sort by

191 publications mentioning hsa-mir-204 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-204. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 420
For the MAFA transcript, we observed a modest and statistically not significant 5% decrease of copy number upon miR-204 upregulation (Mann Whitney test p = 1.0) and a 6% mean increase when miR-204 was down-regulated (Mann Whitney test p = 0.7) (Fig.   6b); the TXNIP transcript showed a 14% mean decrease when miR-204 was up-regulated (Mann Whitney test p = 0.222) and a 7% mean decrease when miR-204 was down-regulated (Mann Whitney test p = 0.7 for both) (Fig.   6c); the TRPM3 transcript showed a 5% mean decrease when miR-204 was up-regulated (Mann Whitney test p = 0.895) and a 6% mean decrease when miR-204 was down-regulated (Mann Whitney test p = 1.0 for both) (Fig.   6d). [score:19]
In pancreatic β cells, miRNAs potentially contribute to the pathogenesis of diabetes by acting on cell function and differentiation 2– 9. In a proposed regulatory pathway, miR-204 has been implicated in the regulation of insulin expression in both human islets and rodent β cell lines [10], mediated by a direct targeting and downregulation of MAFA, a known insulin transcription factor. [score:11]
While the mismatch present in the candidate human seed sequence could explain the negligible or minor effect of miR-204 up- or down-regulation on the transcript levels of MAFA that we observed in our study, the current understanding of miRNAs’ function allows for translational repression, also following non-canonical interactions [32], that are independent of the downregulation at the transcript level of the miRNAs’ targets. [score:11]
Expression of miR-204 is associated with an insulin functional phenotype in PETsExpression of miR-204 and of the closely related miR-211, miR-375, and miR-9 was analyzed by real-time qRT-PCR in functional pancreatic neuroendocrine tumors (PET) of which 7 expressed insulin (Ins-F-PET), 4 glucagon or somatostatin (Gluc/Som-F-PET, 3 glucagonomas, 1 somatostatinoma), and in 7 non-functional tumors (NF-PET) (Supplementary Table  S1). [score:7]
Treatment groups are identified by bar color: untreated cells white bars, miR-204 down-regulation light grey bars, miR-204 up-regulation dark grey bars. [score:7]
miR-204 up- and down-regulation in EndoC-βH1 cellsEndoC-βH1 cells were seeded at 2 × 10 [5] cells/well in a 6 wells plate, cultured for 1 week, and then subjected to miR-204 up- and down-regulation as described above for purified islets, allowing the transfection to proceed for either 48 (three independent experiments) or for 72 hours (one experiment). [score:7]
The transcript of the TRPM3 gene, within whose intron 6 the miR-204 gene is encoded, showed a 4% decrease when miR-204 was up-regulated and a 7% decrease when miR-204 was down-regulated (Mann Whitney test p values equal to 0.9 and 0.1, respectively) (Fig.   7d). [score:7]
The miR-204 target sequence in the 3′ UTR of the human MAFA transcript is not canonicalA bioinformatics analysis of potential mRNA targets of miR-204 was performed with a panel of online tools based on alternative algorithms: miRanda (complementary method), TargetScan (seed-complementary method), DIANAmicroT (thermodynamics method), RNAhybrid (Thermodynamics & Statistical mo del method), and MiRtaget2 (Support Vector Machine method) 14– 18. [score:7]
Treatment groups are identified by bar color: untreated cells white bars, miR-204 down-regulation light grey bars, miR-204 up-regulation dark grey bars (panel b). [score:7]
Effective up- and down-regulation of miR-204 by transfection of miR-204 precursor or hairpin inhibitor in the human β cell line EndoC-βH1We investigated the effect of miR-204 up- or down-regulation in the EndoC-βH1 cell line, as a mo del of pancreatic β cells. [score:7]
Copies of the MAFA transcript showed a 21% decrease when miR-204 was up-regulated and a 9% decrease when miR-204 was down-regulated; both changes did not reach statistical significance (Mann Whitney test p values equal to 0.1 and 0.2, respectively) (Fig.   7b). [score:7]
Treatment groups are identified by bar color: untreated cells white bars, miR-204 down-regulation light grey bars, miR-204 up-regulation dark grey bars. [score:7]
Copies of the TXNIP transcript showed a 33% decrease when miR-204 was up-regulated and a 23% decrease when miR-204 was down-regulated (Mann Whitney test p values equal to 0.1 for both) (Fig.   7c). [score:7]
The statistical significance of changes in gene expression upon miR-204 up-regulation was assessed using the Wilcoxon matched pair signed rank test. [score:6]
In miR-204 down-regulation experiments, cells were transfected with the miRIDIAN hairpin inhibitor rno-miR-204 (Dharmacon) at a final concentration of 25 nM [10]. [score:6]
In the HP1260 islet preparation, that showed the highest viability post transfection, the INS transcript displayed a 5% mean decrease upon miR-204 up-regulation and a 6% mean decrease upon miR-204 down-regulation compared to the appropriate control treatment (Mann Whitney test p = 0.7 for both) (Fig.   6a). [score:6]
For miR-204 down-regulation, the same islets were transfected with a miR-204 hairpin inhibitor or with transfection reagent alone as a mock treatment. [score:6]
Effective up- and down-regulation of miR-204 by transfection of miR-204 precursor or hairpin inhibitor in the human β cell line EndoC-βH1. [score:6]
In turn, the levels of miR-204 were shown to down-regulate the MAFA transcription factor, leading eventually to a reduction in the expression of the insulin gene. [score:6]
miR-204 is upregulated when iPSCs are differentiated towards a β cell-like phenotypeThe association of miR-204 and miR-211 expression with the acquisition of a β cell-like phenotype was tested in the course of iPSCs differentiation towards pancreatic endocrine cells [12]. [score:6]
Consistent with previous reports, miR-204 expression was enriched in insulinomas and drastically lower in both non-functional PETs and functional PETs expressing glucagon or somatostatin. [score:5]
However, the expression of miR-204 was previously reported as restricted to insulinomas in pancreatic endocrine tumors (PET) [27] and enriched in β cells compared to α cells in purified pancreatic islets [28], suggesting a potential role in either β cell differentiation or insulin expression regulation or both. [score:5]
Bioinformatics analysis of miR-204 target sequences in the MAFA 3’UTRA bioinformatics analysis of potential mRNA targets of miR-204 was performed with a panel of online tools based on alternative algorithms: miRanda (complementary, http://www. [score:5]
miR-204 up- and down-regulation in purified human isletsFor mir-204 up or down regulation experiments human pancreatic islets from 3 different donors were used HP1260, HP1266, and HP1269 (median islets purity = 80%, range 70% to 80%). [score:5]
A bioinformatics analysis of potential mRNA targets of miR-204 was performed with a panel of online tools based on alternative algorithms: miRanda (complementary method), TargetScan (seed-complementary method), DIANAmicroT (thermodynamics method), RNAhybrid (Thermodynamics & Statistical mo del method), and MiRtaget2 (Support Vector Machine method) 14– 18. [score:5]
Expression of miR-204 and of the closely related miR-211, miR-375, and miR-9 was analyzed by real-time qRT-PCR in functional pancreatic neuroendocrine tumors (PET) of which 7 expressed insulin (Ins-F-PET), 4 glucagon or somatostatin (Gluc/Som-F-PET, 3 glucagonomas, 1 somatostatinoma), and in 7 non-functional tumors (NF-PET) (Supplementary Table  S1). [score:5]
Effect of up- or down-regulation of miR-204 in EndoC-βH1 on C-peptide secretionC-peptide content in culture supernatants of EndoC-βH1 was measured by ELISA at day 1 and 2 after up- or down-regulation of miR-204. [score:5]
miR-204/211 are expressed in different human tissues and, in the pancreas, are specifically enriched in isletsAmong normal tissues, the expression of miR-204 was highest in the kidney, followed by brain, testes, ovary, and then pancreatic islets (Supplementary Fig.   S4) with levels just below the 3rd quartile of all tissues tested. [score:5]
Effect of up- or down-regulation of miR-204 in Human Islets on INS, MAFA, TXNIP, and TRPM3 mRNA levelsThree independent experiments were performed in which miR-204 was up- or down-regulated in pancreatic human islets from different cadaveric donors (HP1260, HP1266, HP1269) and INS, MAFA, TXNIP, and TRPM3 transcripts subsequently measured by ddPCR. [score:5]
Assessment of c-peptide content in culture supernatant of EndoC-βH1 upon miR-204 up- and down-regulationBasal c-peptide levels in culture supernatants of EndoC-βH1 cells upon miR-204 up- and down-regulation were measured using the Mercodia c-peptide ELISA kit (Mercodia AB, Uppsala, Sweden) following the manufacturer’s instructions. [score:5]
Figure 8Effect of miR-204 up- or down-regulation on c-peptide release in EndoC-βH1 supernatants. [score:4]
Moreover, miR-204 was also clearly detectable in healthy purified islets, with levels higher than in PETs or co-purified non-endocrine components like acinar, ductal cells, and mesenchymal stem cells resident within islets, despite the known ability of the latter to up-regulate miR-204 under suitable conditions [29]. [score:4]
Figure 6Effect of miR-204 up- or down-regulation on INS, MAFA, TXNIP, and TRPM3 transcripts in isolated human islets. [score:4]
Figure 5 miR-204 up- and down-regulation in Human Islets. [score:4]
Figure 7Effect of miR-204 up- or down-regulation on INS, MAFA, TXNIP, and TRPM3 transcripts in EndoC-βH1. [score:4]
Linear regression analysis showed that miR-204 expression in all PET sub-groups correlated with expression of its homologous miR-211 (Supplementary Fig.   S1), likely as a consequence of partial cross-reactivity between the miR-204 and the miR-211 assays. [score:4]
miR-204 up- and down-regulation in EndoC-βH1 cells. [score:4]
Scatter plot of ddPCR droplets’ fluorescence results from a representative experiment of miR-204 up- or down-regulation in transfected purified human islets. [score:4]
miR-204 is upregulated when iPSCs are differentiated towards a β cell-like phenotype. [score:4]
Surprisingly, our study failed instead to replicate the main observations linking miR-204 to the regulatory pathway of the INS gene expression mediated by MAFA. [score:4]
In miR-204 up-regulation experiments, cells were transfected with either the hsa-miR-204 specific Pre-miR™ precursor or the Pre-miR™ negative control 2 (Life Technologies), a random sequence Pre-miR™ molecule validated to produce no identifiable effects on known miRNA function, at a final concentration of 25 nM [10]. [score:4]
However, while miR-204 might therefore theoretically lead to reduced levels of the MAFA protein in the absence of a significant effect on its transcript, we could not replicate in both purified human islets and the EndoC-βH1cell line the originally suggested downstream effect of mir-204 up-regulation and subsequent MAFA protein decrease i. e. the reduction of the insulin transcript levels. [score:4]
Unlike in the original report, in our hands a major up- or down-regulation of miR-204 reduced MAFA levels only under some experimental conditions and did not result in significant changes of the INS mRNA. [score:4]
Assessment of c-peptide content in culture supernatant of EndoC-βH1 upon miR-204 up- and down-regulation. [score:4]
Effect of up- or down-regulation of miR-204 in EndoC-βH1 on C-peptide secretion. [score:4]
Experiments in which EndoC-βH1 cells were incubated for 48 hours post transfection showed similar results (Supplementary Fig.   S8), with a mean 144 fold increase (Mann Whitney test p < 0.0001) and a mean 171 fold decrease (Mann Whitney test p < 0.0001) of mir-204 upon up- or down-regulation, respectively. [score:4]
miR-204 up- and down-regulation in purified human islets. [score:4]
Furthermore, in a clear cell renal cell carcinoma mo del [41], mir-204 post-translationally regulates TRPM3, eliciting a coordinated function in pathways in which TRPM3 is involved. [score:4]
EndoC-βH1 cells were seeded at 2 × 10 [5] cells/well in a 6 wells plate, cultured for 1 week, and then subjected to miR-204 up- and down-regulation as described above for purified islets, allowing the transfection to proceed for either 48 (three independent experiments) or for 72 hours (one experiment). [score:4]
Effect of up- or down-regulation of miR-204 in Human Islets on INS, MAFA, TXNIP, and TRPM3 mRNA levels. [score:4]
For miR-204 up-regulation, purified human islets were dissociated and transfected with a pre-miR-204 precursor or, for comparison, with an irrelevant scrambled miRNA precursor. [score:4]
All together these data demonstrate a correlation between miR-204/211 and insulin expression at both the mRNA and protein level in PET. [score:3]
miR-204/211 are expressed in different human tissues and, in the pancreas, are specifically enriched in islets. [score:3]
With respect to basal levels in undifferentiated iPSCs, expression of miR-204, INS, and PDX1 during differentiation from the DE to the EN stages reaching a median increase of 6, 51, and 2 × 10 [6] folds, respectively. [score:3]
Logistic regression analysis, based on negative or positive immunohistochemical staining, showed that in PETs the expression of insulin at the protein level was predicted by both miR-204 (OR: 16.8, 1.49–189 p = 0.022) and miR-211 (OR: 9.65, 1.09–85 p = 0.041) but not by miR-375 (OR: 0.35, 0.09–1.34) or miR-9 (OR: 0.73; 0.23–2.26). [score:3]
Box and whisker plot (min to max) of miR-204, miR-211, miR-375, and miR-9 levels expressed as fold change relative to median levels in human islets (HI) in Ins-F-PET (dark grey boxes), Gluc/Som-F-PET (light grey boxes), and NF-PET (clear boxes); the significance of differences was analyzed using the Mann Whitney test. [score:3]
In pancreatic islets expression of miR-9, another miRNA implicated in the regulation of insulin secretion, was markedly lower compared to both miR-204 and miR-375, with median levels 87 and 3857 fold lower, respectively. [score:3]
In this mo del, it was reported that TXNIP, a cellular redox regulator implicated in diabetes and pancreatic β cells susceptibility to apoptosis, could indirectly modulate the transcription of miR-204. [score:3]
miR-204 and miR-211 expression levels were not related to patient age, sex, tumor size, tumor location (head vs body-tail), tumor proliferation index, tumor histological classification (well-differentiated endocrine neoplasms vs carcinomas). [score:3]
Figure 3ddPCR quantification of miR-204 expression in PET, Human Islets and EndoC-βH1. [score:3]
However, while it is unclear how any of these predicted or described pathways could be linked to the maintenance and acquisition of an endocrine phenotype, it is of notice that none of the proposed interactions between miR-204 and MAFA, could be predicted by any of the algorithms that we applied to identification of miR-204 targets. [score:3]
No significant changes were observed when miR-204 was either up- or down-regulated compared to mock transfected cells or cells transfected with an irrelevant negative control miRNA (Fig.   8). [score:3]
Expression of miR-204 and miR-211 together with that of the INS, NGN3 and PDX1 genes was determined at sequential time-points corresponding to differentiation stages of the endocrine pancreas (Supplementary Fig.   S5). [score:3]
A bioinformatics analysis of potential mRNA targets of miR-204 was performed with a panel of online tools based on alternative algorithms: miRanda (complementary, http://www. [score:3]
The comparison of Ins-F-PET with NF-PET and with Gluc/Som-F-PET identified miR-204 and miR-211 as significantly over-expressed in insulinomas (Fig.   1). [score:3]
The association of miR-204 and miR-211 expression with the acquisition of a β cell-like phenotype was tested in the course of iPSCs differentiation towards pancreatic endocrine cells [12]. [score:3]
Figure 1 miR-204 and selected miRNA expression in PET. [score:3]
Expression of miR-204 is associated with an insulin functional phenotype in PETs. [score:3]
None of these alternative algorithms identified either TXNIP or MAFA as targets of human miR-204. [score:3]
Bioinformatics analysis of miR-204 target sequences in the MAFA 3’UTR. [score:3]
Further studies will be required in order to unravel the question if in islets the expression of miR-204 is merely reflective of that of TRPM3 or has an additional role independent from that of its host gene. [score:3]
Overall, while the results showed wide variations in the copy number of the studied mRNAs across islets preparations, we did not observe significant changes in the levels of any of the analyzed transcripts when miR-204 was either up- or down-regulated compared to control treatments. [score:3]
The variability of expression of miR-375 in islets was less pronounced than that of miR-204 with a 10-fold change from the lowest to highest observed value. [score:3]
Among normal tissues, the expression of miR-204 was highest in the kidney, followed by brain, testes, ovary, and then pancreatic islets (Supplementary Fig.   S4) with levels just below the 3rd quartile of all tissues tested. [score:3]
The miR-204 target sequence in the 3′ UTR of the human MAFA transcript is not canonical. [score:3]
Expression of miR-204/211 was detectable in all islet preparations tested, with a predominance of miR-204 whose median levels were >10 fold higher compared to miR-211 (Fig.   2). [score:2]
C-peptide content in culture supernatants of EndoC-βH1 was measured by ELISA at day 1 and 2 after up- or down-regulation of miR-204. [score:2]
Bar plot of picomoles/liter of c-peptide in culture supernatant measured by ELISA at day 1 after miR-204 up- and down-regulation. [score:2]
The aim of this study was to investigate the contribution of miR-204 to the regulation of the insulin gene transcript; we analyzed miR-204 and insulin expression in pancreatic endocrine tumors (PET), induced pluripotent stem cells (iPSCs) in the course of their differentiation towards an insulin producing endocrine phenotype, human islets, and in the human EndoC-βH1 [11] cell line, as a mo del of pancreatic β cells. [score:2]
Expression of miR-204 was clearly higher in purified islets compared to either acinar or ductal enriched cell fraction obtained after purification, with median levels 8.9 and 11.5 fold greater, respectively. [score:2]
Bar plots of average copies per ng of total RNA measured by ddPCR for the INS, MAFA, TXNIP, and TRPM3 (panel a,b,c,d, respectively) in miR-204 up- and down-regulation experiments in the HP1260 human islets preparation. [score:2]
Three independent experiments were performed in which miR-204 was up- or down-regulated in pancreatic human islets from different cadaveric donors (HP1260, HP1266, HP1269) and INS, MAFA, TXNIP, and TRPM3 transcripts subsequently measured by ddPCR. [score:2]
Basal c-peptide levels in culture supernatants of EndoC-βH1 cells upon miR-204 up- and down-regulation were measured using the Mercodia c-peptide ELISA kit (Mercodia AB, Uppsala, Sweden) following the manufacturer’s instructions. [score:2]
We investigated the effect of miR-204 up- or down-regulation in the EndoC-βH1 cell line, as a mo del of pancreatic β cells. [score:2]
In this light, we found of particular interest the novel pathway recently proposed by Xu et al. in which an additional miRNA, miR-204, influenced insulin mRNA levels by exerting a direct action on the mRNA of MAFA, a known insulin gene transcription factor [10]. [score:2]
At 72 hours, we observed a 135 fold increase of miR-204 upon transfection with the pre-miR-204 precursor compared to an irrelevant scrambled miRNA precursor, while transfection with a miR-204 specific hairpin inhibitor instead reduced miR-204 by 49 folds relative to mock -transfected cells (Supplementary Fig.   S7). [score:2]
At 72 hours post transfection, the copies per ng of total RNA of the INS transcript showed a 12% decrease in cells transfected with the pre-miR-204 precursor and a 13% decrease in cells transfected with a miR-204 specific inhibitor compared to the appropriate control treatment (Fig.   7a). [score:2]
Bar plots of average copies per ng of total RNA measured by ddPCR for the INS, MAFA, TXNIP, and TRPM3 (panels a,b,c,d, respectively) in miR-204 up- and down-regulation experiments. [score:2]
In the three experiments in which mRNA levels were measured 48 hours post transfection, we observed similar not significant results for the INS and TRPM3 transcripts while, when miR-204 was up-regulated, MAFA and TXNIP transcripts showed a mean decrease of 32% and 40% respectively (Mann Whitney test p values equal to 0.0005 and 0.0002) (Supplementary Fig.   S9). [score:2]
For mir-204 up or down regulation experiments human pancreatic islets from 3 different donors were used HP1260, HP1266, and HP1269 (median islets purity = 80%, range 70% to 80%). [score:2]
These data suggest that in pancreatic islets both miR-204 and miR-211 are predominantly enriched in endocrine cells. [score:1]
No correlation was observed also between MAFA (Spearman r = 0.25, p = 0.594) (Fig.   4c) or TXNIP (Spearman r = 0.286 p = 0.556) (Fig.   4d) and miR-204 transcripts levels. [score:1]
miR-204 was detected in all the analyzed PET, with a median number of copies per ng of total RNA of 1123 (range 142–14447) (Fig.   3). [score:1]
Older studies that analyzed the miRNA transcriptome in the pancreas or in islets failed to identify miR-204, or the closely related miR-211, as enriched in pancreatic tissue. [score:1]
The specificity of miR-204/211 for Ins-F-PET was confirmed by the presence of a statistically significant positive correlation of miR-204/211 and insulin but not glucagon mRNA levels (Supplementary Fig.   S2). [score:1]
It is therefore questionable whether the changes in insulin mRNA levels upon miR-204 modulation previously reported could be representative of what occurs in untreated β cells where the physiological levels of miR-204 are consistently orders of magnitude lower. [score:1]
miR-204 was also clearly expressed in the human β cell line EndoC-βH1, with a median of 4612 copies/ng of total RNA (range 1642–17576) measured in 9 RNA preparations collected at different time points in culture. [score:1]
Irrespective of whether this variability in insulin mRNA content reflects a true biological difference, originally present between islets preparations, or a response to physiological stimuli in culture, or more simply an effect of cellular stress, like that of the isolation and dissociation procedure in the case of purified islets, these differences clearly exceeded those previously reported as the product of the artificial modulation of miR-204 [10]. [score:1]
