs, including miR-204 and miR-224, were found to be expressed in ARPE-19 cells, the majority did not respond to 4HPR treatment. [score:3]
An exception is the reported detection of miR-204 and miR-224 in mouse RPE using in situ hybridization [29, 30]. [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 7
And some of these miRNAs, such as miR-26b, miR-106a and miR-301b (targeting Hsc 70), or miR-21, miR-224 and miR-373 (targeting LAMP2A) have been confirmed to target the 3' UTR of either Hsc 70 or LAMP2A [42]. [score:7]
[1 to 20 of 1 sentences]
54
[+] score: 7
MiR-224 was chosen as one of the negative controls because it was down-regulated during hypoxia but was not predicted to target VEGF. [score:5]
These include one positive control, VEGF-siRNA, and four negative controls, miR-224, mutated miR-16 (miR-16M 5′-UAGCCUAACGUAAAUAUUGGCG- 3′) and miR-20a, miR-20aM 5′ -UACGUUGCUUAUAGUGCAGGUAG- 3′), and a random sequence. [score:1]
The controls consist of one positive control: VEGF-siRNA (PC), and four negative controls: miR-224, mutated miR-16, and miR-20a (miR-16M, miR-20aM), and a random sequence (NC). [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 6
miRNAs have been shown to be important regulators of immune homeostasis and their aberrant expression was found in some autoimmune diseases, such as miR155 and miR146a in rheumatoid arthritis, and miR145 and miR224 in lupus erythematosus [12– 14]. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
Consistent with other studies, we also found that miR-200a, miR-200b, miR-18a and miR-224 were among the top 10 downregulated miRNAs, while miR-29, miR-125a, miR-125b, miR-122 and miR-186 were upregulated in LNCaP/DHT compared with LNCaP. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
The top five upregulated miRNAs (miR-1195, miR-223-3p, miR-129-2-3p, miR-709, and miR-224-5p) were selected for subsequent analysis, which was performed via quantitative real-time PCR analysis of the plasma from individual mice in each group. [score:4]
We were unable to detect miR-1195, miR-129-2-3p, and miR-224-5p in the plasma of mice in either group (Fig 3). [score:1]
Five miRNAs (miR-1195, miR-223-3p, miR-129-2-3p, miR-709, and miR-224-5p), whose levels were found to be significantly elevated in the pooled plasma of ß-glucan -injected SKG mice by panel real-time PCR, were analyzed. [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 6
In contrast, miR-196a/b/c, miR-224 and miR-324-3p were found to be downregulated, hence their low expression may also be indicative of recovery. [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 6
hsa-miR-182, hsa-miR-183 and hsa-miR-224 are upregulated and hsa-miR-1, hsa-miR-101, hsa-miR-143, hsa-miR-145, hsa-miR-127 and hsa-miR-29c are downregulated in bladder urothelial carcinoma compared to matched histologically normal urothelium [27]. [score:6]
[1 to 20 of 1 sentences]
60
[+] score: 6
As illustrated in Figure 2, one of the poly-miRTSs identified by TargetSpy (a created site for miR-224 at position 50 of SLA-3 3′-UTR) was always associated with a miR-27a/b created site predicted by TargetScan and PACMIT at position 298. [score:5]
Each poly-miRTS was either found in several alleles (e. g. miR-224 site in SLA-3), or in a single allele (e. g. miR-216 site in SLA-3: gb_EU432082.1 allele) (e. g. SLA-3: Figure 2). [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 6
MiR-224, miR-18, and pre-mir-18 were upregulated and miR-199a*, miR-200a, miR-199a, miR-125a, and miR-195 were downregulated in HCC samples compared to normal liver samples. [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 6