Although the mechanisms through which miR-204 might be linked to the endocrine phenotype in the pancreas and β cell identity in islets await clarification, we are reporting the observation of a potential correlation between the levels of the insulin mRNA and those of the transient receptor cation channel TRPM3 in the EndoC-βH1 mo del. [score:1]
In fact, the proposed seed sequence of miR-204 in the 3′ UTR region of the rat MAFA transcript contains a nucleotide mismatch in humans, therefore classifying the potential interaction of miR-204 and MAFA in humans as non-canonical. [score:1]
Overall, a 72-hour incubation with the miR-204 precursor induced an 85 fold mean increase of miR-204 compared to islets transfected with a scrambled miRNA, while transfection with a miR-204 hairpin inhibitor resulted in a 167 fold mean decrease of miR-204 compared to mock transfected islets (Fig.   5). [score:1]
In this report, we studied the relationship between insulin mRNA and miR-204 levels, both in PET, normal purified human islets, and in a human β cell line mo del. [score:1]
Box and whisker plot (min to max) of miR-204 (grey boxes), miR-211 (clear boxes), miR-375 (dark striped boxes), and miR-9 (dotted boxes) levels in human islets (HI), acinar, ductal, and pMSC cells. [score:1]
The mechanism through which TXNIP exerted this effect was only partially clarified although TXNIP was shown to induce a reduced activity of the transcription factor STAT3, that interacts with the promoter of the TRPM3 gene, within whose intron 6 miR-204 is encoded [10]. [score:1]
Levels of both miR-204 and miR-375 showed a trend towards a positive correlation with the degree of islet purity although statistically not significant (miR-204 Spearman R = 0.62, p = 0.14; miR-375 Spearman R = 0.68, p = 0.11). [score:1]
In purified human islets INS mRNA levels showed a trend towards a partial correlation with those of the MAFA transcripts, although it did not reach statistical significance, (Spearman r = 0.75, p = 0.063) (Fig.   4a), and no correlation with those of miR-204 (Spearman r = 0.357, p = 0.444) (Fig.   4b). [score:1]
The established optimal quantity for RT-ddPCR for each reaction corresponded to: 0.001 ng for INS, 5 ng for MAFA and TXNIP, 1 ng for TRPM3, 0.33 ng for miR-204, 0.25 ng for GAPDH. [score:1]
Expression was measured by qRT-PCR and is reported as fold change relative to median miR-204 levels in HI (dashed line). [score:1]
Conventional qPCR has known limitations when aimed at determining relative differences in RNA content as small as those previously described as the consequence of miR-204 up our down-modulation [10]. [score:1]
Several factors might have contributed to this lack of detection of miR-204/211, including known technical differences in RNA extraction, detection systems, and normalization strategies, that can profoundly affect miRNA discovery and quantification 23– 26. [score:1]
Neither the expression of miR-204 or miR-211 nor that of miR-375 and miR-9 correlated with any of the other evaluated genes (Supplementary Table  S2). [score:1]
Overall, these observations support the concept that, within normal pancreatic islets, miR-204 is likely to be enriched in the β cells of mature islets and related to some unspecified β cell functions. [score:1]
As typical for most miRNAs, also for miR204 the prediction in silico of the pathways in which it could be potentially involved leads to multiple alternatives of which only a fraction has been experimentally validated and only in tissues other than islets 27, 29– 31. [score:1]
We assessed the feasibility to study the function of miR-204 in pancreatic β cells using droplet digital PCR (ddPCR) for the precise and absolute quantification of selected miRNA and gene transcripts in a selection of PET (n = 10), purified human islets preparations (n = 7), and in the recently established β cell line of human origin EndoC-βH1. [score:1]
Overall, the evidences we have collected indicate that the proposed miR-204 > MAFA > INS pathway might not be relevant in human pancreatic β cells. [score:1]
Correlation of miR-204 with TRPM3 was instead only partial and did not reach statistical significance (Spearman r = 0.535, p = 0.235) (Fig.   4f). [score:1]
miR-204 quantification by ddPCR. [score:1]
However, we also observed that miR-204 levels, while clearly increasing in the course of the induced differentiation of iPSCs towards endocrine cells, did not strictly correlate with the acquisition of a terminal differentiated β cell phenotype. [score:1]
The levels of both miRNAs also differed wi dely between islet preparations, in particular miR-204 observed levels showed a >100-fold change from lowest to highest value. [score:1]
The largest amounts of miR-204 were found in the single insulinoma tested and in human islet preparations, with a median of 4488 copies/ng of total RNA (range 3079–14182). [score:1]
Xiao J MiR-204 regulates cardiomyocyte autophagy induced by ischemia-reperfusion through LC3-IIJ. [score:1]
[1 to 20 of 121 sentences]
2
[+] score: 402
1000730.g002 Figure 2(A) Enrichment of 34 miR-204 gene targets between 382 differentially upregulated HNSCC genes (GSE6631) and 1088 putative miR-204 targets predicted by sequence -based microRNA target prediction databases (miRNOME); (B–C) Determination of mRNA expression of “functionally prioritized miR-204 targets” in four laser-microdissected HNSCC tumor samples (B) and in 10 HNSCC cell lines (C) by qPCR as described above in Figure 1 and in ). [score:14]
The presence of miR-204 binding sites (Table 8 in Text S2), the coordinated up-regulation and the ability of increased miR-204 function to specifically inhibit the expression of 18 out of 21 gene targets (86%) (Figure 2D, Supporting Figures 4–5 in Text S1) suggest that these predicted genes are very likely selective and direct miR-204 targets in HNSCC. [score:13]
Further, the strong association of overexpression of functional miR-204 gene targets with an earlier relapse in a sub-type of HNSCC tumors expressing an EGFR-pathway signature (Figure 5) suggests that miR-204 expression and its deregulated gene targets could be potentially used for mechanism -based prognostic stratification of HNSCC patients to complement the conventional clinical-pathological tumor diagnosis. [score:12]
To provide evidence that miR-204 can directly suppress the expression of its predicted targets in HNSCC, examination of the 3′UTR confirmed that all 34 predicted target genes contain at least one miR-204 binding site as expected by our predictions using sequence homology databases of the miRNOME (Table 8 in Text S2, and ). [score:10]
Based on the importance of hub-bottleneck genes in regulating the function of a PPIN [33], the enrichment of four hub-bottlenecks miR-204 targets in the EGFR -dependent “prioritized HNSCC PPIN” predicts that their up-regulation upon miR-204 suppression in HNSCC could significantly augment cell cycle and extracellular matrix remo deling. [score:9]
Functional enrichment analysis of miR-204 targets and PPIN using Gene Ontology (Figures 2B–C, Figure 3C, Table 7 in Text S2, Protocol S1/Section C)To provide insights into biological functions and processes potentially regulated by miR-204 in HNSCC, we conducted standard statistical enrichment analyses based on the functional assignments of gene in Gene Ontology (GO) [28] to infer significantly deregulated functions associated with altered miR 204 target expression in the HNSCC according to their presence in the miRNOME and/or the PPINs (details in Protocol S1/Section C). [score:9]
Through enrichment analysis and network mo deling using mRNA gene expression profile, we identified a set of functionally related miR-204 targets that showed increased mRNA expression in HNSCC upon miR-204 suppression (Figures 2A–C). [score:9]
Since a small variation in the expression of a specific microRNA is expected to affect the expression of tens or hundreds of target mRNAs, genetic variations in a microRNA expression at the chromosomal break point, as we observed with miR-204 at the 9q21.1–q22.3 locus, could represent an effective mechanism of cancer predisposition, a hypothesis that is supported by emerging experimental evidences [44], [45]. [score:9]
miR-204 suppressed HNSCC cell migration, adhesion and invasion in vitro and lung colonization in vivo Among miR-204 gene targets that are potential regulators of cell-matrix interaction and proteolysis, overexpression of APRC1B [34], CTSC [35], FAP [36], MMPs [37], BMP1 [38], CDH11 [39] and ITGB4 [40] is associated with cancer metastasis and/or poor prognosis. [score:8]
We next examined mRNA expression status of 21 representative “functionally prioritized miR-204 targets” in four laser capture microdissected HNSCC tumor samples and observed increased expression of 18 of these genes compared with their respective expression in five pooled normal buccal mucosa (Figure 2B). [score:8]
Collectively, these observations indicate that down-regulation of functionally related miR-204 targets upon miR-204 mimics treatment was sequence specific and was not due to artifacts of transfection or the “off target” effect of miR-204 mimics. [score:8]
Following functional enrichment analysis of upregulated miR-204 targets in HNSCC, we next examined the role of miR-204 targets in modulating the function of a protein-protein interaction network (PPIN). [score:8]
To provide insights into biological functions and processes potentially regulated by miR-204 in HNSCC, we conducted standard statistical enrichment analyses based on the functional assignments of gene in Gene Ontology (GO) [28] to infer significantly deregulated functions associated with altered miR 204 target expression in the HNSCC according to their presence in the miRNOME and/or the PPINs (details in Protocol S1/Section C). [score:7]
The highly coordinated and nearly complete suppression of miR-204 and its host gene TRPM3 (Figure 1B–E) raises the possibility that TRPM3 mRNA expression may serve as a marker to indicate miR-204 expression status in HNSCC or other tumors, and also potentially LOH at 9q21.1–q22.3. [score:7]
Additionally analysis of thirteen “functionally prioritized miR-204 targets”, those enriched with the listed GO functions (the table in Figure 2B, ), showed overexpression of nine targets in ten HNSCC cell lines (Figure 2C). [score:7]
miR-204 suppresses the expression of its functionally prioritized targets. [score:7]
Restoration of miR-204 function achieved significant inhibition (between 30% to 75%) of endogenous mRNA expression in 18 out of 21 predicted targets examined for both cell lines, while non-specific control mimics had no significant effect (Figure 2D and Supporting Figures 4–5 in Text S1). [score:7]
Accordingly, enhancement of miR-204 function inhibited the expression of its functionally related gene targets (Figure 2D, Supporting Figures 4–5 in Text S1) in the “prioritized HNSCC PPIN” and lead to the reduced adhesion, migration and invasion in vitro (Figures 4A–C) and experimental lung metastasis in vivo (Figures 4D–F). [score:7]
We subsequently could map 260 out of 382 (68%) up-regulated genes in GSE6631 to the PPIN (refer to as “HNSCC PPIN”), of which 24 were miR-204 targets predicted in miRNOME. [score:6]
These results indicate that predicted miR-204 targets, upregulated in HNSCC, share similar functions and may participate in similar biological processes. [score:6]
Expression pattern of miR-204 targets identified a subtype of HNSCC tumors exhibiting an EGFR-pathway signature and miR-204 was deregulated in other squamous and epithelial tumors. [score:6]
To explore the clinical relevance of miR-204 down regulation in HNSCC, we conducted an unbiased hierarchical clustering analysis of 60 HNSCC tumors harvested from representative anatomical sites of HNSCC in GSE686 [41] based on the mRNA expression pattern of 34 miR-204 targets identified in GSE6631 [21] (). [score:6]
Among miR-204 gene targets that are potential regulators of cell-matrix interaction and proteolysis, overexpression of APRC1B [34], CTSC [35], FAP [36], MMPs [37], BMP1 [38], CDH11 [39] and ITGB4 [40] is associated with cancer metastasis and/or poor prognosis. [score:6]
Collectively, these biological findings support the validity of our computational predictions of miR-204 downregulation in HNSCC and suggest that it may possess tumor suppressor activity. [score:6]
Among the 1,088 putative miR-204 targets predicted in the miRNOME, 34 mRNA transcripts that were significantly upregulated in HNSCC (GSE6631) led to the enrichment of miR-204 (Figure 2A and Table 6 in Text S2). [score:6]
Hierarchical clustering using 19 -upregulated genes, a subset of miR-204 targets that could be mapped to this dataset, identified two clusters (Figure 5). [score:6]
Expression pattern of 19 miR-204 targets identified a subtype of HNSCC tumors exhibiting an EGFR-pathway signature and predicted earlier relapse. [score:5]
Since miR-204 was also predicted in the OMIM analysis to be associated with lymphoma (Table 3 in Text S2), we quantified miR-204 expression in immortalized “normal B cell 11365” and three Burkitt B-cell lymphoma cell lines and found its expression significantly reduced (Figure 1F). [score:5]
This is consistent with our observation that miR-204 targets were hub-bottleneck regulators of an EGFR -dependent regulatory network in HNSCC (Figure 3). [score:5]
In addition, the joint analyses of sequence-base information and mRNA expression arrays yielded an accuracy rate of 86% of miR-204 target predictions which surpasses the published accuracy (about 40%) of each sequence -based method when used alone [10], [55], [56]. [score:5]
The specificity of miR-204 mimics was further confirmed by unaltered expression of four endogenous housekeeping genes (GUSB, HPRT1, HUPO and PPIA) that lack target homology to miR-204 (Figure 2D and Supporting Figure 4 in Text S1). [score:5]
We first conducted statistical functional enrichment analyses using Gene Ontology (GO) [28] and found a number of biological processes (BP) and molecular functions (MF) of GO were significantly enriched among 32 of the 34 miR-204 gene targets (referred to as “functionally prioritized miR-204 targets”) (Table 7 in Text S2,, and Protocol S1/Section C). [score:5]
To determine the miR-204 expression status in epithelial tumors (Figure 1G), the expression values of miR-204 were extracted from microRNA array set GSE2564 [18]. [score:5]
Employing this method that integrates the analysis of microRNA target predictions, differential HNSCC gene expression and the cancer genes in the OMIM genetic dataset, we identified and characterized miR-204, located within its host gene TRPM3 at the 9q21.1–q22.3 region frequently incurring allelic loss [11]– [15], as a potential tumor suppressor microRNA of HNSCC and possibly of other epithelial cancers. [score:5]
Thereafter, we selected 21 “functionally prioritized miR-204 targets” overexpressed in HNSCC (Figure 2B) for biological validation. [score:5]
We first examined miR-204 host gene TRPM3 expression by quantitative PCR (qPCR) and observed near complete TRPM3 suppression in four micro-dissected HNSCC tumors (Figure 1B) and in a panel of 10 low passage HNSCC cell lines generated from tumors of diverse head and neck locations (Figure 1C and Table 5 in Text S2) [26]. [score:5]
Taken together, these observations indicate that miR-204 can significantly suppress experimental lung metastasis of SQ38 HNSCC tumors, thereby acting as a potent suppressor of metastasis. [score:5]
Thus far, miR-204 was implicated in affecting global mRNA expression levels in the retina [52]; and was shown to regulate mesenchymal progenitor cell differentiation [53]. [score:4]
Consistent with the observed near complete loss of TRPM3 (Figures 1B–C), miR-204 expression was inhibited in all four tumors by 85% to 99% (Figure 1D), and by more than 90% in all ten HNSCC cell lines (Figure 1E) compared to samples of pooled normal buccal mucosa. [score:4]
The novelty of our illustration of metastatic suppressor functions of miR-204 in head and neck cancer and its relevance to metastasis stems from our demonstration of miR-204 function at multiple scales of biology that collectively show its potential as a key regulator microRNA. [score:4]
Using this approach, the biological effect of altering the function of a specific microRNA, such as miR-204, can be accurately predicted via its gene targets that are key regulators of a protein network. [score:4]
miR-204 was significantly down-regulated in breast (P = 0.014), kidney (P = 0.004) and prostate (P = 0.0001) tumors (Figure 1G). [score:4]
Additionally, significant miR-204 down-regulation was recently reported in a subtype of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin [27]. [score:4]
miR-204 appeared critical to regulate the function of this “prioritized HNSCC PPIN” as its gene targets exhibited significant enrichment of hub and bottleneck properties (Figures 3A–B). [score:4]
In addition, as negative controls for the off target effect of miR-204 mimics treatment, real time qPCR was performed to include three additional endogenous controls: PPIA (AB, Cat#4333763), GUSB (AB, Cat# 4333767) and, HPRT1 (Cat#4333768) using commercially designed Taqman gene expression assays (Applied Biosystems). [score:4]
Moreover, consistent with the predicted role of miR-204 targets AURKB and CDC25B as hub/bottleneck regulators of the cell cycle sub-network (Figure 3), restoration of miR-204 function in vivo significantly decreased the number of Ki-67 positive proliferating single SQ38 cells (indicated by *) and micro-foci (indicated by arrows) in the paraffin embedded lung sections (P = 0.001, Figure 4F). [score:4]
Genes colored in red: miR-204 gene targets. [score:3]
The association of miR-204 targets with clinical parameters was analyzed using HNSCC mRNA array set GSE686 [41]. [score:3]
In contrast, increased miR-204 function led to a significant inhibition (P<0.05) of the ability of JSQ3 and SQ38 cells to adhere to laminin-rich basement membrane (Figure 4A), to migrate through porous Transwell (Figure 4B), and to invade through Matrigel-coated basement membrane (Figure 4C). [score:3]
We further demonstrate that gene targets of miR-204 exhibit enriched bottleneck and hub network topology properties in a predicted protein-protein interaction network (PPIN). [score:3]
These results demonstrate that increased miR-204 function via its synthetic mimics is sufficient to suppress cell-matrix interaction, motility and invasiveness in vitro. [score:3]
While similar miR-204 downregualtion was reported in head and neck cancer cell lines based on microarray analysis [46], [48], its expression status was not further confirmed by PCR or other methods and its biological functions were not explored. [score:3]
miR-204 gene targets exhibit significant topological properties in a HNSCC protein interaction network predicted by network mo deling. [score:3]
Human TATA -binding protein (TBP) (Applied Biosystems) was used as an endogenous control for miR-204 expression normalization. [score:3]
We show at the LOH 9q21.1–22.3 locus, miR-204 could serve as a tumor suppressor of HNSCC oncogenesis and progression. [score:3]
The frequent allelic loss at 9q21.1–q22.3 in HNSCC [11]– [14] provides genetic evidence that loss of miR-204 microRNA function may occur as a result of genomic imbalance at this site and that miR-204 may be a potential candidate associated with the tumor suppressor activity of 9q21.1–q22.3. [score:3]
These results indicate that the enrichment of bottleneck and hub-bottleneck properties among miR-204 gene targets in the “prioritized HNSCC PPIN” is a system's property of microRNAs. [score:3]
Further, six of the seven-miR-204 targets remained prioritized when computed using different network mo deling conditions demonstrating the robustness of our analyses (not shown, and ). [score:3]
Further, paired comparison of miR-204 expression between 6 types of adenocarcinomas and their respective normal tissues was conducted using the microRNA array dataset GSE2564 [18]. [score:3]
miR-204 gene targets exhibit significant topological properties in a predicted protein interaction network of HNSCC based on single protein network mo deling. [score:3]
Additionally, the proportion of hub-bottleneck genes was further enriched among the seven miR-204 targets present in the “prioritized HNSCC PPIN” (P = 0.002; Fisher's exact test, MMP9, SHC1, CDC25B and AURKB in Figures 3A–B). [score:3]
Predicted miR204 gene targets are significantly related through their biological functions. [score:3]
miR-204 functional targets classified 60 HNSCC tumors in (GSE686) [41] microarray based on their intrinsic properties (Methods). [score:3]
miR-204 suppressed HNSCC cell migration, adhesion and invasion in vitro and lung colonization in vivo. [score:3]
Using this approach, we selected miR-204 among ten prioritized microRNAs for biological characterization, as miR-204 is located at the cancer -associated genomic region (CAGR) 9q21.1–q22.3 locus exhibiting high frequency of Loss of heterozygosity (LOH) in human HNSCC [11]– [15], and a CAGR for which candidate tumor suppressor gene targets have not been identified. [score:3]
The biological processes (BP) and molecular functions (MF) enriched in this network (Figure 3C, ) overlapped with our findings of functional enrichment among 34 predicted miR-204 targets (Figures 2B–C). [score:3]
The miR-204 targets predicted in Figure 2A and filtered by coefficient of variation >0.3 were used for hierarchical clustering. [score:3]
Among the 24 miR-204 targets mapped to the genome-scale PPIN, seven were present in the “prioritized HNSCC PPIN” (Figure 3, shown in red). [score:3]
To assess whether miR-204 could inhibit HNSCC tumor metastasis in vivo, we increased miR-204 function in SQ38 with miR-204 mimics treatments for three days prior to tumor transplantation. [score:3]
Predicted targets of miR-204 in HNSCC are significantly related via their molecular or biological functions. [score:3]
miR-204 suppressed HNSCC cell migration, adhesion and invasion in vitro and lung colonization in vivo. [score:3]
Functional enrichment analysis of miR-204 targets and PPIN using Gene Ontology (Figures 2B–C, Figure 3C, Table 7 in Text S2, Protocol S1/Section C). [score:3]
The intensity ratios of red to green channel of the predicted miR204 targets were retrieved from GSE686 dataset. [score:3]
Here, we provided a plausible mechanism that loss of tumor suppressor function of miR-204 as a result of allelic imbalance at 9q21.1–q22.3 may significantly increases the genetic susceptibility to HNSCC oncogenesis and progression. [score:3]
First, miR-204 is located within the sixth intron of the host gene transient receptor potential melastatin 3 cation channel (TRPM3, NM_020952) and is transcribed in the same direction as TRPM3 [24]. [score:2]
In vitro, ectopic restoration of miR-204 function by miR-204 mimics had no effect on the viability and proliferation of the two cell lines (Supporting Figure 6 in Text S1). [score:1]
GFP-SQ38 cells were treated with miR-204 miRIDIAN mimics or non-specific control mimics for 2 days prior to tumor cell inoculation. [score:1]
To initiate the study, one million of GFP-SQ38 cells transfected with either control mimics or miR-204 mimics were transplanted into athymic mice via tail-vein injection. [score:1]
Control or miR-204 miRIDIAN mimics treated JSQ3 and SQ38 cells were trypsinized and re-suspended in fully supplemented medium. [score:1]
40% confluent JSQ3 and SQ38 cells were transfected with 50–200 nM Control [Cat#110CN-001000-01] or miR-204 miRIDIAN mimics [Cat#110C-300069-02](Dharmacon) using Oligofectamine (Invitrogen). [score:1]
Fourth, the role of miR-204 in human cancer has not been established. [score:1]
Moreover, Ki-67 positive SQ38 cells that received miR-204 mimics treatment were mostly single-cell foci and were in striking contrast to the multi-cell foci observed in the lungs of control mimics treatment group (Figure 4F). [score:1]
Specifically, HNSCC cell lines were seeded at 5×10 [3] cells/well in 96-well plates and let incubated for 24 hours prior to treatment with control or miR-204 miRIDIAN mimics. [score:1]
§: miR-204 and let-7g are located in chromosomal regions with known increased genetic risk of HNSCC (9q21.1–22.1 for miR-204 and 3p21 for let-7g, respectively) [15]. [score:1]
Amplification of predicted miR-204 targeted genes was performed by Sybr Green qPCR assays using custom designed primers. [score:1]
We conducted in vitro miR-204 gain-of-function analyses by transiently transfecting JSQ3 and SQ38 HNSCC cells with mature miR-204 mimics (Dharmacon) to enhance miR-204 function in these two cell lines. [score:1]
Increase miR-204 function by miRIDIAN mimics treatment (Figure 2D and Figure 4). [score:1]
We subsequently measured miR-204 expression in HNSCC tumors and cell lines. [score:1]
miR-204 is located at the genomic imbalanced 9q21.1-22.3 locus associated with genetic predisposition for head and neck cancer. [score:1]
The fold changes of miR-204 expression between normal and tumor tissues or cell lines were calculated using the ΔΔCt method of relative comparison. [score:1]
Increase miR-204 function by miRIDIAN mimics treatment (Figure 2D and Figure 4)40% confluent JSQ3 and SQ38 cells were transfected with 50–200 nM Control [Cat#110CN-001000-01] or miR-204 miRIDIAN mimics [Cat#110C-300069-02](Dharmacon) using Oligofectamine (Invitrogen). [score:1]
In drastic contrast, 50% of animals (7 out of 14) receiving miR-204 mimics treated SQ38 cells failed to develop any lung metastasis (Figure 4D–E and not shown), while the other 50% of animals developed significantly less GFP-SQ38 lung foci at this early three-week time point (P = 0.011 Figure 4E). [score:1]
Definitive demonstration of the role of miR-204 in head and neck progression requires future studies using cohorts of head and neck tumors. [score:1]
[1 to 20 of 93 sentences]
3
[+] score: 372
Other miRNAs from this paper: hsa-mir-211, hsa-mir-200b, hsa-mir-200c, hsa-mir-200a
MiR-204-5p is a negative modulator of TrkB expression in endometrial cancer cellsSeparately, we surveyed the 3′-UTR of the TrkB promoter using three target-prediction algorithms, TargetScan, Pictar and MiRanda, to identify candidate miRNAs which may act as posttranscriptional modulators of TrkB expression. [score:9]
This study uncovers a new regulatory loop involving TrkB/miR-204-5p that is critical to the tumorigenesis of EC and proposes that reestablishment of miR-204-5p expression could be explored as a potential new therapeutic target for this disease. [score:8]
We demonstrate a role for miR-204-5p in endometrial cancer and also shed light on a novel posttranscriptional regulatory circuit in which TrkB induces the activation of STAT3 to regulate the expression of miR-204-5p, which in turn, directly modulates TrkB expression in endometrial cancer cells. [score:8]
The RPKM value of miRNAs in each sample was used to construct the expression profile for hsa-miR-204 and the median of miR-204 expression was used as the cutoff value for high and low expression of miR-204. [score:7]
Generation of stable miR-204-5p expressing Ishikawa [TrkB] cell linesThe lentivirus vector expressing miR-204-5p was prepared using the Lenti-miR-204 miRNA Precursor Expression Construct according to the manufacturer’s protocol (Genechem, Shanghai) (Additional file 4: Figure S4A). [score:7]
Recently, miR-204 has been suggested as a novel predictor of outcome in neuroblastoma, functioning, at least in part, by increasing the sensitivity to cisplatin through direct targeting and downregulation of anti-apoptotic BCL2 and TrkB [48]. [score:7]
Left: In normal cells, a recurrent auto-regulatory circuit involving the expression of TrkB induces phosphorylation of STAT3 to negatively regulate the expression of miR-204-5p. [score:7]
To address whether the phenotypic effects of miR-204-5p expression are predominately due to the suppression of TrkB, rather than one of its other cellular targets, we additionally examined whether miR-204-5p and TrkB functioned in the same pathway in modulating clonogenic growth, migration and invasion of endometrial cancer cells. [score:7]
Furthermore, analysis of the correlation of miR-204 expression and the overall survival (OS) of uterine corpus endometrioid carcinoma (UCEC) patients (n = 279) in an independent dataset from the Cancer Genome Atlas network further showed that though UCEC patients with high mR-204 expression exhibited a higher rate of OS, no significant difference in OS was noted between UCEC patients with high and low mR-204 expression (P > 0.05) (Figure  7H). [score:7]
No obvious activation was found by TrkB overexpression in ERK/MAPK pathway (Figure  3C), and effect of its inhibition (U0126 10 μM) on miR-204-5p expression (Additional file 2: Figure S2A-C). [score:7]
TrkB represses miR-204-5p expression by activating the JAK2/STAT3 pathway in vitroOur microRNA microarray showed that miR-204-5p was downregulated in Ishikawa [TrkB] cells. [score:6]
Overall, this study uncovers a novel regulatory circuitry involving TrkB–STAT3–miR-204-5p that is critical to the tumorigenicity of human endometrial carcinoma and indicates that reestablishing miR-204-5p expression could be explored as a potential new therapy for this disease. [score:6]
These data together suggest that TrkB overexpression upregulates the phosphorylation levels of STAT3, which binds to the STAT -binding sites near the TRPM3 promoter region upstream of miR-204-5p, leading to repression of miR-204 in endometrial cancer cells. [score:6]
In addition, this study provides a comprehensive mechanism in the tumorigenesis of endometrial carcinoma for TrkB in inducing phosphorylation of STAT3 to regulate the expression of miR-204-5p, which, in turn, controls TrkB expression. [score:6]
The TrkB signaling pathway overlaps with the ERK/MAPK or JAK2/STAT3 signaling pathway in myeloma or endometrial cancer cells [20, 21], which prompted us to examine whether TrkB suppressed miR-204-5p expression via these signaling pathways. [score:5]
TrkB is a functionally important target of miR-204-5p involved in the clonogenic growth, migration and invasion of endometrial cancer cells in vitroMiRNAs can target a series of mRNAs representing anywhere from several to hundreds of genes. [score:5]
Effect of MAPK pathway inhibition on miR-204-5p expression. [score:5]
To determine whether miR-204-5p expression affects the in vivo proliferative ability of endometrial carcinoma cells, we examined the expression of two proliferation protein markers ki67 and PCNA by immunohistochemical staining (Figure  6E, last two pairs of panels). [score:5]
MiR-204-5p inhibits the growth of mouse xenografts bearing human endometrial carcinoma cellsWe were interested in whether miR-204-5p suppressed the growth of xenografts bearing human endometrial carcinoma cells. [score:5]
These results indicate that miR-204-5p inhibits the tumorigenicity of endometrial carcinoma cells in vivo and further suggests a tumor-suppressive effect of miR-204-5p via the TrkB/STAT3 pathway. [score:5]
These results further corroborated the microRNA array findings and indicated that TrkB suppresses miR-204-5p expression. [score:5]
Examination of the 76 differentially expressed miRNAs as identified by microarray analysis showed that miR-211-5p and miR-204-5p were the only two candidate miRNAs that were also identified by all three target-prediction algorithms to potentially bind to the 3′-UTR of the TrkB (Figure  2A). [score:5]
Moreover, inhibition of STAT3 by small interference RNA (siRNA) (Figure  3D) elevated the miR-204-5p expression in Ishikawa [TrkB] and HEC-1B cells (P < 0.05) (Figure  3E), indicating that, indeed, TrkB activates the JAK2/STAT3 pathway in endometrial cancer cells. [score:5]
Click here for file Effect of MAPK pathway inhibition on miR-204-5p expression. [score:5]
The finding that miR-204-5p is downregulated in endometrial carcinoma is intriguing, as decreased miR-204-5p levels have been reported in several types of solid tumors [36- 38], and suggests that loss of miR-204-5p may be a common event in tumorigenesis. [score:4]
Our microRNA microarray showed that miR-204-5p was downregulated in Ishikawa [TrkB] cells. [score:4]
To examine whether miR-204-5p modulated TrkB expression, we constructed vectors containing a wildtype or mutant TrkB 3′UTR directly fused downstream of the Firefly luciferase reporter gene (Figure  2B). [score:4]
One candidate miRNA of interest, miR-204-5p, is located at the cancer -associated genomic region 9q21.1–q22.3 locus and is known to be significantly dysregulated in broad tumor types, including breast, prostate, and kidney cancers [17], suggesting a role for miR-204-5p as a tumor suppressor gene. [score:4]
MiR-204-5p expression was normalized against U6B and TRPM3 mRNA expression was normalized against β-actin. [score:4]
These findings indicated that miR-204-5p negatively regulated the expression of TrkB. [score:4]
Furthermore, we present the first direct evidence that reduced expression of miR-204-5p is significantly associated with lymph node metastasis. [score:4]
As expected, TrkB and phospho-STAT3 levels were detectable in the control xenografts; however, the miR-204 expressing tumors had significantly lower levels of these proteins (Figure  6E, first four pairs of panels), thus verifying its role as a negative regulator of the TrkB/STAT3 pathway in vivo. [score:4]
These results establish miR-204-5p as a novel TrkB regulator and a potential therapeutic target for EC. [score:4]
MiR-204 has been previously shown to be greatly downregulated in endometrioid adenocarcinoma tissues by human miRNA microarray [18]. [score:4]
MiR-204 expression was detected by in situ hybridization (second panels), and TrkB, p-STAT3, Ki 67 and PCNA expression was detected by immunohistochemistry (right panels) (magnification, 200×). [score:4]
In endometrial cancer, decreased expression of miR-204 causes dysfunctional regulation of FOXC1, which results in enhanced metastasis and invasion of tumor cells [19]. [score:4]
In this study, we show that reduction of miR-204 correlates with phosphorylation of STAT3, which directly binds to the regulatory sites of its host gene, TRPM3, suggesting a regulatory mechanism for TrkB in controlling miR-204 levels through STAT3 activation. [score:4]
Further examination by qRT-PCR assays revealed that miR-204-5p expression was noticeably suppressed in Ishikawa [TrkB] cells (vs. [score:4]
In contrast, a more recent study showed that miR-204 is upregulated in the serum of endometrial carcinoma patients [42]. [score:4]
TrkB is a functionally important target of miR-204-5p involved in the clonogenic growth, migration and invasion of endometrial cancer cells in vitro. [score:3]
Our results support the possibility that miR-204-5p may constitute a potential biomarker for good prognosis of endometrial cancer, and therapeutic approaches targeting elevated levels of miR-204-5p should be explored as a novel approach to improve the clinical outcomes of endometrial carcinoma patients. [score:3]
We were interested in whether miR-204-5p suppressed the growth of xenografts bearing human endometrial carcinoma cells. [score:3]
These results suggest that TrkB promotes while miR-204-5p suppresses the clonogenic growth of endometrial cancer cells. [score:3]
The expression of miR-204 within this circuit maintains endometrial cells in a normal differentiated state. [score:3]
qRT-PCR results showed that elevated TrkB repressed miR-204-5p expression in EC cells. [score:3]
These results together demonstrate that TrkB increases while miR-204-5p suppresses the clonogenic growth, migration and invasion of endometrial cancer cells in vitro. [score:3]
Furthermore, miR-204 expression by RT-PCR was stratified by FIGO stage (C), histological type (D), grade in type I (E), myometrial invasion (F), and lymph node status (G). [score:3]
Furthermore, HEC-1B [shTrkB] cells transfected with a miR-204-5p inhibitor (miR-204i) had markedly higher TrkB mRNA transcript levels than HEC-1B [shTrkB] cells transfected with scrambled miRNA (P < 0.01) (Figure  2F). [score:3]
MiR-204 also targets forkhead box C1 (FOXC1), which regulates metastasis and invasion in human endometrial cancer-derived HEC-1A cells. [score:3]
Our finding that TrkB may be targeted by miR-204-5p led us to further delineate the actions of miR-204-5p on TrkB in endometrial cancer cells. [score:3]
Figure 4 TrkB promotes while miR-204-5p suppresses the clonogenic growth, migration and invasion of endometrial cancer cells. [score:3]
TrkB promotes while miR-204-5p suppresses the clonogenic growth, migration and invasion of endometrial cancer cells. [score:3]
Figure 3 TrkB represses miR-204-5p expression by activating the JAK2/STAT3 pathway. [score:3]
Furthermore, we chose Ishikawa cells, who do not express TrkB to see if miR-204-5p alone exerted any functional effect on EC cell lines. [score:3]
Our results, therefore, provide evidence for another distinct role of miR-204 in carcinogenesis and further highlight the importance of miR-204 expression in endometrial carcinoma. [score:3]
Together, these results suggest that TrkB is a functionally important downstream target of miR-204-5p that is involved in the clonogenic growth, migration and invasion of endometrial carcinoma cells. [score:3]
Furthermore, the miR-204-5p targeting site within the 3′UTR of TrkB (position 457–464) was highly conserved across five mammalian species (Additional file 1: Figure S1A). [score:3]
Generation of stable miR-204-5p expressing Ishikawa [TrkB] cell lines. [score:3]
Moreover, Spearman correlation analysis showed a strong inverse correlation between the expression of TrkB and miR-204-5p (r = −0.2414, P < 0.05) (Figure  7B). [score:3]
Consistent with the study, we determined that miR-204-5p specifically targets the 3′UTR of TrkB, resulting in a significant reduction of full-length TrkB protein. [score:3]
Importantly, we found lower miR-204-5p expression was associated with advanced FIGO stages, lymph node metastasis and probably a lower chance for survival in EC patients. [score:3]
We provide evidence that miR-204-5p, which acts as a potent tumor growth and metastasis suppressor both in vitro and in vivo, is somatically lost in human endometrial carcinoma. [score:3]
Furthermore, miR-204-5p also inhibited the growth of tumor xenografts bearing human EC cells. [score:3]
However, a statistically significant association was observed between miR-204-5p expression and lymph node metastasis with tumors showing positive lymph node metastasis having markedly lower levels of miR-204-5p (P < 0.05) (Figure  7G). [score:3]
Our results are consistent with the former study in showing that miR-204-5p expression in endometrial carcinoma tissues is significantly lower than that in the normal endometrium. [score:3]
Our results suggest that the TrkB/miR-204 pathway may serve as a novel therapeutic target for endometrial carcinoma, a disease characterized by remarkable lymph node metastasis and dismal prognosis. [score:3]
Our qRT-PCR assays also showed that the mRNA transcript levels of TRPM3, which shares the same regulatory motif for transcription with miR-204 [17], were significantly decreased in Ishikawa [TrkB] cells (P < 0.05), but markedly elevated in HEC-1B [shTrkB] cells (P < 0.01) (Figure  3B), lending support to an inhibitory role of TrkB at the TRPM3/miR-204-5p locus. [score:3]
I tumors and tumors with myometrial invasion, no statistical association was observed between miR-204-5p expression and histological type, tumor grade, or myometrial invasion (P > 0.05) (Figure  7D-F). [score:3]
Figure 5 TrkB is a functionally target of miR-204-5p involved in the clonogenic growth, migration and invasion of endometrial cancer cells. [score:3]
TrkB promotes while miR-204-5p suppresses the clonogenic growth, migration and invasion of endometrial cancer cells in vitro. [score:3]
For transfections, cells were seeded at 2 × 10 [5] cells/well in 6-well plates and after growth overnight were transfected with miR-204i, miR-204 m, miR-204 mimic negative control (miR-204 m NC), or miR-204 inhibitor negative control (miR-204i NC) (all from GenePharma, Shanghai, China) using Lipofectamine [2000] (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:3]
In the absence of sufficient miR-204 tumor suppressor activity, TrkB is left uncontrolled, thereby leading to carcinogenesis. [score:3]
TrkB represses miR-204-5p expression by activating the JAK2/STAT3 pathway in vitro. [score:3]
These intriguing findings suggest that miR-211-5p and miR-204-5p and TrkB are likely mutual modulators of their expression. [score:3]
Click here for file TrkB promotes while miR-204-5p suppresses the clonogenic growth, migration and invasion of endometrial cancer cells. [score:3]
Therefore, the regulation of miR-204 is complex. [score:2]
MiR-204-5p is a negative modulator of TrkB expression in endometrial cancer cells. [score:2]
The characterization of miR-204-5p function, to date, has been limited, although several mRNA targets have been identified that are important in normal cell development, including MEIS1, HOXA9, MEIS2, RUNX2, SIRT1 and Mcl-1 [43- 47]. [score:2]
Figure 8 The TrkB–STAT3–miR-204-5p regulatory circuit in endometrial cancer. [score:2]
Compared to the scrambled control, mouse xenografts bearing Ishikawa [TrkB] cells overexpressing miR-204-5p showed a dramatic reduction in tumor size (P < 0.05) (Figure  6B and C) and tumor weight (P < 0.05) (Figure  6D). [score:2]
MiR-204-5p expression correlates with tumor stage and lymph node metastasis of endometrial cancer patients. [score:2]
MiR-204-5p inhibits the growth of mouse xenografts bearing human endometrial carcinoma cells. [score:2]
MiR-204-5p, in turn, represses TrkB expression. [score:2]
Interestingly, using bioinformatics analysis and luciferase assays, we identified TrkB was a novel target of miR-204-5p. [score:2]
We observed a significantly lower expression of miR-204-5p in endometrial cancer tissues compared with the normal endometrium (P < 0.0001) (Figure  7A). [score:2]
Right: In endometrial cancer cells, this circuit becomes dysregulated due to increased activity of the TrkB–STAT3 component of the circuit, which constitutively represses miR-204-5p. [score:2]
Nevertheless, these data suggest that TrkB -dependent STAT3 activation is an important event in regulating miR-204 transcription in endometrial cancer cells and possibly other cancer types. [score:2]
Figure 7 MiR-204-5p expression correlates with tumor stage and lymph node metastasis of endometrial cancer patients. [score:2]
MiR-204-5p has been reported to act as a tumor suppressor in a variety of cancers through different mechanisms. [score:2]
TrkB promotes while miR-204-5p suppresses the clonogenic growth, migration and invasion of endometrial cancer cells in vitroTo investigate whether miR-204-5p modulated the growth of endometrial cancer cells, we transfected Ishikawa [TrkB] cells with miR-204 m or its scrambled control and HEC-1B [shTrkB] cells with miR-204i or its scrambled control. [score:1]
We further examined whether phospho-STAT3 could bind to three putative STAT -binding sites that are located near the TRPM3 promoter region upstream of miR-204-5p[22] (Figure  3F). [score:1]
However, it will be of interest to also determine the potential functional contribution of miR-200 within the TrkB-STAT3-miR-204-5p axis. [score:1]
Stable Ishikawa [TrkB] cells containing the lentivirus vector carrying miR-204 or scramble hairpin control (Genechem) were established after selection with appropriate antibiotics. [score:1]
For in situ hybridization, sections of mouse xenografts were dewaxed and rehydrated, followed by digestion with proteinase K. A 5′ digoxin-labeled locked nucleic acid -modified miR-204-5p probe (Ambion Life Technologies,) was incubated on coverslips at 37°C overnight. [score:1]
The wildtype or mutant vector was co -transfected into 293 T cells with miR-204-5p mimic (miR-204 m) or its scrambled control (miR-204 m NC). [score:1]
Click here for file Predicted miR-204 binding site in the TrkB 3′UTR. [score:1]
The ki67 proliferation index of the NC group [(92.80 ± 3.24)%] was markedly greater than that of the miR-204-5p group [(52.76 ± 9.62)%; P < 0.05]. [score:1]
Whether TRPM3 and miR-204 could cooperate with each other in the pathogenesis of human endometrial carcinoma remains unknown but is an intriguing and biologically important question. [score:1]
Right panel: 293 T cells were co -transfected with pMIRGLO-TrkB-3′UTR-WT or pMIRGLO-TrkB-3′UTR-MT and miR-204-5p mimic (miR-204 m) or scrambled miRNA control (miR204m NC). [score:1]
MiR-204-5p is reportedly dysregulated in endometrial carcinoma [18, 19]. [score:1]
We abolished miR-204-5p activity by transfecting Ishikawa cells with miR-204i. [score:1]
also showed that Ishikawa [TrkB] cells transfected with miR-204 m had markedly reduced TrkB levels (P < 0.05) (Figure  2D and E). [score:1]
Moreover, ChIP assays showed that phospho-STAT3 could directly bind to STAT3 -binding sites near the TRPM3 promoter region upstream of miR-204-5p. [score:1]
In silico analysis of miR-204 and OS of UCEC patients. [score:1]
We further assessed whether miR-204-5p modulated the migratory and invasive capacity of endometrial cancer cells. [score:1]
Functionally, the MTT assays, clonogenic and Transwell assays showed that miR-204-5p significantly suppressed the clonogenic growth, migration and invasion of EC cells. [score:1]
In silico analysis of miR-204 and OS of UCEC patientsWe performed an in silico analysis of the association between miR-204 and OS of UCEC patients using published data from the Cancer Genome Atlas network [56] (Additional file 5). [score:1]
Treatment with miR-204 m, however, significantly attenuated the growth of Ishikawa [TrkB] cells (vs. [score:1]