Another micro RNA miR-224 has been shown to target MBD4 in metastatic colorectal cancer cells 49. [score:3]
Additionally, Few X linked miRNAs like hsa-mir-23c, hsa-miR-222-5p, hsa-miR-224–3p, hsa-miR-767-5p and hsa-miR-6089 were also observed to be differentially expressed. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 6
Other miRNAs from this paper: hsa-mir-205, mml-mir-224, mml-mir-205
Additionally, up-regulation of miR-224 observed in our study further supports this interpretation as TGFβ1 was shown to activate miR-224 transcription in mouse granulosa cells [52]. [score:4]
The BPA mediated induction of miR-205 and miR-224 in fetal cardiac tissue is compelling as these are known to regulate tissue remo deling [49], [52]. [score:2]
[1 to 20 of 2 sentences]
64
[+] score: 5
Other miRNAs from this paper: mmu-mir-224
Li et al. found that miR-224 directly targeted HOXD10, which triggered the down-stream p-PAK4/MMP-9 signaling pathway, subsequently contributing to the regulation of cell migration and invasion [31]. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
Ling H, Pickard K, Ivan C, Isella C, Ikuo M, Mitter R, Spizzo R, Bullock MD, Braicu C, Pileczki V, et al. The clinical and biological significance of MIR-224 expression in colorectal cancer metastasis. [score:3]
Previous studies have proved that miR-224 is involved in tumor formation and progression of several human cancers [18– 20]. [score:1]
miR-452 is a member of miR-224/miR-452 cluster. [score:1]
[1 to 20 of 3 sentences]
66
[+] score: 5
Consistent with previous reports [10, 11], miR-10b-5p (miR-10b) and miR-224 were overexpressed, miR-200c-3p (miR-200c) and miR-141-3p (miR-141) were significantly reduced in NSCLC cell lines, and our laboratory also reported reduced expression of miR-129-1-3p and miR-203a in the NSCLC sample [12, 13]. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Three different miRNAs, miR-224, miR-378, and miR-383, have been found to be involved in the regulation of aromatase expression during follicle development. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 5
Similarly, transcriptional regulation may also be important for many of the significantly repressed miRNAs in smoker alveolar macrophages because ten downregulated miRNAs were processed from four polycistronic pri-miRNAs (miR-224/miR452, miR-200a/miR-200b/miR-429, miR-449a/miR-449b/miR-449c, and let-7e/miR-99b/miR-125a). [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
Other miRNAs from this paper: hsa-mir-149, hsa-mir-188, hsa-mir-193a
CCR-15-0217 26080838 6. Lin ZY MicroRNA-224 inhibits progression of human prostate cancer by downregulating TRIB1Int. [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-96, hsa-mir-140, hsa-mir-30e
miR-224-3p inhibits autophagy in cervical cancer cells by targeting FIP200. [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 5
It was found that miR-140 [*] and miR-224 are linked to androgen pathway [25] and it was noted that the stimulation of these miRNAs transcription by androgen pathway is involved to suppress the tumor suppressor in lung cancer-1 gene [26]. [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
Another example comes from a recent paper showing that metastatic cells from bladder carcinoma secrete increased levels of miRNAs with tumor-suppressor functions (e. g. inhibition of invasion, angiogenesis, and pulmonary metastasis), including miR-23b, miR-224, and miR-921. [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 5
Six miRNAs (i. e., 33a, 33b, 421, 495, 590-3p, and 590-5p) could target both CD1a and CD1c, whereas miRNA-224 could be active on CD1a and CD1b, and 3 miRNAs (i. e., 129-5p, 185 and 203) appear to be theoretically competent to target CD1b and CD1c. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