For xenograft experiments, sixteen 5-week old female BALB/c nude mice (Chinese Academy of Sciences, Shanghai, China) were injected subcutaneously with 5 × 10 [6] Ishikawa [TrkB] miRNA NC and Ishikawa [TrkB] miR-204 cells, respectively, in the nape. [score:1]
Structure of the miR-204 plasmid and the proliferation index in xenograft tumor tissues. [score:1]
We transfected Ishikawa [TrkB] cells with miR-204-5p precursor or its scrambled control using lentiviruses (Figure  6A, Additional file 4: Figure S4A). [score:1]
Though miR-204-5p levels were lower in type II vs. [score:1]
The current study identifies a novel TrkB–STAT3–miR-204-5p signaling axis that plays an important role in endometrial carcinoma growth through the accumulation of the key tumor oncogene TrkB (Figure  8). [score:1]
Consistently, the PCNA proliferation index of the NC group [(91.30 ± 6.75)%] was significantly higher than that of the miR-204-5p group [(20.60 ± 11.46)%; P < 0.05], (Additional file 4: Figure S4B). [score:1]
We performed an in silico analysis of the association between miR-204 and OS of UCEC patients using published data from the Cancer Genome Atlas network [56] (Additional file 5). [score:1]
Click here for file Structure of the miR-204 plasmid and the proliferation index in xenograft tumor tissues. [score:1]
Predicted miR-204 binding site in the TrkB 3′UTR. [score:1]
[1 to 20 of 117 sentences]
4
[+] score: 332
Because it is generally accepted that miRNAs exert their function by inhibiting the expression of their target genes, miR-204-5p may execute its tumor-suppressive function by downregulating targets that normally have tumor-promoting functions. [score:14]
In the present study, we showed that downregulation of miR-204-5p in human gliomas is correlated with poor patient prognosis, and overexpression of miR-204-5p can inhibit the proliferation, migration and invasion of glioma cells in vitro and in vivo. [score:8]
In this study, our data affirmed that ectopic expression of miR-204-5p inhibited the growth of glioma cells, suggesting that the downregulation of miR-204-5p may be responsible for the enhanced growth of glioma cells. [score:8]
Overexpression of miR-204-5p is able to suppress glioma cell growth and metastasis through directly targeting RAB22A. [score:8]
To delineate the mechanism by which miR-204-5p inhibited cell proliferation, invasion and migration in glioma cells, miR-204-5p target genes were searched using the TargetScan (http://www. [score:7]
Overexpression of miR-204-5p inhibits growth of glioma cells in vitro To further explore its biological roles in glioma, miR-204-5p overexpression lentiviral vector (Lv-miR-204-5p), lentiviral empty vector (LEV) or negative control miRNA (miR-NC) were transfected into human glioma LN229 and U87 cells. [score:7]
As shown in S1 Table, low expression levels of miR-204-5p glioma contained comparatively high RAB22A expression than those in high miR-204-5p expression specimens. [score:7]
In the subsequent mechanistic study, we demonstrated that miR-204-5p directly targets RAB22A to inhibit proliferation, migration and invasion in glioma cells. [score:6]
In summary, our study demonstrated that the expression of miR-204-5p is significantly downregulated in clinical glioma tissues. [score:6]
miR-204-5p directly inhibits expression of RAB22A via its 3′-UTR. [score:6]
Taken together, these results imply that miR-204-5p exerts tumor-suppressive function in glioma cells via directly targeting RAB22A. [score:6]
B, Stably upregulating miR-204-5p reduced in vitro invasiveness of LN229 and U87 cells, and specific inhibition of miR-204-5p in Lv-miR-204-5p cells rescued the invasion ability. [score:6]
The results revealed that miR-204-5p could inhibit the expression of the reporter gene in recombinant plasmids containing the 3′UTRs of RAB22A, BCL2 and CCPG1, particularly RAB22A (S2 Fig). [score:5]
Overexpression of miR-204-5p inhibits growth of glioma cells in vitro. [score:5]
Furthermore, Lv-miR-204-5p/inhibitor cells, LEV cells, miR-204-5p inhibitor cells and NC cells were cultured in transwell and Boyden chamber, respectively. [score:5]
A significant difference in expression level of miR-204-5p was observed between the miR-204-5p inhibitors group and the negative control (NC) group by RT–qPCR. [score:5]
Together, these data suggest that miR-204-5p inhibits glioma cells growth by inhibiting cell metastasis. [score:5]
MiR-204-5p suppresses tumorigenicity of glioma cells in vivo Having established that miR-204-5p inhibits glioma cells proliferation and invasion in vitro, we evaluated the growth inhibitory effect of miR-204-5p in vivo by using experimental intracranial mo dels. [score:5]
For example, miR-204 inhibited tumor growth in renal clear cell carcinoma [53], suppressed invasion in endometrial cancer [54], gastric cancer [55], and head and neck tumor [56]. [score:5]
To further determine the correlation between miR-204-5p and RAB22A expression, we analyzed expression levels of miR-204-5p and RAB22A in human GBM tissue specimens by qRT-PCR. [score:5]
A, Stably upregulating miR-204-5p reduced the migration ability of LN229 and U87 cells in vitro, and knockdown of miR-204-5p in Lv-miR-204-5p cells rescued the migration ability. [score:5]
Dosage effect of miR-204-5p overexpression and the function of knockdown miR-204-5p in glioma LN229 and U87 cells. [score:4]
To identify the roles of miR-204-5p in the development of gliomas, we analyzed the expression level of miR-204-5p in 35 snap-frozen glioma tissues and 10 normal brain tissues by quantitative real-time PCR (qRT–PCR). [score:4]
MiR-204-5p expression inhibits migratory and invasive ability in glioma cells. [score:4]
Downregulation of miR-204-5p is correlated with the progression of primary gliomas. [score:4]
Based on the presence of miR-204-5p sites in their 3′-untranslated region (3′-UTR), >100 messenger RNAs (mRNAs) were predicted to be regulated by miR-204-5p. [score:4]
Further mechanistic investigations revealed that miR-204-5p inhibits gliomas cell growth, migration and invasion by directly targeting RAB22A (a member of the RAS oncogene family), which appears to be a new prognostic factor in gliomas. [score:4]
Several studies have also shown that miR-204-5p is frequently downregulated in papillary thyroid carcinoma, gastric cancer, colorectal cancer and endometrial carcinoma, suggesting a common role of miR-204-5p in human tumorigenesis [27– 30]. [score:4]
miR-204-5p is downregulated in glioma tissues. [score:4]
Role of miR-204-5p in tumorigenesis via directly targeting RAB22A. [score:4]
Therefore, miR-204-5p may be considered to be a tumor suppressor and has significant value as an unfavorable progression indicator for glioma patients, and may serve as a therapeutic target in the future. [score:4]
No significant difference was observed between miR-204-5p inhibitor and NC groups (S1 Fig). [score:3]
Site-directed mutagenesis of the miR-204-5p binding site in RAB22A, BCL2, CCPG1 or KLF12 3′-UTR were performed using GeneTailor Site-Directed Mutagenesis System (Invitrogen, Guangzhou, China; named mt). [score:3]
Furthermore, in situ hybridization assay demonstrated miR-204-5p expression was significantly suppressed in glioma tissues compared with normal brain tissues. [score:3]
MiR-204-5p directly targets to the RAB22A 3′UTR. [score:3]
Screening for candidate target genes of miR-204-5p in glioma. [score:3]
miR-204-5p inhibits glioma cell growth in vitro. [score:3]
These results demonstrated that miR-204-5p could exert a significant inhibitory effect on growth of glioma cells in vitro. [score:3]
Reintroduction of miR-204-5p suppresses glioma tumorigenesis in vivo. [score:3]
A gradually reduced miR-204-5p expression was found from grade II to grade IV samples (Fig 1B). [score:3]
For the highly proliferative LN229 cells, results from luminescence images revealed a high degree of suppression on the growth of Lv-miR-204-5p-LN229 cells in contrast to the larger intracranial tumor formed by the control cells at day 15 after implantation. [score:3]
miR-204-5p inhibits migration and invasion of glioma cells in vitro. [score:3]
0132399.g006 Fig 6Reintroduction of miR-204-5p suppresses glioma tumorigenesis in vivo. [score:3]
In addition, miR-204 could affect chemoresistance in neuroblastoma and gastric cancer cells by targeting BCL2 [54, 57]. [score:3]
Moreover, miR-204-5p inhibitors were transient transfected into LN229 and U87 cells. [score:3]
Likewise, RAB22A overexpression could restore miR-204-5p -mediated reduction of growth, migration and invasion (Fig 5B–5D). [score:3]
Establishment of glioma cell lines with stable expression of miR-204-5p. [score:3]
When the mice intracranially transplanted with Lv-miR-204-5p-LN229 that stably express luciferase and miR-204-5p, or control lentiviral empty vector (LEV), bioluminescence imaging was done for the whole body. [score:3]
These results demonstrated that miR-204-5p could exert a significant inhibitory effect on tumorigenesis of glioma cells in vivo. [score:3]
RAB22A, BCL2, CCPG1 and KLF12 were predicted to be possible target of miR-204-5p by RNAhybrid (The BiBiServ, Bielefeld, Germany) and miRwalk software (University of Hei delberg, Mannheim, Germany). [score:3]
C and D, The effect of miR-204-5p on the endogenous expression levels of RAB22A was examined in LN229 and U87 cells by qRT–PCR (C) and Western blot (D) analysis. [score:3]
These results suggest that miR-204-5p may function as a suppressor in gliomas. [score:3]
miR-204-5p has been reported to function as a tumor suppressor in a variety of human cancers through different mechanisms, suggesting its extensive function in tumorigenesis. [score:3]
The protein levels of RAB22A (Santa Cruz, CA) were determined by in LN229 and U87 cells transfected with miR-204-5p mimic, miR-204-5p inhibitor, or the corresponding negative control (NC). [score:3]
We further found that miR-204-5p expression was negatively correlated with tumor grading. [score:3]
However, there was no significant difference in results between miR-204-5p inhibitor group and NC control group (S1 Fig). [score:3]
The miR-204-5p mimics, miR-204-5p inhibitor oligonucleotides and their corresponding negative control (miR-NC and anti-NC) were synthesized at Ribo Biotech (Guangzhou, China). [score:3]
glioma xenografts stably expressing firefly luciferase together with miR-204 or the corresponding control vector were orthotopically implanted in the brains of nude mice. [score:3]
In miR-204-5p–transfected cells, ectopic RAB22A expression can rescue the proliferation, migration and invasion ability attenuated by miR-204-5p. [score:3]
B, LN229 and U87 cells were transfected with miR-204-5p inhibitors or negative control miRNA (NC), the levels of miR-204-5p were detected by qRT-PCR. [score:3]
The correlation between miR-204-5p and RAB22A expression in glioma samples. [score:3]
To further explore its biological roles in glioma, miR-204-5p overexpression lentiviral vector (Lv-miR-204-5p), lentiviral empty vector (LEV) or negative control miRNA (miR-NC) were transfected into human glioma LN229 and U87 cells. [score:3]
Lentiviral vectors which overexpress miR-204-5p were purchased from GeneChem (Shanghai, China). [score:3]
miR-204-5p represses glioma cells proliferative, migration and invasion by targeting RAB22A. [score:3]
Compared with normal brain tissues, significant downregulation of miR-204-5p was observed in glioma tissues (Fig 1A). [score:3]
Having established that miR-204-5p inhibits glioma cells proliferation and invasion in vitro, we evaluated the growth inhibitory effect of miR-204-5p in vivo by using experimental intracranial mo dels. [score:3]
Overexpression of miR-204-5p significantly decreased both the RAB22A mRNA and protein levels compared with LEV cells (Fig 4C and 4D). [score:2]
B, In situ hybridization assay showing the expression level of miR-204-5p in normal brain tissues and glioma tissues. [score:2]
Luciferase reporter assays were then conducted to determine the influence of miR-204-5p on the expression of these 4 genes. [score:2]
As shown in Fig 2A, more than 200-fold increase in miR-204-5p expression was observed in Lv-miR-204-5p-LN229 cells and Lv-miR-204-5p-U87 cells compared with the LEV group by qRT–PCR. [score:2]
A, More than 200-fold increase in the expression of miR-204-5p was observed in Lv-miR-204-5p-LN229 cells and Lv-miR-204-5p-U87 cells compared to the LEV group by qRT-PCR. [score:2]
Furthermore, EdU incorporation assays showed that the proliferation of Lv-miR-204-5p-LN229 and U87 cells were significantly inhibited by Lv-miR-204-5p relative to LEV (Fig 2C). [score:2]
In this study, we found that expression of miR-204-5p was decreased in glioma tissues compared with normal brain tissues. [score:2]
Li and colleagues performed preliminary luciferase reporter assay to validate the targeting of miR-204-5p to the 3′UTRs of RAB22A under stress conditions in human trabecular meshwork cells [58]. [score:2]
MiR-204-5p suppresses tumorigenicity of glioma cells in vivo. [score:2]
However, a significant increase of cell invasion and migration was found in Lv-miR-204-5p/inhibitor group compared with the Lv-miR-204-5p group (Fig 3A and 3B). [score:2]
Ectopic miR-204-5p expression blocked proliferation of glioma cells in colony formation assays (Fig 2D). [score:2]
For reporter assays, wt or mt vector and the control vector psiCHECK-2 vector were cotransfected into LN229 cells with miR-204-5p mimics or inhibitors in 48-well plates, and then harvested for luciferase assay 48 h after transfection. [score:1]
Our data provide new insights into the molecular function of miR-204-5p in gliomas. [score:1]
As shown in Fig 6A, Lv-miR-204-5p-LN229 cell lines exhibited significantly slower growth after implantation. [score:1]
Kaplan-Meier survival analysis demonstrated that miR-204-5p significantly prolonged survival of glioma in mice. [score:1]
We subcloned 3′-UTR region of RAB22A mRNA including the predicted miR-204-5p recognition site (wild type) or the mutated sequence (mutant type) into luciferase reporter plasmids. [score:1]
In vivo, miR-204-5p transfected LN229 cells displayed a marked reduction of the tumor. [score:1]
Overexpression of miR-204-5p resulted in a significant decrease in viability compared with LEV group both in LN229 and U87 cells in an 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay (Fig 2B). [score:1]
The relative expression ratio of miR-204-5p was calculated by the 2 [−ΔΔCT] method. [score:1]
In addition, the miR-204-5p cotransfection at concentrations of 0, 1, 3 and 10.0 nM showed that the levels of miR-204-5p gradually increased with the increase of miR-204-5p mimics concentrations (S1 Fig). [score:1]
D, In vitro proliferative ability of glioma cells was significantly decreased in overexpressed miR-204-5p cells compared with LEV cells by colony formation assay. [score:1]
A, Decreased levels of miR-204-5p were positively correlated with the status of pathology classification by qRT–PCR). [score:1]
Our results showed that the reporter plasmid with 3′-UTR of RAB22A resulted in a significant decrease in luciferase activity after transfection with miR-204-5p mimic, whereas the plasmid without RAB22A 3′-UTR had no change in luciferase activity (Fig 4A and 4B). [score:1]
In addition, to examine the effect of miR-204-5p on cell invasiveness, Lv-miR-204-5p and LEV cells were cultured in a Boyden chamber. [score:1]
However, the roles of miR-204-5p in glioma remain undefined. [score:1]
For miR-204-5p detection, reverse-transcribed complementary DNA was synthesized with the PrimeScript RT reagent Kit (TaKaRa, Dalian, China), and quantitative real time–PCR (qRT–PCR) was performed with SYBR Premix ExTaq (TaKaRa, Dalian, China) with the Stratagene Mx3000P real-time PCR system (Agilent Technologies, Inc. [score:1]
In the current study, we focused on miR-204-5p. [score:1]
To further investigate whether miR-204-5p mediated the expression of RAB22A in glioma cells. [score:1]
As a result of our present study, we have made clear that reintroduction of miR-204-5p dramatically repressed the migration and invasion of glioma cells. [score:1]
Furthermore, Ki-67 staining showed that tumors of Lv-miR-204-5p cells had fewer proliferative cells than LEV transfected tumor cells (Fig 6C). [score:1]
Taken together, miR-204-5p may play an important functional role in decreasing the ability of neoplastic cells to grow and invade tissue in glioma. [score:1]
To examine the effect of miR-204-5p on cell migration, using a transwell chamber, we determined changes in cell migration after 6h of incubation. [score:1]
C, Effect of miR-204-5p inhibitors on LN229 and U87 cell growth was measured by. [score:1]
0132399.g001 Fig 1A, Decreased levels of miR-204-5p were positively correlated with the status of pathology classification by qRT–PCR). [score:1]
B, Survival curves of mice (seven mice per group) with brain glioma xenograft formed by Lv-miR-204-5p-LN229 or LEV-LN229 cells. [score:1]
Subsequently, mRNA and protein levels of RAB22A in Lv-miR-204-5p -treated cells were detected using qRT–PCR and Western blot. [score:1]
D, Effect of specific knockdown of miR-204-5p on LN229 and U87 migration and invasion was detected by Transwell and Boyden chamber assay. [score:1]
However, the role of miR-204-5p in glioma was not well known. [score:1]
Total RNA from these cell clones was isolated, and levels of miR-204-5p were quantified using qRT–PCR. [score:1]
We also observed that reduced levels of miR-204-5p in glioma patients were positively correlated with the status of pathology classification (WHO II vs WHO IV; p<0.01). [score:1]
A, Sequence alignment between miR-204-5p and the 3′-UTR of human RAB22A mRNA. [score:1]
0132399.g004 Fig 4A, Sequence alignment between miR-204-5p and the 3′-UTR of human RAB22A mRNA. [score:1]
[1 to 20 of 108 sentences]
5
[+] score: 326
Despite we observed a different kinetics in the GTL-16 as opposed to the HUCCT1 cells transfected with the mimic-204 molecule, in both cases we witnessed effective downregulation of the gene targets, compatible with a reversal of the miR-204 dependent gene expression (Figure 6A, left and right panels, respectively) (p < 0.05 at 72hrs). [score:8]
In facts, it is not very common that unrelated tumors exhibit a high degree of similarity in their gene expression profile and this may further suggest a relevant effect of the miR-204 downregulation on the progression of the diseases. [score:8]
Our study hypothesis was that the deep downregulation of the miR-204 in tumor tissues may underlie a very relevant event in the progression of the disease, possibly by triggering gene expression changes, impinging on key protumorigenic properties of the transformed cells. [score:8]
This revealed that the miR-204 was downregulated in 103 colon tumor tissues as compared to normal colon mucosa (Supplementary Figure 4A); we also observed that the microRNA-204 was deeply downregulated in 12 esophageal cancer tissues vs its normal counterpart (Supplementary Figure 4B) and, finally, albeit with less statistical strength, we found reduced miR-204 expression in 49 hepatic carcinoma tissues (Supplementary Figure 4C). [score:8]
Downregulation of the single miR-204 targets recapitulates the biological effects of miR-204 expression. [score:8]
Staining of the cells with propidium iodide at 72h following siRNA transfection revealed that downregulation of each miR-204 target affected to a varying degree the cell cycle of the transfected cells, compatible with the different biological activities of each of the targets. [score:8]
On the other hand, when we transfected GTL-16 and HUCCT1 cells, stably expressing miR-204 with a miR-204 antagomiR molecule (and a control molecule), we witnessed upregulation of 6 out of the 7 miR-204 targets (Supplementary Figure 8). [score:8]
Overexpression of the miR-204 agonist led to time -dependent, decreased expression of the levels of all 7 representative gene targets (Figure 5A, left and right panels). [score:7]
As microRNAs work mainly by targeting the expression of multiple mRNAs through base paired interactions within their 3′-UTR region, we set out to determine the targets of miR-204 in the tumor tissues analyzed. [score:7]
Principal component analysis (PCA) performed on the gene expression levels of the 37 genes in both our discovery set and in the TGCA samples revealed that the expression levels of the microRNA-204 targets could effectively discriminate between tumor and normal samples (Figure 1E, left panel) and between tumor and normal tissue (Figure 1F, right panel), respectively. [score:7]
Thus, targeting of the single targets did not fully mimic the effect of miR-204 expression. [score:7]
Hepatic cholangiocarcinomas exhibited deep miR-204 downregulation and high levels of its target gene signature. [score:6]
The analysis of samples in our cohort also showed that the degree of downregulation of the miR-204 and of some of its targets (SHCBP1, CENPA, RAD51) was higher in the intrahepatic cholangiocarcinoma samples as opposed to the extrahepatic ones (Supplementary Figure 5A). [score:6]
On this line, we found here that the intestinal type of gastric tumors in the TGCA cohorts exhibited a deeper miR-204 downregulation and, consequently, higher levels of its gene target signature. [score:6]
This correlated with a deeper downregulation of miR-204 in the “intestinal” histotype (Supplementary Figure 1A), and with higher levels of its representative candidate targets (Table 5 and Supplementary Figure 5, respectively). [score:6]
In order to assess whether the miR-204 downregulation and its consequent alteration of gene transcription would be a gastric cancer specific lesion, we analyzed the levels of expression of miR-204 in matched tissues from other tumors of the digestive system, by employing the TCGA database. [score:6]
Restoring miR-204 level in GC and CC cell lines impinged on the expression of common gene targets. [score:5]
Unsupervised hierarchical clustering of the levels of 37 genes targets anti-correlated with miR-204 expression and which contained a miR-204 seed sequence in 3′UTR region (see Table 1) in both the discovery set C. and in the TGCA dataset. [score:5]
However, it remains to be addressed whether reduced expression of miR-204 would be observed in PSC tissues rather than in patient sera and whether expression of miR-204 may represent a biomarker of progression to CC. [score:5]
A. Heat map depicting the expression levels of the indicated miR-204 targets in the GTL-16 and HUCCT1 cell lines transfected with 10 nM of control (ctrl) or mimic-204 and harvested at 24hr, 48hr and 72hr. [score:5]
For the Inhibition experiments GTL-16 and HUCCT1 stable expressing miR 204 were transfected with antagomiR of miR-204-5p and antagomiR-NC (THERMO FISHER, MA, USA) according to the manufacturer's instructions. [score:5]
D. Expression levels of representative miR-204 target genes as assessed by quantitative PCR from freshly frozen tumor vs normal tissues (n = 26). [score:5]
Figure 5 A. Heat map depicting the expression levels of the indicated miR-204 targets in the GTL-16 and HUCCT1 cell lines transfected with 10 nM of control (ctrl) or mimic-204 and harvested at 24hr, 48hr and 72hr. [score:5]
Tumor-expressed miR-204 targets may have prognostic potential. [score:5]
Unsupervised hierarchical clustering of the expression levels of 36 putative miR-204 gene targets (see table 1 please). [score:5]
Overall survival calculated on patients bearing intestinal (left panel) or diffuse (right panel) GC histotype, according to the gene set shown in Supplementary Table 1. In order to assess whether the miR-204 downregulation and its consequent alteration of gene transcription would be a gastric cancer specific lesion, we analyzed the levels of expression of miR-204 in matched tissues from other tumors of the digestive system, by employing the TCGA database. [score:4]
In this experimental work we have detailed the modulation of microRNA-204 in both gastric carcinoma and cholangiocarcinoma samples, which exhibited common downregulation of this microRNA in the tumor tissues as opposed to normal tissues. [score:4]
Clonogenic assays revealed that silencing of each of the target caused a reduction in colony formation, thus fully matching what observed when ectopically expressing the miR-204 (Figure 6C-6D). [score:4]
MiR-204 and its target gene signature are differentially expressed in cholangiocarcinoma tissues. [score:4]
Next, we set out to better understand the contribution of miR-204 downregulation to the progression of GC. [score:4]
We have also shown that altering the miR-204 levels in both gastric carcinoma and cholangiocarcinoma cells changed the levels of the miRNA-204 targets genes in a direction compatible with a reversal of the miR-204 -dependent effect. [score:4]
We found that the miR-204 levels, deeply downregulated in cholangiocarcinomas as opposed to normal tissues, correlated with a gene signature almost identical to that observed in gastric cancer specimens. [score:4]
We recently found that miR-204 was deeply downregulated in gastric cancer tissues. [score:4]
Of note, we also found that a deeper downregulation of the miR-204 levels was a feature of the “intestinal” histotype as opposed to the “diffuse” histotype of gastric cancer (Supplementary Figure 1A). [score:4]
Notably, no upregulated miR-204 was observed by Bernuzzi et al. both in the PSC and the CC patient sera. [score:4]
Analysis of the distribution of the miR-204 levels and those of its putative target genes revealed similar relationship in both gastric cancer and cholangiocarcinoma samples. [score:3]
We extended the analysis of the levels of the whole set of the previously identified miR-204 targets on the 45 CC samples from TGCA database. [score:3]
Altogether, these observations suggested that increasing the miR-204 intracellular levels triggered effects on the cell cycle and clonogenic ability of the cells which could be partially recapitulated by silencing each of the single miR-204 targets. [score:3]
Next, we assessed whether manipulating the levels of the miR-204 gene targets in the GTL-16 and HUCCT1 cells, by means of transfecting mimic-204, could affect some of their protumorigenic properties. [score:3]
We showed that manipulating the levels of miR-204 (by means of agonist molecules) in representative GC and CC cell lines, led to a reversal of the identified gene target signature. [score:3]
C. Expression levels of miR-204 in a validation set obtained from the TGCA database (n = 45). [score:3]
Interference of single miR-204 target genes affects cell cycle and clonogenicity. [score:3]
Last but not least, exogenously added miR-204 affected the cell cycle progression and inhibited the clonogenicity of the transfected cells. [score:3]
We identified a novel miR-204 gene target signature perturbed in gastric cancer and in cholangiocarcinoma specimens. [score:3]
Analysis of the miR-204 expression in 45 cholangiocarcinoma specimens from the TCGA database (Table 2) confirmed our observation (Figure 3C). [score:3]
Expression level of miR-204 in a discovery set of tumor (n = 15) and normal (n = 5) gastric tissues. [score:3]
Here we partially addressed the specific contribution of each miR-204 gene target to the cell cycle progression and clonogenicity of the GTL-16 and HUCCT1 cells. [score:3]
The miR-204 target gene signature is enriched in cholangiocarcinoma tissues. [score:3]
Putative miR-204 gene targets selected according to the criteria described in the text. [score:3]
B. Gene Ontology of the 7 miR-204 target genes. [score:3]
This affected the clonogenicity and cell cycle progression of the transfected cell lines, thus establishing a mechanistic link between the modulation of miR-204 targets and the protumorigenic properties of the tumor cells. [score:3]
This revealed a high degree of similarity about the modulation of miR-204 and the perturbation of its target genes among three unrelated tumors of the digestive system. [score:3]
To do this, we aimed at identifying mRNAs whose expression anti-correlated with that of the microRNA-204 and which contained a microRNA-204 seed sequence in their 3′-UTR region by means of an Affymetrix -based profiling in our discovery set as assessed in Figure 1A (Table 1) (Figure 1C). [score:3]
In a previous study we profiled microRNA differentially expressed in gastric cancer vs matched normal tissue specimens and miR-204 was among those differentially modulated in a cohort of 123 matched tissues [14]. [score:3]
OZ-ratio and p-value of each miR-204 target gene with regard to the tumor histotype (intestinal vs diffuse). [score:3]
However, little is known about the miR-204 gene targets in various tumors and, more, whether perturbation of miR-204 -dependent gene signatures may contribute to tumor progression. [score:3]
tA subgroup of mir-204 gene targets predicted overall survival of GC patients carrying the intestinal GC histotype. [score:3]
More in detail, while silencing of SHCBP1, RAD51, NOTCH1 and FOXM1 significantly increased the cells in the sub-G1 phase, all of the tested miR-204 targets (except for KIF15) affected the clonogenicity of the transfected cell lines. [score:3]
For mature miR-204-5p expression, we used Pre-miRNA Precursor-Negative Control (THERMO FISHER, MA, USA) and Pre-miRNA204-5p (THERMO FISHER, MA, USA) at final concentration of 10nM, 4nM 2,5nM. [score:3]
MiR-204 is downregulated in GI tumors. [score:3]
Restoring miR-204 levels in gastric and cholangiocarcinoma cancer cells affects the target signature and some protumorigenic properties of the GTL-16 and HUCCT1 cells. [score:3]
We have identified, in silico, a 37-gene target signature whose levels anti-correlated with those of the miR-204 and shown that 20 out of 37 genes exhibited prognostic potential in GC, with some of the genes of the signature exhibiting independent prognostic potential, in Kaplan-Meier analysis. [score:3]
These results are compatible with the previously mentioned involvement of most of the miR-204 candidate targets in the cell cycle control. [score:3]
A. Gene Ontology of the 37 miR-204 target genes. [score:3]
In silico analysis aided us to identifying a miR-204 target signature in publicly available databases (TGCA). [score:3]
B. Expression levels of miR204 in a validation set of 264 tumoral and 38 normal gastric sample tissues from the TGCA database. [score:3]
Figure 3 A. - C. Expression levels of miR-204 in a discovery set of 26 freshly frozen A. and 19 FPPE B. cholangiocarcinoma samples as compared to matched normal biliary duct tissues (for the extra-hepatic cholangiocarcinoma) or to hepatic, non tumoral tissues (for the intra-hepatic cholangiocarcinoma), as assessed by quantitative RT-PCR. [score:2]
We first aimed at deeply characterize the expression of miR-204 in a sizable cohort of gastric cancer specimens (as compared to normal tissues) to identify, by combining transcription profiling and extensive in silico analysis, the potential targets of this microRNA. [score:2]
The miR-204 is a well-characterized microRNA, already shown to be downregulated in many solid tumors [15, 18, 19]. [score:2]
A. - C. Expression levels of miR-204 in a discovery set of 26 freshly frozen A. and 19 FPPE B. cholangiocarcinoma samples as compared to matched normal biliary duct tissues (for the extra-hepatic cholangiocarcinoma) or to hepatic, non tumoral tissues (for the intra-hepatic cholangiocarcinoma), as assessed by quantitative RT-PCR. [score:2]
This strategy revealed that the clonogenicity of the both cell lines was affected upon overexpression of the miR-204 mimic molecule as compared to the control -transfected cells (Figure 5D). [score:2]
Next, we observed that miR-204 down regulation was a rather general feature of other tumors of the digestive system, also including colon, esophageal cancer and hepatocellular carcinoma, which all exhibited a similar degree of miR-204 perturbation. [score:2]
We transfected both cell lines with a control (ctrl) or a mimic-204 molecule (mimic-204) and transfection of the latter led to a dose dependent increase of the intracellular levels of the miR-204 (Supplementary Figure 7A). [score:1]
As such, miR-204 levels may be diagnostically and prognostically relevant. [score:1]
Representative histograms showing the DNA content of GTL-16 (left panel) and HUCCT-1 cells (right panel) stained with propidium iodide at 72 hours after transfection with a control- or the miR-204 agonist. [score:1]
We suggest that restoring the physiological levels of miR-204 in some gastrointestinal cancers might be exploited therapeutically. [score:1]
Altering the miR-204 levels affects clonogenicity. [score:1]
Taking the start from our previous observations, we here evaluated the expression of the miR-204 in a series of tumors of the digestive system and we mechanistically dissected its contribution to tumor progression. [score:1]
However, to detail the mechanism of action of the mimic-204, we aimed to investigate which of the miR-204 target gene(s) could mostly influence the miR-204 phenotype. [score:1]
Notably, 36 out of the identified 37 genes were identically modulated in gastric cancer, cholangiocarcinoma and esophageal cancers tissues as well, thus highlighting the potential relevance of the low levels of the miR-204 observed in GI tumors types. [score:1]
To deepen those previous findings, we specifically evaluated the expression of microRNA-204 in a novel discovery set of 20 frozen gastric specimens (15 tumor and 5 normal gastric mucosa) (Table 1), by quantitative PCR (Figure 1A). [score:1]
The obtained signature was first validated in The Cancer Genome Atlas (TCGA) gastric adenocarcinoma and TCGA cholangiocarcinoma dataset, and only genes anti-correlated to miR-204 were selected. [score:1]
The microRNA-204 (miR-204) was among the differentially modulated microRNAs and a component of a prognostically relevant signature [14]. [score:1]
In fact, our and others published work indicate that miR-204 may play a role in determining chemoresistance, at least partially through the modulation of the anti-apoptotic BCL2 protein, in gastric [14] and breast cancer cells [32]. [score:1]
Representative micrographs of colonies formed by the GTL-16 and HUCCT1 cells transfected with a control (ctrl) or a miR-204 agonist molecule (mimic-204) for 96hrs before seeding at clonal density. [score:1]
Again, we observed similar modulation of the miR-204 in the validation set (Figure 1B). [score:1]
In order to investigate a causal relationship between the lower levels of the miR-204 and the higher levels of its anti-correlated targets, we manipulated the levels of the miR-204 in two representative GC and CC cell lines (GTL-16 and HUCCT1, respectively). [score:1]
This revealed that the miR-204 was lower in the tumor as opposed to matched normal tissues (Figure 3A). [score:1]
de/apps/zmf/mirwalk2/) and the most predicted putative targets (at least four prediction software) of miR-204 selected to evaluate miRNA\mRNA correlation. [score:1]
A Pearson's correlation coefficient and relative p-value were obtained for each miRNA-204\mRNA pairs, and genes with p-values less than 0.05 and absolute value coefficient higher than 0.7 were used for further analyses. [score:1]
Next, we assessed the levels of the seven miR-204 gene targets (those already characterized in the gastric cancer specimens). [score:1]
MiR-204 was also reported as down regulated in several cancers, including biliary-tree tumors [14– 17]. [score:1]
We aim to perform more studies to investigate how the levels of miR-204 are modulated in chemotherapy -treated gastric cancer and cholangiocarcinoma cell lines and, importantly, whether the chemotherapy -induced stress may change the spatial and/or temporal modulation of its targets. [score:1]
Here we investigated whether this was common to other tumors of the digestive system and whether this elicited a miR-204 -dependent gene target signature, diagnostically and therapeutically relevant. [score:1]
[1 to 20 of 94 sentences]
6
[+] score: 319
The fact that miR-204 inhibition represses while miR-204 induces the expression of the validated genes suggests that miR-204 might indirectly regulate their expression. [score:9]
We observed that sequestration of endogenous miR-204 with the specific antagomir increased the expression of the Renilla reporter, while the expression of the miR-204 mimic reduced the expression of the reporter, confirming that PTPN11 may be a primary target of miR-204 through its 3′ UTR (Fig.   3e). [score:9]
Contrary to the effect observed on PTPN11 mRNA levels, transfection of miR-204 antagomir in HaCaT cells up-regulated PTPN11 protein levels, whereas miR-204 mimic resulted in downregulation of PTPN11 expression (Fig.   3d). [score:9]
To determine gene expression changes induced by miR-204 downregulation in non-tumoral keratinocytes we infected HaCaT cells with lentiviral supernatants carrying short hairpin RNA (shRNA) targeting miR-204 or the corresponding scrambled hairpin negative control along with the GFP gene. [score:8]
On the contrary, pY705-STAT3 signal at the plasma membrane/cytoplasm in some of the non-peritumoral AKs suggests that certain degree of STAT3 activation is already present in AK, but miR-204 expression would inhibit the expression of proteins regulating effective pY705-STAT3 translocation to the nucleus, where these proteins act as transcription factors. [score:8]
Importantly, treatment of HaCaT cells, which express low but detectable miR-204 levels, with the demethylating agent 5-aza-2′-deoxycytidine partially restored miR-204 expression (Fig.   2c) suggesting that DNA methylation of the miR-204 promoter directly impinges on miR-204 expression. [score:8]
To restore the expression of DNA-methylated miR-204, HaCaT cells were treated with the DNA demethylating agent 5-aza-2′-deoxycytidine (Sigma) at 10 μM for 120 h. To generate retroviral stocks for stable expression of miR-204 antagomir, 293T cells were transfected with Fugene (Roche) with miRZIP-204 anti-miR-204 construct (shRNA targeting miR-204 microRNA, cloned in pGreenPuro HIV based lentivector, BioCat), or with the corresponding pGreenPuro scrambled hairpin negative control (BioCat). [score:7]
AK identified a unique downregulated miRNA, miR-204 (Logarithmic fold change = −1.2; p = 0.0097) in cSCC, whereas no miRNA was found to be upregulated. [score:7]
Therefore gene expression and migration modulation by miR-204 were more effectively observed when this miRNA was overexpressed, whereas miR-204 depletion mostly resulted in mild gene expression changes and unaffected cell motility. [score:7]
Transient expression of miRIDIAN microRNA human hsa-miR-204-5p-hairpin inhibitor (Dharmacon), pre-miR™ miRNA-204-5p precursor (Life Technologies) or the corresponding controls (miRIDIAN microRNA hairpin inhibitor negative control #1, Dharmacon, and pre-miR™ miRNA precursor negative control #1, Life Technologies, respectively) at 50 nM was performed with DHARMAFECT 4 as described earlier [39]. [score:7]
d PTPN11 expression is up-regulated by miR-204 in HaCaT cells, monitored by Western blot. [score:6]
These results indicated that miR-204 expression modulates EGF signaling intensity and timing, with an initial activation followed by a downregulation at longer time periods. [score:6]
Since this genomic region also displays STAT3 -binding sites, and phosphorylated STAT3 suppresses miR-204 expression in pulmonary arterial hypertension [68], STAT3 activation by alterations in proteins modulating this pathway could account as an alternative mechanism for miR-204 dowregulation in cSCC [69]. [score:6]
We have identified miR-204, previously found to be down-regulated in head and neck squamous cell carcinoma (HNSCC) [62, 63] and cSCC [25], as the only miRNA to be significantly downregulated in cSCC when compared to AK. [score:6]
Fig. 3Identification of gene expression changes upon miR-204 downregulation in the non-tumorigenic HaCaT cell line. [score:6]
In HaCaT cells miR-204 inhibits STAT3 and favours the MAPK signaling pathway, likely acting through PTPN11, a nuclear tyrosine phosphatase that is a direct miR-204 target. [score:6]
Since interfering endogenous miR-204 levels in HaCaT cells would likely result in subtle gene expression changes, from then on the analysis of miR-204 -mediated changes was carried out by miR-204 overexpression. [score:5]
In pulmonary hypertension an auto-regulatory positive feedback has been reported, in which STAT3 activation might perpetuate miR-204 downregulation [74]. [score:5]
According to the gene expression data, miR-204 antagomir transfected cells displayed lower PTPN11 mRNA levels than their control antagomir counterparts, whereas the expression of the miR-204 mimic enhanced PTPN11 levels (Additional file 1: Figure S3A). [score:5]
cSCCs display a marked downregulation of miR-204 expression when compared to AK. [score:5]
Among them, PTPN11 and FAM117B were also predicted to be miR-204 targets by the TargetScan 6.2 software [44]. [score:5]
Accordingly, the kinetic of PTPN11 expression after the stimulation with the cytokine closely resembled that of total STAT3 and, as observed for STAT3, enhanced PTPN11 expression was stronger in miR-204 mimic cells than control cells at these time points (Fig.   5a). [score:5]
Mean ± SD of three replicate samples from one representative experiment out of twoNext we tested whether miR-204 overexpression impinged on EGF -induced gene expression. [score:5]
Because the FGF-STAT3 pathway was identified to be deregulated in miR-204 -depleted HaCaT we hypothesized that the PTPN11 phosphatase could be directly targeted by miR-204 to modulate STAT3 signaling. [score:5]
Mean ± SD of three replicate samples from one representative experiment out of two Next we tested whether miR-204 overexpression impinged on EGF -induced gene expression. [score:5]
In contrast, control cells displayed enhanced STAT3 expression by FGF9 and IL6 and sustained Y705-STAT3 phosphorylation by IL6 that were not observed in miR-204 overexpressing cells. [score:5]
b In silico identification by IPA of putative direct miR-204 targets differentially regulated in HaCaT cells. [score:5]
Since miRNAs can interfere with mRNA translation in a manner independent of changes at the mRNA level [47] we tested miR-204 impact on PTPN11 protein expression. [score:5]
This result parallels that of the effect of IL6 in miR-204 overexpressing HaCaT cells, supporting the notion that PTPN11 mediates, at least in part, some of the miR-204 regulatory effects on STAT3 signaling pathway. [score:4]
Nuclear p705-STAT3 signal in adjacent AKs and cSCC [59, 60] (our own data) suggests that miR-204 already suffers a downregulation in some areas of the AK that will progress to cSCC. [score:4]
f Independent validation of miR-204 regulation of some of the genes identified by the expression array, by HaCaT transient transfection of miR-204 antagomir or mimic along with their controls. [score:4]
Accordingly, we observed a positive short-term induction of the STAT3 pathway by miR-204, whereas in the long-term miR-204 downregulates STAT3 pathway, while favouring MAPK pathway activation. [score:4]
IPA software (which integrates experimentally demonstrated and predicted microRNA-mRNA interactions) identified a number of putative direct miR-204 targets (Fig.   3b). [score:4]
b MiR-204 expression in cSCC and AK, analyzed by qRT-PCR and expressed as relative quantitative levels (2-(ΔΔCt) method). [score:4]
Two days after the infection, control and miR-204 antagomir expressing HaCaT cells were FACS-sorted. [score:3]
Identification of miR-204 targets in non-transformed keratinocytes. [score:3]
Identification of miR-204 targets and pathways was accomplished in HaCat cells. [score:3]
Finally we validated the microarray data by qRT-PCR analysis of some differentially expressed genes in HaCaT cells transfected with miR-204 antagomir or miR-204 mimic (Fig.   3f). [score:3]
We also tested some cellular functions identified by IPA as modulated by miR-204 expression. [score:3]
In contrast, 9 out of 11 cSCC biopsies and their adjacent AKs (82 %) displayed nuclear pY705-STAT3 signal (Fig.   6a, b), suggesting that STAT3 activation and nuclear localization in AK and cSCC inversely correlate with miR-204 expression. [score:3]
Independent validation in a different cohort consisting of 45 biopsy samples (15 CSE skins, 15 cSCCs and 15 cSCC-distant AKs from 15 patients; all lesions were located on the head and were at least 1 cm and maximum 5 cm apart from each other) confirmed miR-204 downregulation in cSCC when compared to intraindividual AKs (Fig.   1d). [score:3]
c Relative miR-204 levels in human epithelial keratinocytes and HaCaT cells, and restored expression of DNA methylated miR-204 in HaCaT cells after treatment with the DNA demethylating agent 5-aza-2′-deoxycytidine (Aza). [score:3]
Immunofluorescence detection of pY705-STAT3 signal suggests an inverse correlation between the pY705-STAT3 subcelular localization and miR-204 expression in AK and cSCC. [score:3]
c HaCaT cells were treated with EGF, FGF9 or IL6 (10 ng/ml) for 24 h, in the absence or in the presence of 50 μM NSC87877, and processed as in b The miR-204 target PTPN11 can modulate STAT3 [53– 55]. [score:3]
Fig. 5Effects of miR-204 overexpression on MAPK and STAT3 signaling pathways. [score:3]
Among the canonical pathways and upstream regulators, the FGF-STAT3 signaling pathway was identified to be deregulated in miR-204 -depleted HaCaT cells (Fig.   3a). [score:3]
b DNA methylation and expression levels of miR-204 in human biopsies detected by qRT-PCR. [score:3]