To determine whether miR-224 directly targets the 3′-UTRs of Smad4, the wild-type or mutant Smad4 gene contained 3′UTR sequence with relative miR-20a-5p binding specific sequence was amplified and transfected into Dual Luciferase Reporter vector, and miR-20a-5p mimics, anti-miR-20a-5p or mutant-anti-miR-20a-5p mimics were cotransfected into relative CRC cells by Lipo2000 following the introductions. [score:4]
miR-224, as an oncogenic miRNA, facilitates tumor progression by shifting the equilibrium of the partially antagonist functions of SMAD4 toward enhanced invasion and growth in non-small-cell lung cancer [7]. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Functional involvement of miR-224, miR-378, and miR-382 in regulation of aromatase expression during follicle development has been demonstrated, and miR-21 promoted follicular cell survival during the ovulation (Donadeu et al. 2012). [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
A set of 22 miRNAs were found to be differentially expressed between normal and early stage (mostly stage II) CRC including increases in miR-21 and miR-224 and decreases in miR-133a and miR-145 (Table 2). [score:3]
These miRNAs such as miR-224 and miR-21 should be further examined for their utility as diagnostic biomarkers of CRC. [score:1]
Furthermore, several of these miRNAs were associated with CRC tumor progression including loss of miR-133a and gain of miR-224. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 5
Moreover, qRT-PCR results have confirmed that within a number of gastric cancer cell lines there was a decrease in miR-224, a CD40 regulator, and an increase in miR-200a, which targets E-cadherin, following the knockdown of hsa_circ_0000096 [68]. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 4
The most dramatic effect among highly expressed known miRNA was observed for let-7a-3p, as well as: let-7i-5p, miR-1296-3p, miR-340-5p, miR-3184-3p, miR-7-5p, miR-142-5p, and miR-224-3p (Supplementary Table S4). [score:3]
Finally, the miR-1296-3p MiR is intragenic to the JMJD1C gene that has a strong BORIS binding site in its promoter, with a similar situation observed for miR-340-5p (the RNF130 gene), and for miR-224-3p (GABRE gene). [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 4
Other miRNAs from this paper: hsa-mir-21, hsa-mir-675
Lu S. Wang S. Geng S. Ma S. Liang Z. Jiao B. Upregulation of microRNA-224 confers a poor prognosis in glioma patients Clin. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
NFKB1 is another important TF that regulates the expression of eight miRNAs, including hsa-miR-21, hsa-miR-17 and hsa-miR-224. [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
Severals, including let-7, miR-9, miR-21, miR-143, miR-146 and miR-224, are transcriptional targets of NF-κB (Hoesel and Schmid 2013). [score:3]
Others, including let-7, miR-9, miR-143 and miR-224 that have been shown to be transcriptional targets of NF-κB (Hoesel and Schmid 2013) were not associated with genes evaluated in our colorectal data. [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 4
miR-224 can promote both in vitro and in vivo cisplatin resistance of A549 cells via targeting gene p21 (WAF1/CIP1) and regulating G1/S cell cycle transition and apoptosis [16]. [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
There were however seven microRNAs (miR-335-3p, miR-128, miR-224-5p, miR-28-5p, miR-191-5p, miR-423-3p, and miR-181a-5p) with a statistically significant upregulation in the controls. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