Once ready, HaCaT cells were transfected with the reporter plasmid along with miR-204 antagomir, miR-204 mimic or with their corresponding hairpin inhibitor or precursor negative controls at 50 nM. [score:3]
HaCaT cells infected with anti-miR-204 lentivirus (shRNA targeting miR-204) or with the corresponding pGreenPuro scrambled hairpin negative control lentiviral supernatant were flow cytometry-sorted and their total RNAs were purified. [score:3]
EGF treatment induced a biphasic STAT3 phosphorylation at Y705 in miR-204 overexpressing cells in the first hours, whereas pY705-STAT3 was barely detectable in control cells (Fig.   5a). [score:3]
MiR-204 affects the expression of EGF-modulated genes and regulates STAT3 signaling. [score:3]
However, similar levels of S727 phosphorylation could be observed regardless miR-204 expression. [score:3]
The FGF-STAT3 signaling pathway was identified by the IPA software to be modulated by miR-204 expression in HaCaT cells. [score:3]
c HaCaT cells were treated with EGF, FGF9 or IL6 (10 ng/ml) for 24 h, in the absence or in the presence of 50 μM NSC87877, and processed as in b The miR-204 target PTPN11 can modulate STAT3 [53– 55]. [score:3]
Analysis of miR-204 expression by qRT-PCR in the 20 cSCC and 5 AK biopsies used for the array confirmed low to undetectable levels of this miRNA in cSCC, whereas AK displayed statistically significant higher levels of miR-204 (Fig.   1b, c). [score:3]
All these data indicated that miR-204 induced STAT3 -mediated signaling at short time points but resulted in impairment in STAT3 expression and activation triggered by different cytokines signaling through this pathway at longer time points. [score:3]
d Validation of miR-204 differential expression in an independent cohort. [score:3]
Basal pY705-STAT3 levels were undetectable both in control as well as in miR-204 -overexpressing cells. [score:3]
Therefore, we explored the impact of miR-204 on EGF -mediated regulation of MAPK and STAT3 pathways. [score:2]
PTPN11 levels were higher in untreated cells as well as upon FGF9 and IL6 treatments in control cells when compared to similar conditions in miR-204 overexpressing cells at this time point. [score:2]
Wilcoxon test was applied to determine statistical significance MiR-204 is an intronic miRNA located at the TRPM3 gene that shares the same promoter and regulatory motif for transcription than TRPM3 [41, 42]. [score:2]
MiR-204 expression is frequently silenced by DNA methylation in cSCC. [score:2]
Altogether, these results indicated that different mechanisms account for miR-204 silencing, among them DNA methylation. [score:1]
c Box plot representation of relative miR-204 levels in AK and cSCC. [score:1]
Our data suggest that miR-204 may act as a “rheostat” that controls the signalling towards the MAPK pathway or the STAT3 pathway in the progression from AK to cSCC. [score:1]
This could be explained by the relatively low endogenous miR-204 levels due to partial DNA methylation of the miR- 204 locus in HaCaT cells (see above), despite being a non-tumorigenic cell line. [score:1]
In contrast, cell migration enhancement was observed in HaCaT cells transfected with miR-204 mimic, whereas no effect was observed in those transfected with the antagomir (Additional file 1: Figure S3C). [score:1]
Interestingly, an increase in miR-204 methylation levels was found from CSE skins to AKs, whereas DNA methylation only accounts for miR-204 silencing in seven of the cSCC samples (64 %) (cut off >24 %; the highest methylation value found in CSE skin biopsies) (Fig.   2a, b). [score:1]
e Relative Renilla luciferase activity derived from the PTPN11 3′ UTR reporter construct monitored after transfection of HaCaT cells with miR-204 antagomir or miR-204 mimic, along with their controls. [score:1]
Conversely, low levels of miR-204 in cSCC would favour STAT3 pathway activation, which is also mediated by IL6 [56]. [score:1]
In most cSCCs, miR-204 promoter DNA methylation accounts for miR-204 silencing, which would result in STAT3 activation and translocation to the nucleus, a common feature found in 80 % of cSCCs. [score:1]
The 2-(ΔΔCt) method [40] was used to determine relative quantitative levels of miR-204. [score:1]
DNA methylation of miR-204 promoter was identified as one of the repressive mechanisms that accounts for miR-204 silencing in cSCC. [score:1]
Dot plot representation of relative miR-204 levels in CSE skin, AK and cSCC from the same donor (n = 15), and referred to their corresponding miR-204 levels in CSE skin. [score:1]
miR-204 Cutaneous squamous cell carcinoma Actinic keratosis Sun -induced keratinocyte intraepithelial neoplasia DNA methylation MAPK STAT3 Cutaneous squamous cell carcinoma (cSCC) is an epidermal keratinocyte derived skin malignant tumor with an incidence of 16 per 100,000 people in Europe [1]. [score:1]
b HaCaT cells were transiently transfected for 24 h with miR-204 mimic or control mimic molecules and treated with EGF (10 ng/ml) for the indicated time points. [score:1]
HaCaT cells transfected with miR-204 or control mimics were stimulated with EGF for different time periods up to 6 h. ERK2 total levels and ERK1/2 phosphorylation kinetics were similar upon EGF stimulation in both conditions. [score:1]
To investigate this possibility, HaCaT cells were transiently transfected with miR-204 antagomir (hairpin inhibitor), miR-204 mimic (pre-miRNA-204 precursor) or with the corresponding antagomir or precursor negative controls (Fig.   3c). [score:1]
b Control or miR-204 mimic transfected HaCaT cells were treated with EGF, FGF9 or IL6 (10 ng/ml) for 24 h. Total extracts from these cells were subjected to western blot analysis (left). [score:1]
Fig. 2DNA methylation -associated silencing of miR-204 in cSCC cell lines and human samples. [score:1]
However, mRNA levels of these genes were further increased in control cells at 24 h, whereas the levels of these mRNAs dropped in miR-204 mimic cells (Fig.   4b). [score:1]
Some in vitro studies with hepatic, renal, ovarian and breast cancer cell lines have shown that loss of miR-204 results in activation of an EMT, leading to cancer cell migration and invasion [71, 72]. [score:1]
Methylation levels represent the mean of three consecutive CpGs (-26, -28, -40) located at the promoter region of miR-204. [score:1]
Fig. 4EGF induction of miR-204 modulated genes in HaCaT cells. [score:1]
Cell cycle status assessed by BrdU staining to detect DNA synthesis revealed that miR-204 depletion in HaCaT cells impairs BrdU incorporation while cells transfected with miR-204 mimic displayed an enhancement in BrdU staining (Additional file 1: Figure S3B). [score:1]
DNA methylation of miR-204 promoter was determined by bisulphite treatment and pyrosequencing. [score:1]
Pyrosequencing analysis of three consecutive CpGs (CpG -26, CpG -28, CpG -40) located at the miR-204 promoter region revealed that this promoter was heavily methylated in the two cSCC cell lines tested (SCC12 and SCC13) as well as in the epidermal carcinoma cell line A431, whereas the immortal keratinocyte cell line HaCaT displayed a partially methylated miR-204 promoter (Fig.   2a). [score:1]
Of note, pERK1/2 basal levels were higher in miR-204 mimic cells (Fig.   5a). [score:1]
Down, DNA methylation levels of the miR-204 promoter region in cell lines and human biopsies. [score:1]
Oligonucleotides corresponding to the PTPN11 3′UTR region containing the miR-204 binding site (5′-TCGAGTTGCAATTGTCAAGTGTTTTGTTGTAGCTTAGTATCCATAAGGGAAAC TTAGACTATAGACATAGATCTGC-3′; 5′-GGCCGCAGATCTATGTCTATAGTCTAAGTT TCCCTTATGGATACTAAGCTACAACAAAACACTTGACAATTGCAAC-3′) were annealed and inserted in the psiCHECK2 plasmid (Promega), immediately downstream from the stop codon of Renilla luciferase, and the sequence was confirmed by sequencing. [score:1]
Next we determined miR-204 promoter methylation in 5 CSE skin, 4 AK and 11 cSCC samples. [score:1]
c MiR-204 expression relative to RNU48 measured by qRT-PCR in HaCaT cells transfected with miR-204 antagomir or miR-204 mimic along with their appropriate controls. [score:1]
Since our in vitro data suggested that miR-204 expression in AK would impair long term activation of STAT3 signaling, we investigated pY705-STAT3 localization in 14 non-peritumoral AKs, 11 cSCCs and in their adjacent corresponding AKs. [score:1]
In addition, EGF enhanced STAT3 total levels during the first hours, dropping to basal levels after 6 h of the treatment, being this effect stronger in those cells transfected with miR-204 mimic. [score:1]
a Up, schematic representation of TRPM3/miR-204 gemomic locus. [score:1]
To identify molecular and cellular functions modulated by miR-204 in our cellular context we used Ingenuity Pathway Analysis (IPA) software. [score:1]
Although we have not detected a relationship between miR-204 and EMT, the demonstration of miR-204 silencing in cSCC samples regardless of their biological behaviour makes unlikely the possibility that miR-204 plays a relevant role in this process. [score:1]
Therefore, different DNA-methylation dependent and independent mechanisms could mediate miR-204 repression in cSCC. [score:1]
a HaCaT cells were transiently transfected for 24 h with miR-204 or control mimics, and treated with EGF (10 ng/ml) for the indicated time points. [score:1]
To this end, HaCaT cells transfected with control or miR-204 mimics were stimulated with EGF for 30 min or 24 h. MiR-204 mimic -transfected cells displayed higher basal and induced mRNA levels of the tested genes at short time points. [score:1]
At this time point pERK1/2 levels were higher in miR-204 mimic cells stimulated with EGF, FGF9 and IL6 (Fig.   5b). [score:1]
We here report hypermethylation of the miR-204 promoter in AKs and in a high proportion of cSCCs. [score:1]
[1 to 20 of 102 sentences]
7
[+] score: 243
Since microRNAs regulate gene expression leading to decreased translation, increased degradation of the target message, or both [27], we examined the effects of over -expression of miR-204 on Mcl-1 protein expression. [score:12]
miR-204 is reported to act as a tumor suppressor in a variety of cancers through different mechanisms including down-regulation of Bcl-2, NTRK2 in neuroblastoma cancer and suppression of invasion in endometrial cancer mediated by FOXC1 regulation [31, 32]. [score:9]
Loss of miR-204 expression in gastric cancer has been associated with poor prognosis due to an increase in the anti-apoptotic protein, Bcl-2. In agreement with these studies, we have shown that miR-204 is down-regulated in pancreatic cancer cells, and over -expression of miR-204 induces loss of pancreatic cancer cell viability (Figure 3). [score:8]
Over -expression of miR-204, either by triptolide treatment or a miR-204 mimic transfection results in suppression of Mcl-1 expression and cell death, both in pancreatic cancer cells and human patient xenografts. [score:7]
We have shown that triptolide up-regulates miR-204 and down-regulates Mcl-1, an anti-apoptotic protein essential for the survival of multiple cell lineages, and among one of the amplified genes in pancreatic cancer cells (Figure 5). [score:7]
In the presence of the deletion mutant, no abrogation of reporter activity was observed, thereby confirming that miR-204 interacts directly with the 3’ UTR of Mcl-1 and inhibits the expression of Mcl-1. Figure 4 miR-204 binds directly to the 3’ UTR of Mcl-1. A. Luciferase activity in MIA PaCa-2 cells transiently transfected with the luciferase construct alone, or co -transfected with the vector containing either wild type or mutant miR-204 described in A. Mean ± SEM, *p < 0.01. [score:7]
In the presence of the deletion mutant, no abrogation of reporter activity was observed, thereby confirming that miR-204 interacts directly with the 3’ UTR of Mcl-1 and inhibits the expression of Mcl-1. Figure 4 miR-204 binds directly to the 3’ UTR of Mcl-1. A. Luciferase activity in MIA PaCa-2 cells transiently transfected with the luciferase construct alone, or co -transfected with the vector containing either wild type or mutant miR-204 described in A. Mean ± SEM, *p < 0.01. [score:7]
Using human xenograft samples treated with Minnelide, a water soluble variant of triptolide, we have shown that miR-204 is up-regulated and Mcl-1 is down-regulated in treated vs. [score:7]
Since miR-204 was inhibited in pancreatic cancer cells, we assessed the effect of its up-regulation on cell survival. [score:6]
Our data suggest that over -expression of miR-204 induces down-regulation of Mcl-1 in pancreatic cancer cells. [score:6]
Additionally, VHL expression increases miR-204 levels, resulting in down-regulation of LC3-II and cell death [35]. [score:6]
A previous study has shown that miR-204 is down-regulated in head and neck cancer [14], but there is no information available on the expression of miR-204 in pancreatic cancer cells. [score:6]
Our data, taken together, suggests that triptolide induces pancreatic cancer cell death via down-regulation of Mcl-1 and increased expression of miR-204. [score:6]
Our data therefore show that Mcl-1 over -expression in pancreatic cancer cells is due to down-regulation of miR-204. [score:6]
While the role of miR-204 as a tumor suppressor is well established, its ability to regulate Mcl-1 expression was not known prior to this study. [score:6]
In our study, over -expression of miR-204 results in decrease in Mcl-1 expression and subsequent cell death in pancreatic cancer cells (Figure 3). [score:5]
D. Over -expression of a miR-204 mimic in MIA PaCa-2 and S2-VP10 cells results in reduced Mcl-1 protein expression 48 h post-transfection. [score:5]
Triptolide regulates Mcl-1 and miR-204 expression in pancreatic cancer cells in vitro. [score:4]
Triptolide regulates Mcl-1 and miR-204 expression in pancreatic cancer cells in vitroWe have previously shown that triptolide, a diterpene triepoxide, is effective in causing pancreatic cancer cell death both in vitro and in vivo. [score:4]
Minnelide regulates Mcl-1 and miR-204 expression in pancreatic cancer cells in vivo. [score:4]
To test if Mcl-1 expression was being regulated by miR-204, we transfected a fragment of the Mcl-1-3’UTR containing the miR-204 binding site in a Renilla/Luciferase reporter containing vector into MIA PaCa-2 cells in the presence of miR-204 or scrambled miRNA. [score:4]
Once we had established that Mcl-1 is required for pancreatic cancer cell survival, we investigated the mechanism of regulation of Mcl-1. Using TargetScan 6.2, a database identifying putative miRNAs associated with mRNA, we identified Mcl-1 as a hypothetical target gene of miR-204 (Figure 3A). [score:4]
Our data show that over -expression of wild type miR-204 abrogated reporter activity by 40% (Figure 4A), suggesting a direct interaction between Mcl-1 and miR-204. [score:4]
Mcl-1 is reported to be regulated by the miR-204 microRNA in head and neck squamous cell carcinoma (HNSCC), where it behaves as a tumor suppressor [14]. [score:4]
This is the first study demonstrating that triptolide increases miR-204 expression resulting in decreased levels of Mcl-1 by the direct binding of miR-204 to its 3’-UTR (Figure 4). [score:4]
Using luciferase reporter assays, we confirmed the ability of miR-204 to down-regulate Mcl-1 by directly binding to the Mcl-1 3’ UTR. [score:4]
The function of miR-204, to date, is still unclear, although some mRNA targets that are important for normal cell development have been identified. [score:4]
Minnelide regulates Mcl-1 and miR-204 expression in pancreatic cancer cells in vivoMinnelide, a water soluble pro-drug of triptolide, is shown to be extremely effective against pancreatic cancer both in vitro and in vivo[22]. [score:4]
VHL-regulated miR-204 is suppressed in VHL−/− renal clear cell carcinoma cells. [score:4]
For this, we first over-expressed the miR-204 mimic in MIA PaCa-2 and S2-VP10 cells. [score:3]
B. Alignment of miR-204 with the predicted target region in the Mcl-1 3’UTR. [score:3]
A. Target Scan prediction of the miR-204 pairing site in Mcl-1 3’UTR. [score:3]
Loss of miR-204 has recently been shown to promote cancer cell migration via increased expression of brain derived neurotrophic factor or its receptor, TrkB. [score:3]
The Mcl-1-derived miR-204 binding site or a binding site deletion in the 3’UTR was inserted into the psiCheck2 expressing firefly luciferase plasmid (Promega) and transfected into MIA PaCa-2 or S2-VP10 cells using Attractene (Giagen) following manufacturer’s instructions. [score:3]
Figure 6 Minnelide treatment leads to loss of Mcl-1 expression and increase of miR-204 in vivo. [score:3]
In the presence of miR-204 mimic, Mcl-1 protein levels decreased, suggesting that miR-204 targets Mcl-1 in pancreatic cancer cells (Figure 3D). [score:3]
Figure 5 Triptolide increases miR-204 and decreases Mcl-1 expression resulting in pancreatic cancer cell death. [score:3]
Over -expression of miR-204 significantly decreased cell viability in MIA PaCa-2 and S2-VP10 cells 48 h after transfection (% of Control: 60.85 ±10.21 (MIA PaCa-2) and 61.48 ±9.48 (S2-VP10)) (Figure 3C). [score:3]
Over -expression of miR-204, either by a miR-204 mimic, or by triptolide treatment results in a decrease in Mcl-1 levels, and a subsequent decrease in cell viability. [score:3]
C. Over -expression of miR-204 results in loss of cell viability in both MIA PaCa-2 and S2-VP10 cells. [score:3]
Treatment of cells with the same concentration of triptolide for 24 h did not lead to changes in miR-204 expression in normal ductal cells (HPDEC; data not shown). [score:3]
Importantly, loss of miR-204 has been associated with a stem cell-like phenotype in gliomas, and its over -expression results in reduced tumorigenicity and loss of the stemness transcription factor, SOX4 [33]. [score:3]
In support of our in vitro data suggesting that triptolide leads to an increase in miR-204 levels and decreased Mcl-1 levels, miR-204 expression was significantly increased (20–40 fold) in Minnelide treated vs. [score:3]
Mcl-1 is a target of miR-204 in pancreatic cancer cells. [score:3]
Figure 3 Over -expression of miR-204 results in loss of Mcl-1 and causes cell death in pancreatic cancer cells. [score:3]
Over -expression of miR-204 in MIA PaCa-2 and S2-VP10 cells transfected with a miR-204 mimic. [score:3]
Animals treated with doses of Minnelide shown to cause tumor regression show a decrease in levels of Mcl-1 and increase in miR-204 expression compared to saline treated controls (Figure 6). [score:2]
We show in this study that one of the miRs that regulates Mcl-1 levels is miR-204. [score:2]
To evaluate the ability of Minnelide to regulate Mcl-1 and miR-204 levels in a preclinical setting, we analyzed Mcl-1 and miR-204 expression in three patient tumor xenografts treated with Minnelide. [score:2]
Pancreatic cancer cells show a decreased expression of miR-204, compared to HPDEC. [score:2]
In conclusion, in this study we provide a mechanism for triptolide induced cell death through regulation of miR-204. [score:2]
The binding site deletion used to establish direct binding between miR-204 and Mcl-1 is shown. [score:2]
Triptolide mediated miR-204 increase causes pancreatic cancer cell death via loss of Mcl-1. Pancreatic cancer is the fourth leading cause of cancer related deaths in the United States with a five year survival of less than 5% [1]. [score:1]
To validate binding specificity, we assessed reporter activity with a miR-204-Mcl-1 3’UTR binding site deletion mutant (Figure 4B). [score:1]
Syn-hsa-miR-204 miScript miRNA Mimic (MSY0000265) and FlexiTube human Mcl-1 short interfering RNA (siRNA) was purchased from Qiagen and used for transfection. [score:1]
18S and U6 were used as internal controls for quantifying Mcl-1 and miR-204 levels respectively (Qiagen). [score:1]
Taken together, our data show that triptolide treatment increased miR-204 levels and decreased Mcl-1 levels in vitro. [score:1]
Using pancreatic cancer cell lines, we have shown that miR-204, a putative regulator of Mcl-1, is repressed in cancer cell lines compared to normal cells. [score:1]
B. Minnelide treatment increases miR-204 levels in patient tumors transplanted into SCID mice. [score:1]
miR-204 binds to the Mcl-1 3’UTR. [score:1]
Correspondingly, triptolide treatment resulted in an increase in miR-204 levels in both MIA PaCa-2 (23.1 ± 7.5 fold) and S2-VP10 cells (75.2 ± 15.4 fold), 24 h post-triptolide treatment (Figure 5B). [score:1]
B. Treatment of both MIA PaCA-2 and S2-VP10 cells with triptolide significantly increases levels of miR-204 as assessed using real time PCR. [score:1]
Mcl-1 siRNA or miR-204 mimic was transfected following manufacturer’s instructions. [score:1]
The miR-204 mimic was co -transfected where indicated. [score:1]
Animals were sacrificed 7 days after start of the treatment and RNA extracted from tumors was evaluated for Mcl-1 and miR-204 expression. [score:1]
miR-204 expression was measured by Real-Time PCR. [score:1]
Once we had established that miR-204 levels were increased in the presence of mimic, we assessed cell viability in the presence of the mimic. [score:1]
Relative levels of Mcl-1 or miR-204 were assessed using the ΔΔCt method [40]. [score:1]
[1 to 20 of 68 sentences]
8
[+] score: 235
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196a-2, hsa-mir-27b
demonstrated that UCA1 expression was upregulated in the esophageal cancer tissues and ecoptic expression of UCA1 increased esophageal cancer cell proliferation by regulating the miR-204 and Sox4 expression. [score:11]
Furthermore, we showed that elevated expression of UCA1 regulated the chondrocytes cell proliferation and collagen expression through inhibiting the miR-204-5p expression. [score:10]
Elevated expression of UCA1 regulated the chondrocytes cell proliferation and collagen expression through inhibiting the miR-204-5p expression. [score:10]
Overexpression of UCA1 suppressed the miR-204-5p expression and enhanced the MMP-13 expression in the chondrocytes. [score:9]
Moreover, elevated expression of miR-204-5p suppressed the MMP-13 expression in the UCA1 overexpressing-chondrocytes (Figure 6C). [score:9]
Overexpression of miR-204-5p also inhibited the ki-67 expression in the UCA1 overexpressing-chondrocytes (Figure 6B). [score:9]
Overexpression of UCA1 suppressed the miR-204-5p expression in the chondrocytes. [score:7]
Overexpression of miR-204-5p suppressed MMP-13 expression in the chondrocytes (Figure 3D). [score:7]
In line with this, we demonstrated that overexpression of UCA1 suppressed the miR-204-5p expression in the chondrocytes. [score:7]
Ecoptic expression of miR-204-5p inhibited the ki-67 expression in the chondrocytes (D). [score:7]
Elevated expression of UCA1 promoted the chondrocytes cell proliferation and overexpression of miR-204-5p suppressed chondrocytes cell proliferation. [score:7]
Ecoptic expression of miR-204-5p enhanced the type II collagen (Figure 6D) and type IV collagen (Figure 6E) expression in the UCA1 overexpressing-chondrocytes. [score:7]