22 hsa-miR-224 1.43 hsa-miR-26a −1.26 hsa-miR-29a −1.21 hsa-miR-376c 1.26 hsa-miR-424 −1.35 hsa-miR-455-3p 1.48 hsa-miR-99a † 1.21 Italic: down-regulated in fat cells from obese. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
In our previous study, we reported that miR-224 could promote cisplatin resistance in A549/DDP cells via regulating G1/S transition and apoptosis by targeting p21 [WAF1/CIP1] [10]. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 3
Two prior studies concluded that TCF21 is targeted by miR-21 and miR-224 [38, 39]. [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
Many miRNAs such as miR-21, miR-224, miR-34a, miR-221/222, miR-106a, and miR-203 are upregulated in HCC compared to benign hepatocellular tumors such as adenomas or focal nodular hyperplasia. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Assessment of CRC-specific survival with less commonly expressed miRNAs showed two significant associations (q value < 0.05) with colon cancer survival and three associations, miR-224-5p, miR- 335-5p and miR- 374a-5p (q value < 0.1), with survival after being diagnosed with rectal carcinoma (Table 6). [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Altered gene or miRNA expression also contribute to MTX resistance such as increases in AKR1C1 [11], S100A4 [12], caveolin-1, enolase-2, PRKCA [13], DKK1, EEF1A1, and UGT1A family [14], [15], and the decrease of E-Cadherin [13] or miR-224 [16]. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Expression signatures of a minimum of two (miR-126/126*), three (miR-224, miR-368, and miR-382), and seven (miR-17-5p and miR-20a, along with the aforementioned five) miRNAs could correctly distinguish CBF, t (15;17), and MLL-rearrangement AMLs, suggesting that these microRNAs may cooperate with specific translocation in leukemogenesis [107]. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
Several deregulated miRNAs in HCC such as miR-195 [7], miR-101 [8], miR-122 [9], miR-221 [10], miR-224 [11] miR-223 [12], miR-21 [13] and miR-199 [14] have been shown to regulate cell growth, apoptosis, migration and invasion. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
TAZ can regulate miR135b and miR224 to promote EMT and tumorigenesis in osteosarcoma [366, 367]. [score:2]
Ma J. Huang K. Ma Y. Zhou M. Fan S. The TAZ-miR-224-SMAD4 axis promotes tumorigenesis in osteosarcomaCell Death Dis. [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 3
Involvement of CD40 targeting miR-224 and miR-486 on the progression of pancreatic ductal adenocarcinomas. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Interestingly, exosomes derived from metastatic-cancers might also display high expression for anti-cancer miRNAs such as hsa-let-7, hsa-miR-23, hsa-miR-224 and hsa-miR-921 64, which is believed as an internal reformation technique of the cancer cells to retain malignant properties by sacking the promising threats outside. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Murakam et al. systematically analyzed miRNA expression profiles in biopsies from patients with HBV, HCV, cirrhosis, and HCC using the adjacent normal tissues as control, and demonstrated that levels of miR-18, pre-miR-18 and miR-224 are elevated in HCC, whereas levels of miR-199a*, miR-195, miR-199, miR-200a and miR-125a are decreased. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
Other studies focusing on Wnt -dependent MB show decreased expression of miR-193 and miR-224 to enhance cell proliferation and decrease radiosensitivity [118]. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