Overexpression of UCA1 suppressed the miR-204-5p expression in the chondrocytes (Figure 2B). [score:7]
Ecoptic expression of miR-204-5p inhibited the ki-67 expression in the chondrocytes (Figure 4D). [score:7]
Elevated expression of miR-204-5p also inhibited the protein expression of MMP-13 in the chondrocytes (Figure 3E). [score:7]
The expression of miR-204-5p was downregulated in the OA cartilage. [score:6]
The data indicated that the expression level of miR-204-5p was downregulated in the OA cartilage. [score:6]
These results suggested that lncRNA UCA1 played as an important regulator of survival and matrix synthesis of chondrocytes partly through suppressing the miR-204-5p expression. [score:6]
The expression of miR-204-5p was significantly upregulated in the chondrocytes after treated with miR-204-5p mimic (Figure 3B). [score:6]
Figure 3(A) There is a potential miR-204-5p binding sequence in the 3’UTR of MMP-13 through by using TargetScanHuman miRNA target prediction software. [score:5]
We restored miR-204-5p expression in the UCA1 overexpressing-chondrocytes to study whether miR-204-5p was involved in the function of UCA1 in chondrocytes. [score:5]
Figure 6(A) Elevated expression of miR-204-5p inhibited chondrocytes cell proliferation, reversing UCA1 -induced chondrocytes cell proliferation. [score:5]
Moreover, the expression of miR-204-5p was negatively correlated with the UCA1 expression in the OA cartilage. [score:5]
Elevated expression of miR-204-5p suppressed the chondrocytes cell proliferation (Figure 4C). [score:5]
Elevated expression of miR-204-5p inhibited chondrocytes cell proliferation, reversing UCA1 -induced chondrocytes cell proliferation (Figure 6A). [score:5]
miR-204-5p suppressed the MMP-13 expression in the chondrocytes. [score:5]
Elevated expression of miR-204-5p suppressed the chondrocytes cell proliferation (C). [score:5]
Moreover, the expression of miR-204-5p was negatively correlated with the UCA1 expression in the OA cartilage (Figure 2D). [score:5]
Elevated expression of miR-204-5p promoted the type II collagen and type IV collagen expression in the chondrocytes. [score:5]
In addition, elevated expression of miR-204-5p promoted the type II collagen (Figure 5C) and type IV collagen (Figure 5D) expression in the chondrocytes. [score:5]
We identified a potential miR-204-5p binding sequence in the 3′UTR of MMP-13 through using TargetScanHuman miRNA target prediction software (Figure 3A). [score:5]
Elevated expression of UCA1 promoted the chondrocytes cell proliferation and miR-204-5p suppressed chondrocytes cell proliferation. [score:5]
We identified MMP-13 was a direct target gene of miR-204-5p in the chondrocytes. [score:4]
Moreover, we idetified MMP-13 was a direct target gene of miR-204-5p in the chondrocytes. [score:4]
Bian et al. showed that UCA1 enhanced the 5-fluorouracil resistance and cell proliferation in the colorectal cancer through regulating the miR-204-5p expression. [score:4]
As shown in the Figure 3C, miR-204-5p decreased the luciferase activity of MMP-13-WT plasmid, but not of MMP-13-Mut, manifesting that MMP-13 was one of miR-204-5p direct targets. [score:4]
We then determined the expression of miR-204-5p in the OA cartilage and normal cartilage. [score:3]
These data provide the possibility of UCA1/miR-204-5p as therapeutic targets for the treatment of OA. [score:3]
As shown in the Figure 2C, the expression level of miR-204-5p was lowest in the moderate and severe group compared to in the normal cartilage and mild OA cartilage. [score:2]
LncRNA UCA1 and control vector, miR-204-5p mimic and scramble were purchased from GenePharma (Shanghai, China). [score:1]
[1 to 20 of 40 sentences]
9
[+] score: 200
Next, we further demonstrated that miR-204 inhibited ATF2 expression by targeting its 3'UTR, indicating that ATF2 is indeed a direct target of miR-204. [score:10]
In conclusion, our work demonstrates that miR-204 is frequently downregulated in patients with GBM, and can be recommended as a potential tumor-suppressing miRNA to inhibit GBM development and progression. [score:9]
Recently, miR-204 function as a tumor suppressive miRNA and miR-204 expression level is down-regulated in various human malignancies: endometrial cancer [19], prostate cancer [20], medulloblastomas [21], non-small cell lung carcinoma [22, 23]. [score:8]
Recently, miR-204 function as a tumor suppressive miRNA, and miR-204 expression level is down-regulated in endometrial cancer, prostate cancer, medulloblastomas, non-small cell lung carcinoma. [score:8]
Thus, the present data demonstrates that miR-204 regulates ATF2 expression, and thus over-expressed miR-204 functions as a tumor suppressor in GBM progression. [score:8]
Here, we found that ATF2 overexpression reverses the inhibitory effects of over-expressed miR-204 on GBM cancer cell proliferation, migration and invasion. [score:7]
Subsequently, we carried out western blot to testify the overexpression of miR-204 could inhibit ATF2 protein expression. [score:7]
Thus, it should be inferred that miR-204 affected proliferation, migration and invasion directly or indirectly via inhibition of ATF2 to affect the expression of MMP2 and MMP9. [score:7]
Here, we reported down-regulation of miR-204 and demonstrate its role as a tumor suppressor in GBM. [score:6]
ATF2 overexpression reversed the inhibitory effect of miR-204 on GBM cell proliferation, migration and invasion. [score:5]
To further elucidate the association between miR-204 and ATF2, we conducted a transfection pcDNA3.1(+)-ATF2 into miR-204 -overexpressing A172 and U87 cells to enhance the overexpression of ATF2 protein (Figure 6a). [score:5]
We showed that miR-204 is downregulated in clinically obtained human GBM tissues. [score:4]
Moreover, we explored that miR-204 plays a crucial role in cell proliferation, migration and migration by directly targeting ATF2 in GBM cells. [score:4]
For example, miR-204 was reported to be significantly upregulated in most pancreatic cancer [18]. [score:4]
Accumulating studies showed that the deregulated expression of miR-204 was observed in various cancers. [score:4]
For example, miR-204 was reported to be significantly upregulated in most pancreatic cancer. [score:4]
What is more, our transwell assay also showed that ATF2 overexpression in miR-204 -overexpressing A172 and U87 cells enhanced the migration and invasion capacity of A172 and U87 cells in comparison with vector control (Figure 6c, 6d). [score:4]
miR-204 inhibits GBM cell proliferation. [score:3]
a. The miR-204 mimics inhibited the luciferase activity controlled by wild-type ATF2-3'-UTR, but did not affect the luciferase activity controlled by mutant ATF2-3'-UTR in A172 cells. [score:3]
Figure 5 a. The miR-204 mimics inhibited the luciferase activity controlled by wild-type ATF2-3'-UTR, but did not affect the luciferase activity controlled by mutant ATF2-3'-UTR in A172 cells. [score:3]
b. The miR-204 mimics inhibited the luciferase activity controlled by wild-type ATF2-3'-UTR, but did not affect the luciferase activity controlled by mutant ATF2-3'-UTR in U87 cells. [score:3]
ATF2 is a candidate target of miR-204. [score:3]
Our findings showed that miR-204 overexpression resulted in significantly reduced cell proliferation in both A172 and U87 cells (Figure 2b). [score:3]
miR-204 expression was detected by qRT-PCR in GBM cell lines (A172, U87, and U251) and a normal human brain cell NHA. [score:3]
Figure 1 a. Relative miR-204 expression in GBM cell lines (A172, U87, and U251) and a normal human brain cell line NHA. [score:3]
Of 60 GBM samples, miR-204 was obviously down-regulated compared with the adjacent normal tissues (Figure 1b). [score:3]
Our data suggest a novel molecular mechanism of the tumor suppressor activity of miR-204. [score:3]
b. The proliferation capacity of miR-204 -overexpressing A172 and U87 cells was partially improved when cells were transfected with ATF2 plasmids in comparison with miR-NC. [score:3]
miR-204 expression is reduced in. [score:3]
To figure out the role of miR-204 in GBM cell proliferation, we generated miR-204 -overexpressing A172 and U87 cells by transiently transfecting cells with miR-204 mimics. [score:3]
ATF2 regulated by miR-204 might also play an important role in the regulation of malignant behavior of GBM. [score:3]
ATF2 is identified as a target of miR-204. [score:3]
Functional consequences of aberrant miR-204 expression were studied by transiently transfecting miR-204 mimic (Life technologies, Shanghai, China), and corresponding negative controls miR-NC (GenePharma, Shanghai, China) into cells. [score:3]
miR-204 expression was confirmed by real time RT-PCR (Figure 2a). [score:3]
Re -expressing miR-204 and/or interfering with ATF2 function might be a promising therapy strategy. [score:3]
b. Relative miR-204 expression in 60 pairs of GBM tissues and adjacent normal counterpart tissues was detected using real-time RT-PCR. [score:3]
However, the expression and mechanism of miR-204 in bladder cancer remain unclear. [score:3]
miR-204 inhibits GBM cancer cell proliferation, migration and invasion. [score:3]
miR-204 inhibits GBM cell migration and invasion. [score:3]
Reduced miR-204 expression in. [score:3]
c, d. The migration and invasion of miR-204 -overexpressing A172 and U87 cells were effectively improved when cells were transfected with ATF2 plasmids. [score:3]
Enforced ATF2 attenuates the inhibitory effects of miR-204. [score:3]
a. Relative miR-204 expression in GBM cell lines (A172, U87, and U251) and a normal human brain cell line NHA. [score:3]
In this study, we examined both the regulation of the ATF2 pathway by miR-204 in GBM, as well as its functional significance. [score:2]
b. The invasive capacity of A172 and U87 cells was assessed by transwell invasion assay after transfecting the cells with miR-204 mimics or scramble control miRNA for 48 h. Overexpresion of miR-204 inhibited the invasion of A172 and U87 cells. [score:2]
The miR-204 has been commonly deregulated in various cancers. [score:2]
These finding also indicated that miR-204 is implicated in the development of GBM. [score:2]
Figure 2 a. Relative miR-204 expression in A172 and U87 cells was measured after the cells were transfected with miR-204 mimics or scramble control miRNA using real-time RT-PCR. [score:1]
A putative miR-204 binding site was detected at the end of the ATF2 3'UTR according to previous reports. [score:1]
A172 and U87 cells were transfected with miR-204 mimics or scramble control miRNA. [score:1]
The firefly luciferase activity of the cells that were transfected with miR-204 mimics or miR-NC is represented as the percentage of activity relative to that of cells that were transfected with negative controls. [score:1]
Relative miR-204 expressions were calculated with normalization to U6, and GAPDH was used to as internal controls. [score:1]
Besides, we made a correlation analysis to elucidate the negative association of miR-204 and ATF2 in A172, U87, and U251 cells. [score:1]
Cells (3.5 × 10 [4]) were seeded in triplicate in 24-well plates and cotransfected with wild-type (wt) or mutant (mut) 3′-UTR vectors and miR-204 mimics using Lipofectamine 2000. [score:1]
All GBM cancer cell lines tested had lower miR-204 levels than did the NHA cells (Figure 1a). [score:1]
a. Relative miR-204 expression in A172 and U87 cells was measured after the cells were transfected with miR-204 mimics or scramble control miRNA using real-time RT-PCR. [score:1]
The tranwell assay revealed that miR-204 overexpression repressed the migration and invasion capacity of A172 and U87 cells compared with that of cells transfected with the miR-NC control (Figure 3a, 3b). [score:1]
[1 to 20 of 57 sentences]
10
[+] score: 182
Finally, we examined the protein expression level of DVL3 in the hADSCs following transfection with miR-204-5p antagomir or agomir for 72 h. In accordance with the above-mentioned findings, DVL3 expression was significantly upregulated following transfection with the miR-204-5p antagomir, and was markedly downregulated following transfection with the miR-204-5p agomir (Fig. 3D and E). [score:11]
Furthermore, the expression of all 3 genes markedly increased following the overexpression of miR-204-5p, while the knockdown of miR-204-5p led to a significant downregulation in the expression of these genes (Fig. 2B–D). [score:11]
The overexpression of miR-204-5p in the hADSCs caused a significant upregulation in the protein levels of C/EBPα, PPARγ and FABP4, while its knockdown led to a significant decrease in the expression of these genes (Fig. 2E and F). [score:9]
We demonstrated that DVL3, β-catenin and CCND1 expression was downregulated and upregulated in mature adipoctyes, in response to transfection with the miR-204-5p agomir or antagomir, respectively. [score:9]
To demonstrate the effect of miR-204-5p on the activity of Wnt/β-catenin signaling, we analyzed the expression of downstream effectors and targets of this pathway in response to the overexpression or knockdown of miR-204-5p in the hADSCs. [score:8]
In the present study, we first examined the dynamics of miR-204-5p expression during adipogenesis in hADSCs, and found that its expression is gradually upregulated during this process. [score:8]
miR-204-5p is upregulated and DVL3 is downregulated in hADSCs during adipogenic differentiation. [score:7]
Conversely, the downregulation of miR-204-5p suppressed adipogenic differentiation. [score:6]
Although miR-204 has been shown to promote the adipogenesis and inhibit the osteogenesis of human MSCs through the direct suppression of Runx2 (17), the effects of miR-204-5p on the activity of Wnt/β-catenin signaling and, consequently, on adipocytic differentiation remain unclear. [score:6]
In the present study, we demonstrate that miR-204-5p promotes the differentiation of human adipose-derived MSCs (hADSCs) into mature adipoctyes by suppressing the expression of DVL3, a positive regulator of Wnt/β-catenin signaling. [score:6]
Thnus, our results suggest that miR-204-5p suppresses canonical Wnt/β-catenin signaling, possibly by regulating DVL3 expression, which subsequently promotes adipogenesis. [score:6]
Specifically, DVL3 was found to possess the miR-204-5p target site in its 3′-UTR, and it was thus predicted, with a high score, to be a direct target by all 3 programs. [score:6]
We then demonstrated that the overexpression of miR-204-5p enhanced the adipogenesis of hADSCs, as illustrated by the significant increase in the quantity of lipid droplets and in the mRNA expression of PPARγ, C/EBPα and FABP4. [score:5]
A previous study demonstrated a downregulation in the expression level of miR-204 in the mature adipose tissue of C57BLJ6 mice fed a high-fat diet compared to those mice fed a standard diet (20). [score:5]
Although miR-204-5p is known to promote the differentiation of MSCs into mature adipoctyes by suppressing the expression of Runx2, to the very best of our knowledge, its effect on the adipogenic differentiation of hADSCs has not been demonstrated to date. [score:5]
In order to further explore the molecular pathway underlying the effects of miR-204-5p on the adipogenesis of hADSCs, we first identified potential target genes using the online prediction software, TargetScan, miRanda and PicTar. [score:5]
Another study demonstrated that the miR-204 levels were significantly upregulated in rat stromal vascular fraction (SVF) cells following adipocytic differentiation (21). [score:4]
These findings were further corroborated by inducing the overexpression or knockdown of miR-204-5p, that led to alterations in the protein level of DVL3. [score:4]
DVL3 is a direct target of miR-204-5p. [score:4]
The overexpression of miR-204 has been shown to promote adipogenesis (17). [score:3]
miR-204-5p suppresses Wnt/β-catenin signaling, thus promoting adipogenesis. [score:3]
In comparison with the control miR mimic -transfected 293T cells, we found that co-transfection with the wild-type 3′-UTR luciferase plasmid and miR-204-5p resulted in a significant suppression of luciferase activity by 47%. [score:3]
We first determined the changes in the mRNA expression of miR-204-5p and DVL3 during the adipogenic differentiation of hADSCs in vitro at different time points (0, 3, 6 and 9 days). [score:3]
In conclusion, the present study provides direct evidence that miR-204-5p induces the post-transcriptional silencing of DVL3, an important negative regulator of adipogenesis. [score:3]
These findings suggest that DVL3 and miR-204-5p may serve as potential therapeutic targets for the treatment and management of obesity and other related metabolic disorders. [score:3]
This suggests that miR-204-5p plays an important physiological role during the differentiation of hADSCs into the adipocytic lineage, by regulating the levels of DVL3, a critical regulator of the Wnt/β-catenin pathway. [score:3]
The miR-204-5p target site was predicted using online software, and found to be highly conserved among vertebrates. [score:3]
In order to further explore the mechanisms underlying the effects of miR-204-5p on adipocytic differentiation, we performed bioinformatics analysis and a dual luciferase reporter assay and verified that DVL3 is direct target of this miRNA. [score:3]
We found that the overexpression of miR-204-5p enhanced adipogenesis, resulting in increased numbers of stained cellular oil droplets in comparison to the control (untransfected cells) or in the differentiated hADSCs transfected with the negative control agomir (agomir-NC). [score:3]
The 3′-UTR sequence of human DVL-3 containing the seed target sequence of miR-204-5p was amplified by PCR and cloned into the pmiR- RB-REPORT™ (Guangzhou RiboBio Co. [score:3]
As shown in Fig. 5A and B, the DVL3 protein levels were markedly decreased in the cells transfected with the miR-204-5p agomir, while transfection with the miR-204-5p antagomir led to a significant increase in DVL3 expression. [score:3]
miR-204-5p regulates the adipogenesis of hADSCs. [score:2]
Our data strongly suggest that miR-204-5p plays an important physiological role in regulating the adipogenesis of MSCs. [score:2]
Conversely, the knockdown of miR-204-5p significantly decreased the extent of adipogenesis (Fig. 2A). [score:2]
To confirm the predicted molecular interaction between miR-204-5p and the 3′-UTR of DVL3, we performed a standard dual-luciferase reporter assay using reporter plasmids carrying the wild-type or mutated 3′-UTR (of DVL3) seed target sequence (Fig. 3B). [score:2]
The role of miR-204 in regulating adipocytic pathways is unclear. [score:2]
We also demonstrate that miR-204-5p promotes adipogenesis by regulating the activity of canonical Wnt/β-catenin signaling in hADSCs. [score:2]
We measured the mRNA expression level of miR-204-5p and DVL3 by RT-qPCR, and found that miR-204-5p expression gradually increased during adipogenesis, by approximately 2.3-, 4.8- and 8.7-fold on days 3, 6 and 9, respectively, compared to the undifferentiated cells on day 0 (Fig. 1A). [score:2]
Taken, our results suggest that miR-204-5p promotes the adipogenesis of hADSCs. [score:1]
Mimics, mimic-NC, agomir (cholesterol-conjugated 2′-O-methyl -modified mimics), agomiR-NC, antagomir and antagomiR-NC of miR-204-5p, were synthe-sized by Guangzhou RiboBio Co. [score:1]
The pmiR-RB-REPORT vector (50 ng) containing either wild-type or mutated human DVL3 3′-UTR was co -transfected into the 293T cells (obtained from Xiangya Cells Center of Central South University, Changsha, China) together with miR-204-5p mimics (100 nM) using Lipofectamine 2000 (Invitrogen). [score:1]
For this purpose, we transfected the hADSCs with either miR-204-5p agomir, agomiR-NC, antagomir or antagomiR-NC and 2 days later, adipogenic differentiation was induced for 9 days, and we then determined the relative activity of Wnt/β-catenin signaling by measuring the expression level of DVL3. [score:1]
By contrast, miR-204-5p had no effect on the luciferase activity of the mutated 3′-UTR reporter (Fig. 3C). [score:1]
Reverse transcription of miR-204 was carried out using a reverse transcription kit (Life Technologies), according to a protocol with specific instructions for miRNAs (Guangzhou RiboBio Co. [score:1]
miR-204 has been described as a ‘switch’ molecule that can control the fate choice between osteogenesis and adipogenesis. [score:1]
[1 to 20 of 45 sentences]
11
[+] score: 155
As shown in Figure 4A,B, the expression of NP was repressed significantly at both mRNA and protein levels in ssc-miR-204 overexpressed cells compared with the control cells, whereas the NP levels were upregulated markedly in cells transfected ssc-miR-204 inhibitors. [score:9]
In summary, the above results suggested that ssc-miR-204 and ssc-miR-4331 suppressed viral HA and NS expression by directly interacting with them respectively, resulting in inhibiting the replication of SIV-H1N1/2009. [score:8]
In order to explore swine miRNAs that could regulate the SIV-H1N1/2009 replication, we predicted potential miRNAs targeting the viral genomic RNA by bioinformatics method, and identified ssc-miR-204 and ssc-miR-4331 as negative regulators of SIV-H1N1/2009 replication by targeting viral HA and NS respectively. [score:7]
As shown in Figure 3A,B, the ectopic expression of ssc-miR-204 or ssc-miR-4331 markedly suppressed the expression of viral HA1 or NS1, respectively, at mRNA levels. [score:7]
In our work, alignment of the binding sites in the viral HA and NS genes for the corresponding seed region of ssc-miR-204 and ssc-miR-4331 was performed among different subtypes (H1N1, H5N1 and H9N2) of influenza A viruses, and results revealed that the sequences of target sites were not conserved, which indicated that ssc-miR-204 or ssc-miR-4331 did not target the corresponding H5N1 and H9N2 viral HA or NS genes to repress their expression. [score:7]
However, the alignment results showed that the sequences of the target sites in viral HA and NS were not conserved across the three different representative subtypes, which indicated that ssc-miR-204 and ssc-miR-4331 might not inhibit the replication of H5N1 or H9N2 influenza A virus by targeting HA and NS respectively. [score:7]
Because of their importance in virus pathogenicity, ssc-miR-204 and ssc-miR-4331 were demonstrated to negatively regulate the replication of SIV-H1N1/2009 by targeting viral HA and NS respectively and repressing their expression levels. [score:6]
SIV-H1N1/2009 Infection Downregulated the Expression of ssc-miR-204 and ssc-miR-4331. [score:6]
A significant increase of viral HA1 or NS1 mRNA expression was observed when endogenous ssc-miR-204 or ssc-miR-4331 was decreased by treating with the corresponding miRNA inhibitors. [score:5]
Ssc-miR-204 and ssc-miR-4331 Repressed the Expression of Viral HA1 and NS1 Respectively, and Inhibited the Replication of SIV-H1N1/2009. [score:5]