Among the 43 differentially expressed miRNAs, a part of miRNAs such as miR-1, miR-26a, miR-30a, miR-30b miR-133a, miR-133b and miR-224, are found to play a key role in cancers, whereas some miRNAs are not reported [20]– [26]. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Some miRNAs may be uniquely expressed only in specific body fluids, as exemplified by miR-224 (plasma/serum), miR-637 (tears), miR-193b (breast milk), and miR-508-5p (seminal fluid) (14). [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Zhang et al. found that ectopic expression of miR-224 promoted CRC tumor cell proliferation, migration, and invasion in vitro [10]. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-21 -1.1788 1.45E-02 1.68E-02 -2.4642 2.07E-04 3.85E-04 ssc-miR-143-3p -1.1940 1.40E-02 1.67E-02 -2.7004 2.27E-05 5.34E-05 ssc-miR-145-3p -1.2289 2.47E-02 2.68E-02 -2.6837 6.34E-04 1.10E-03 ssc-miR-505 -1.3657 2.68E-02 2.82E-02 -2.1577 4.16E-02 4.16E-02 ssc-miR-98 -1.5185 3.46E-03 5.15E-03 -2.8061 7.55E-05 1.55E-04 ssc-miR-139-3p -1.6685 2. 54E-02 2.71E-02 -2.5158 1.69E-02 1.93E-02 ssc-miR-23b -1.7157 3.70E-03 5.42E-03 -2.3687 8.39E-03 1.10E-02 ssc-miR-224 -1.8515 1.41E-02 1.67E-02 -2.5778 1.95E-02 2.19E-02 ssc-miR-23a -1.8753 3.40E-03 5.15E-03 -2.4676 1.00E-02 1.24E-02 ssc-miR-143-5p -1.9243 1.15E-04 2.60E-04 -3.9943 1.25E-09 5.88E-09 ssc-miR-139-5p -2.1198 2.01E-02 2.24E-02 -3. 2644 1.01E-02 1.24E-02 ssc-miR-222 -2.2666 2.58E-07 1.02E-06 -2.6019 2.34E-05 5.35E-05 ssc-miR-671-5p -2.3068 1.15E-02 1.47E-02 -2.7986 3.86E-02 3.92E-02 ssc-miR-9843-3p -2.3507 9.68E-04 1.87E-03 -4.7281 5.90E-05 1.31E-04 ssc-miR-145-5p -2.7059 2.08E-03 3.50E-03 -4.3459 7.18E-05 1.51E-04 ssc-miR-221-5p -2.7136 3.21E-07 1.21E-06 -1.9513 3.02E-02 3. 22E-02 ssc-miR-221-3p -2.9643 8.31E-11 5.47E-10 -2.1967 1.74E-03 2.90E-03 ssc-miR-708-5p -4.0615 2.31E-06 7.60E-06 -2.8238 6.43E-03 8.72E-03 ssc-miR-193a-3p -4.1933 2.39E-07 1.02E-06 -4.3848 2.87E-07 9.18E-07 ssc-miR-193a-5p -4.1933 2.39E-07 1.02E-06 -7.1423 2.32E-12 1.33E-11 ssc-miR-452 -4.3025 5.55E-11 3.99E-10 -2.2057 1.53E-02 1.77E-02 ssc-miR-206 -5.3001 6. 39E-09 3.37E-08 -6.2200 3.10E-09 1.38E-08 10.1371/journal. [score:1]
adj ssc-miR-21 -1.1788 1.45E-02 1.68E-02 -2.4642 2.07E-04 3.85E-04 ssc-miR-143-3p -1.1940 1.40E-02 1.67E-02 -2.7004 2.27E-05 5.34E-05 ssc-miR-145-3p -1.2289 2.47E-02 2.68E-02 -2.6837 6.34E-04 1.10E-03 ssc-miR-505 -1.3657 2.68E-02 2.82E-02 -2.1577 4.16E-02 4.16E-02 ssc-miR-98 -1.5185 3.46E-03 5.15E-03 -2.8061 7.55E-05 1.55E-04 ssc-miR-139-3p -1.6685 2. 54E-02 2.71E-02 -2.5158 1.69E-02 1.93E-02 ssc-miR-23b -1.7157 3.70E-03 5.42E-03 -2.3687 8.39E-03 1.10E-02 ssc-miR-224 -1.8515 1.41E-02 1.67E-02 -2.5778 1.95E-02 2.19E-02 ssc-miR-23a -1.8753 3.40E-03 5.15E-03 -2.4676 1.00E-02 1.24E-02 ssc-miR-143-5p -1.9243 1.15E-04 2.60E-04 -3.9943 1.25E-09 5.88E-09 ssc-miR-139-5p -2.1198 2.01E-02 2.24E-02 -3. 2644 1.01E-02 1.24E-02 ssc-miR-222 -2.2666 2.58E-07 1.02E-06 -2.6019 2.34E-05 5.35E-05 ssc-miR-671-5p -2.3068 1.15E-02 1.47E-02 -2.7986 3.86E-02 3.92E-02 ssc-miR-9843-3p -2.3507 9.68E-04 1.87E-03 -4.7281 5.90E-05 1.31E-04 ssc-miR-145-5p -2.7059 2.08E-03 3.50E-03 -4.3459 7.18E-05 1.51E-04 ssc-miR-221-5p -2.7136 3.21E-07 1.21E-06 -1.9513 3.02E-02 3. 22E-02 ssc-miR-221-3p -2.9643 8.31E-11 5.47E-10 -2.1967 1.74E-03 2.90E-03 ssc-miR-708-5p -4.0615 2.31E-06 7.60E-06 -2.8238 6.43E-03 8.72E-03 ssc-miR-193a-3p -4.1933 2.39E-07 1.02E-06 -4.3848 2.87E-07 9.18E-07 ssc-miR-193a-5p -4.1933 2.39E-07 1.02E-06 -7.1423 2.32E-12 1.33E-11 ssc-miR-452 -4.3025 5.55E-11 3.99E-10 -2.2057 1.53E-02 1.77E-02 ssc-miR-206 -5.3001 6. 39E-09 3.37E-08 -6.2200 3.10E-09 1.38E-08 10.1371/journal. [score:1]
[1 to 20 of 2 sentences]