As expected, no suppression effect of ssc-miR-204 and ssc-miR-4331 on H9N2 NP expression at mRNA levels (Figure 5D) nor at protein levels (Figure 5F), was observed, which proved that both miRNAs did not have an effect on the replication of H9N2 influenza A virus. [score:5]
Taken together, these results validated that ssc-miR-204 and ssc-miR-4331 directly interacted with the corresponding HA and NS of SIV-H1N1/2009, and the target sites were located in HA1 and NS1, respectively. [score:4]
In our work, ssc-miR-204 and ssc-miR-4331 were downregulated by SIV-H1N1/2009 infection. [score:4]
In summary, this work screened the genome-wide prediction of swine miRNAs and SIV-H1N1/2009 interactions, and for the first time found that ssc-miR-204 and ssc-miR-4331 negatively regulated the replication of SIV-H1N1/2009 by targeting viral HA and NS respectively, which provided us valuable insight into the involvement of swine miRNAs in the swine influenza viruses infection. [score:4]
Human miR-204 was also upregulated in whole blood of H1N1 patients [43]. [score:4]
Since ssc-miR-204 and ssc-miR-4331 negatively regulated the replication of SIV-H1N1/2009, we wondered whether the virus had an impact on the miRNAs expression. [score:4]
Ssc-miR-204 and ssc-miR-4331 Mimics and Inhibitor. [score:3]
However, chicken miR-204 was highly expressed in infected chicken lungs by low pathogenic H5N3 influenza A virus [42]. [score:3]
Similarly, ssc-miR-204 was found to have no influence on the mRNA and protein levels of H5N1 NP (Figure 5C,E), which indicated that it did not inhibit the replication of H5N1 influenza A virus either. [score:3]
The neuraminidase activities of cells supernatants were decreased by ssc-miR-204 from 24 h post-infection, especially, a huge drop was observed at 36 h. Similar results were obtained when cells were treated with ssc-miR-4331 mimics or inhibitors (Figure 4D–F). [score:3]
Validation of ssc-miR-204 and ssc-miR-4331 Targeting Viral HA and NS of SIV-H1N1/2009, Respectively. [score:3]
In conclusion, this result suggested that SIV-H1N1/2009 might weaken the antiviral effect of ssc-miR-204 and ssc-miR-4331 by decreasing their expression levels to facilitate its survival in the host during the infection process. [score:3]
ssc-miR-204 and ssc-miR-4331 were validated to target viral HA1 and NS1 of SIV-H1N1/2009 respectively, then the effect of both miRNAs on the expression of HA1 and NS1 were investigated. [score:3]
However, the relative luciferase activity was only decreased when the cells were cotransfected with ssc-miR-204 and pmirGLO-HA or ssc-miR-4331 and pmirGLO-NS, but remained unchanged when the cells were cotransfected with other pairs of miRNA-genes (Figure 1), which indicated that ssc-miR-204 and ssc-miR-4331 might target viral HA and NS of SIV-H1N1/2009, respectively. [score:3]
As expected, neither of the miRNAs could inhibit the replication of H9N2 influenza A virus effectively, with the same occurring for ssc-miR-204 on H5N1 replication. [score:3]
In addition, in order to further verify that ssc-miR-204 and ssc-miR-4331 inhibiting the replication of SIV-H1N1/2009 is due to the interaction with HA and NS respectively, future work should focus on generating the HA or NS mutated SIV-H1N1/2009 viruses, in which the binding sites for ssc-miR-204 or ssc-miR-4331 are mutated. [score:3]
NPTr cells overexpressed ssc-miR-204 or ssc-miR-4331 by being transfected with the corresponding miRNA mimics and were infected with SIV-H1N1/2009, then total RNA was extracted and reverse transcribed to cDNA which was subjected to quantitative real-time PCR (qRT-PCR). [score:3]
As expected, the decrease or increase trend of luciferase activity was completely abrogated when NPTr cells were treated with pmirGLO-HA-mut together with ssc-miR-204 mimics or inhibitors (Figure 2C), so was the pair of pmirGLO-NS-mut and ssc-miR-4331 (Figure 2F). [score:3]
In order to exclude the possibility of ssc-miR-204 and ssc-miR-4331 targeting the luciferase, we cotransfected ssc-miR-204 or ssc-miR-4331 with the luciferase reporter vector pmirGLO into NPTr cells and found that the relative firefly luciferase activities were not changed significantly (Figure 2B,E). [score:3]
In order to verify this speculation, NPTr cells were transfected with ssc-miR-204 mimics or inhibitors and infected with SIV-H1N1/2009, then the mRNA and protein levels of NP (a conserved viral protein of influenza A virus) were detected using qRT-PCR and western blotting, respectively. [score:3]
These results further indicated the target relationship of ssc-miR-204 and HA, and ssc-miR-4331 and NS. [score:3]
As shown in Figure 5A,B, the target sites in viral HA and NS for the corresponding seed regions of ssc-miR-204 and ssc-miR-4331 were aligned among H1N1, H5N1 and H9N2 influenza A viruses. [score:3]
For the first time, ssc-miR-204 and ssc-miR-4331 were verified to target viral HA and NS respectively by dual-luciferase reporter assays. [score:2]
Therefore, ssc-miR-204 and ssc-miR-4331 might be involved in SIV-H1N1/2009 infection via regulating some host genes. [score:2]
Then, we cotransfected ssc-miR-204 inhibitors with the reporter construct pmirGLO-HA into NPTr cells and found the relative firefly luciferase activity was increased significantly compared with that of control cells (Figure 2B). [score:2]
While HA and NS are important parts of viral genome of SIV-H1N1/2009, ssc-miR-204 and ssc-miR-4331 may negatively regulate the virus replication. [score:2]
Then, the mRNA levels of ssc-miR-204 and ssc-miR-4331 were subsequently quantified by qRT-PCR method. [score:1]
The Effect of ssc-miR-204 and ssc-miR-4331 on the Replication of H5N1 or H9N2 Influenza A Virus. [score:1]
Furthermore, the binding sites for ssc-miR-204 and ssc-miR-4331 were predicted to be located at nt 575–595 in HA and nt 173–199 in NS respectively (Figure 2A,D). [score:1]
This discrepancy might be due to that miR-204 were encoded by different hosts infected by different strains of influenza A viruses, and detected at different time points. [score:1]
In order to address this speculation, NPTr cells were transfected with ssc-miR-204 or ssc-miR-4331 and infected with H5N1 or H9N2 influenza A virus, then the mRNA and protein levels of viral NP were detected using qRT-PCR and western blotting method, respectively. [score:1]
Secondly, the protein levels of viral HA and NS were not assessed after ssc-miR-204 and ssc-miR-4331 treatment respectively, for we did not obtain the effective antibody for HA and NS of SIV-H1N1/2009 and the commercialized antibodies did not function perhaps because of the sequence specificity of SIV-H1N1/2009. [score:1]
However, this antiviral effects of ssc-miR-204 and ssc-miR-4331 were sequence-specific for SIV-H1N1/2009. [score:1]
[1 to 20 of 43 sentences]
12
[+] score: 151
It is not mutually exclusive that the activated STAT3 can upregulate HBV transcription through its interaction with HBV enhancer 1, and at the same time, repress miR-204 expression. [score:6]
Since chronic infection with HBV can increase the risk of HCC development, it is possible that chronic suppression of miR-204 by HBV might contribute to the increased HCC incidence in chronic hepatitis B. Previously, it has been demonstrated that treatment by interleukin-6 (IL-6) and epidermal growth factor stimulated the interaction between HBV enhancer 1 and STAT3 protein, which leads to the activation of HBV gene expression 21. [score:6]
Similar expression levels of total and phosphorylated STAT3 protein (E) and mRNA (F) were detected in HepG2 and HuH7 cell lines stably expressing miR-204. [score:5]
Therefore, we proposed here that HBV infection can activate the phosphorylation of STAT3, which in turn repressed the expression of miR-204, and thus stimulated HBV gene expression and replication. [score:5]
Indeed, the expression of miR-204 was gradually increased upon STAT3 inhibitor treatment (Fig. 4C). [score:5]
In this triad diagram, HBV can stimulate STAT3, which in turn can suppress the level of miR-204, leading to enhanced viral gene expression replication. [score:5]
It is known that the expression of miR-204 can be suppressed by STAT3 activation 15. [score:5]
We found miR-204 is expressed in multiple tissues in rats, with the highest level of expression in the eye and cerebellum by stem-loop real time PCR (Fig. S2). [score:5]
Taken together, our results demonstrated that HBV probably suppressed the expression of miR-204 through STAT3 activation. [score:5]
As shown in Fig. 2A, miR-204 and miR-1236 could each inhibit HBV DNA replication, without altering the level of HBV RNA expression in the cytoplasm (Fig. 2B). [score:5]
As shown in Fig. 4E,F, higher expression of miR-204 driven by the CMV promoter had no apparent effect on the expression of STAT3 protein and mRNA. [score:5]
The expressions of miR-204 and miR-1236 were detected by stem-loop PCR analysis (Fig. S1). [score:3]
The other microRNA, miR-204, inhibited HBV pregenomic RNA encapsidation and capsid assembly. [score:3]
Using Computer-aided programs, we predicted potential target sites of miR-1236 and miR-204 clustering between nt 1521 and nt 2122 on the HBV ayw genome (Fig. 3A). [score:3]
Conversely, miR-204 can inhibit HBV replication through some unknown mechanism (Fig. 4D). [score:3]
MicroRNA miR-204 and miR-1236 can each attenuate HBV replication and gene expression. [score:3]
To address this issue, we cotransfected HepG2 cells with HBV plasmid and miR-204 expression vector and examined the assembly efficiency and stability of intracellular core particles of HBV by native agarose gel (Fig. 5B upper panel). [score:3]
gr) were used to predict potential targets for miR-1236 and miR-204 on HBV genome. [score:3]
Only miR-1236 and miR-130a 5 (data not shown), but not miR-204 and vector control, could reduce HBV protein expression. [score:3]
It is possible that miR-204 might target an unknown host factor (s) involved in capsid assembly or RNA encapsidation. [score:3]
In this scenario, how STAT3 can suppress the level of miR-204 remains unclear. [score:3]
At present, approximately 400 validated targets of miR-204 have been documented in literature 19. [score:3]
To further explore the relationship between miR-204 and STAT3, we established two stable miR-204 -expressing HuH-7 and HepG2 cells lines. [score:3]
Our results suggest that miR-204 might target an unknown host factor(s) involved in capsid assembly or RNA encapsidation. [score:3]
The expression level of miR-204 was always significantly reduced in stable (A) rat, (B) human HBV-producing cell lines, and (C) HBV transgenic mice. [score:3]
We reasoned that a potential target for miR-204 could be at the step of RNA encapsidation and capsid assembly (Fig. 5A). [score:3]
There is no easy way to speculate on which known or unknown miR-204 target might be involved in HBV RNA encapsidation and capsid assembly. [score:3]
Is it possible miR-204 can target STAT3 in a reciprocal manner? [score:3]
It is therefore interesting to ask whether one can restore miR-204 expression in HBV-producing hepatocytes by treatment with S31-201. [score:3]
HBV can reduce the expression of miR-204 through the activation of a STAT3 intermediate. [score:3]
Expression of miR-204 and miR-1236 were reduced in HBV-replicating hepatocytes and HBV-transgenic mice. [score:3]
The methods of engineering the expression vectors of miR-204 and miR-1236 were as described previously 5 33. [score:3]
HBV repressed miR-204 expression through STAT3 activation. [score:3]
How to cite this article: Huang, J. -Y. et al. MicroRNA miR-204 and miR-1236 inhibit hepatitis B virus replication via two different mechanisms. [score:3]
In Fig. 1A–C, we observed that the expression of miR-204 was lower in HBV producing cell lines and transgenic mice. [score:3]
Knockdown of endogenous miR-204-5p or miR-1236 significantly resulted in increased HBV DNA replication (Fig. 2E) and protein synthesis (Fig. 2F). [score:2]
To further study on the regulation of miR-204 will provide more information about the control of HBV replication. [score:2]
In fact, miR-204 is being considered as a tumor suppressor. [score:2]
The dot line and the question mark represent an unknown relationship between miR-204 and STAT3. [score:1]
MiR-204 hairpin precursor can generate both miR-204-5p (miR-204) and its complementary miR-204-3p (miR-204*) from the other arm. [score:1]
To further elucidate the mechanism, we cotransfected an HBV genomic replicon with LNA-miR-204-5p or LNA-miR-1236 into HepG2 cells (Fig. 2D). [score:1]
Human genomic DNA extracted from HepG2 cells was used as a template for PCR amplification of precursor sequences of miR-204 and miR-1236. [score:1]
Briefly, the sequences of human miR-204 and miR-1236 were retrieved from Ensembl database and miRBase (Version 16). [score:1]
Furthermore, miR-204 was also significantly reduced in an HBV transgenic mouse mo del (genotype D, serotype ayw) (Fig. 1C) 10. [score:1]
We focused on miR-204-5p here because the LNA experiment (Fig. 2D–F) confirmed the anti-HBV potential from miR-204-5p. [score:1]
This result supports the notion that miR-204 could interfere with HBV capsid assembly. [score:1]
While miR-204 significantly reduced the level of intracellular core particles, it had no effect on the total amount of core protein by SDS-PAGE. [score:1]
Cotransfection with miR-204 reduced the levels of encapsidated HBV RNAs in HepG2. [score:1]
This LNA experiment confirmed the anti-HBV potential from miR-204-5p and miR-1236. [score:1]
It was puzzling that miR-204 could reduce HBV DNA replication without any apparent reductions in HBV specific RNA and proteins (Fig. 2). [score:1]
In this report, we used the old name miR-204 and the new name miR-204-5p interchangeably. [score:1]
To evaluate the effect of microRNA on viral replication, we cloned the precursors of miR-204 and miR-1236 in miRNA expression vectors, respectively. [score:1]
Cotransfection with miR-204 reduced core particle -associated pgRNA, yet without any apparent effect on total cytoplasmic pgRNA. [score:1]
A positive feed-forward loop summarizes the relationships among HBV, STAT3, and miR-204 (Fig. 4G). [score:1]
[1 to 20 of 54 sentences]
13
[+] score: 131
Although we have shown that DCX is a target for both miR-34c and miR-204, and that over -expression of these miRNAs in IUE experiments significantly inhibit neuron migration in the mouse embryo, we cannot conclude that this migration effect is directly caused by inhibition of DCX. [score:10]
Number of embryos analyzed: miR-34c inhibitor: 5, miR-34c mimic: 5, miR-204 inhibitor: 6, miR-204 mimic: 7, control inhibitor: 9, control mimic: 8. Small RNA sequencing of embryonic porcine cortex across fetal development revealed a remarkable shift in expression levels of a distinct set of miRNAs from embryonic day 60–80 (E60–E80), which is the period of cortical folding in the pig brain (manuscript in preparation). [score:10]
Number of embryos analyzed: miR-34c inhibitor: 5, miR-34c mimic: 5, miR-204 inhibitor: 6, miR-204 mimic: 7, control inhibitor: 9, control mimic: 8. Cortical folding is a complex process orchestrated by spatially controlled gene expression in subsections of the brain, and miRNA is likely to play key roles in the process. [score:9]
miR-34c and miR-204 mimics are shown to reduce DCX 3′UTR luciferase reporter expression, and miR-34c inhibitor increases DCX 3′UTR luciferase reporter expression. [score:7]
Both miR-34c and miR-204 are predicted by TargetScan to target DCX mRNA through 1 and 2 target sites, respectively (Table 1). [score:7]
In accordance with being cognate targets, mimics of both miR-204 and mir-34c were able to significantly reduce luciferase expression, whereas miR-34c inhibitor increased the production from the DCX 3′UTR reporter. [score:7]
MiR-204 and miR-34c are particularly notable upregulated miRNAs, due their almost exclusive expression in E80 cortex tissue (Figure 1B). [score:6]
The most strongly upregulated miRNAs, miR-34c, and miR-204, were shown to alter the extent of neuronal migration in embryonic mouse brain, and their large expression increase during cortical folding in pig, suggests a pivotal role in mediating correct cortical morphogenesis of gyrencephalic animals. [score:6]
miR-204 regulates the EMT by targeting snai1 to suppress the invasion and migration of gastric cancer. [score:6]
To confirm that the predicted target sites are indeed functional targets of miR-34c and miR-204, the DCX 3′UTR was cloned downstream of a luciferase reporter and analyzed in HEK293-H cells. [score:5]
Our finding, that increased miR-34c and miR-204 expression reduces neuronal migration, implies that suppression of EMT related factors could be a contributing mechanism controlling neuronal migration. [score:5]
Both the miR-34 family and miR-204 miRNAs are well known tumor suppressors in several cancers (He et al., 2007; Li et al., 2016) and have been linked to suppression of epithelial to mesenchymal transition (EMT; Hahn et al., 2013; Morizane et al., 2014; Li et al., 2016; Liu et al., 2016). [score:5]
Further support for a conserved functional relationships between DCX and miR-204/34c as well as LIS1 and miR-15a comes from the observation that the respective miRNAs can regulate luciferase expression under control of human derived DCX and LIS1 3′UTRs. [score:4]
Our finding of tightly controlled expression of miR-34c and miR-204 in brain development seems to extrapolate into neuroprotective effects in the aging animal. [score:4]
Detection of miR-204 and miR-34c by in situ hybridization (ISH) at E60 and E80 in the porcine cortex showed clearly increased expression at E80 for both miRNAs (Figure 2A). [score:3]
MiR-204 and miR-34c sequences and their predicted targets in DCX 3′UTR are conserved, implying that the effects of miR-34c and miR-204 on the migration of neurons in the mouse is most likely conserved in higher mammals, such as pigs and humans. [score:3]
Electroporation of miR-204 inhibitor did not significantly alter the radial migration of GFP -positive cells (Figure 3C). [score:3]
Mutating the predicted miR-34c, miR-204 and miR-15a target sites individually in the luciferase reporters abolished the observed effects (Figure 2C). [score:3]
The striking finding that miR-204 and miR-34c exhibit specific expression increases in excess of 100 fold at the time of porcine gyration implies that they have key roles in the timing of the process. [score:3]
DcxDown-3′UTR_WT: chrX:110537676-110538698   1023 bp (Both miR-204 target sites). [score:3]
Aberrant expression of miR-218 and miR-204 in human mesial temporal lobe epilepsy and hippocampal sclerosis-Convergence on axonal guidance. [score:3]
MicroRNA-204 suppresses epileptiform discharges through regulating TrkB-ERK1/2-CREB signaling in cultured hippocampal neurons. [score:3]
Together, these data strongly suggest that miR-34c and miR-204 regulate neuronal migration in the embryonic cortex, in line with our expression and reporter assay experiments. [score:3]
Figure 3 miR-34c and miR-204 regulate cortical neuron migration. [score:2]
The dual regulatory role of miR-204 in cancer. [score:2]
However, we were unable to observe any effect from miR-204 anti-miR (Figure 2C). [score:1]
miR-34c and miR-204 affect neuronal migration. [score:1]
miR-204 shares an identical seed sequence with mR-211 in most animals, however, this miRNA is not annotated in pig, and thus is not found in the analysis of our sequencing experiment. [score:1]
The known link between improper lamination and epilepsy (Stouffer et al., 2016) is highly relevant to our findings, since incorrect levels of both miR-34a and miR-204 have been associated with epilepsy (Hu et al., 2012; Kaalund et al., 2014; Xiang et al., 2016). [score:1]
Representative miR-204 experiment is in Supplementary Figure 2. (C,D) Quantification of GFP -positive cells (% of total) in different layers. [score:1]
Thus, embryonic functions of miRNAs, such as miR-34c and miR-204, which affect cortical morphogenesis, are also likely to affect epilepsy susceptibility later in life. [score:1]
Both miR-34c and miR-204 are conserved between mouse and pig and despite the fact that mice have a non-gyrated brain, the underlying process of neuronal migration is conserved between lissencephalic and gyrencephalic species (Kerjan and Gleeson, 2007). [score:1]
The alkaline phosphatase-labeled probes used for miRNAs were 22 nts and 23 nts in length for miR-204 and miR-34c, respectively. [score:1]
Here we unveil a functional role for two of these miRNAs in neuronal migration, miR-34c and miR-204. [score:1]
[1 to 20 of 34 sentences]
14
[+] score: 109
Other miRNAs from this paper: hsa-mir-335
These findings supported our results regarding miR-204-5p regulation in aging bone process, where up-regulated miR-204-5p was postulated to down-regulate SOX11 and be involved in the cell cycle arrest of osteoblasts, leading to clinical observations of increased bone loss among the geriatric population. [score:8]
Figure 5The target binding site and sequence alignment of miR-204-5p on SOX11 3′UTR at positions of 589-595, 985-991 and 5910-5916 were validated in three microRNA target prediction databases, including miRmap (A), TargetScan (B) and miRDB (C). [score:7]
The target binding site and sequence alignment of miR-204-5p on SOX11 3′UTR at positions of 589-595, 985-991 and 5910-5916 were validated in three microRNA target prediction databases, including miRmap (A), TargetScan (B) and miRDB (C). [score:7]
Analysis of potential molecules involved in miR-204-5p regulation on SOX11To determine the potential interactions between miR-204-5p- SOX11 regulation and other downstream effectors in our aging osteoblast database, we identified miR-204-5p as an upstream regulator in IPA results for all differentially expressed genes. [score:6]
Significant upregulation of miR-204-5p and downregulation of miR-335-3p were observed in women with osteoporotic hip fractures, when compared to those with hip osteoarthritis without osteoporosis. [score:6]
The results showed that miR-204-5p was significantly up-regulated, whereas miR-335-3p was significantly down-regulated, in women with osteoporotic hip fractures compared to those with hip OA but no osteoporosis (Figure 3A and 3B). [score:6]
We further analyzed the 12 microRNAs in the GEO database of osteoporotic fracture array data (GSE74209), and found miR-204-5p to be up-regulated in osteoporotic fracture bone, which was also a potential upstream regulator of the 22 candidate genes in aging osteoblasts identified in IPA analysis. [score:5]
To determine the potential interactions between miR-204-5p- SOX11 regulation and other downstream effectors in our aging osteoblast database, we identified miR-204-5p as an upstream regulator in IPA results for all differentially expressed genes. [score:5]
MiR-204-5p overexpression has been found to induce downregulation of CCND1, resulting in differentiation of human MSCs toward adipogenic rather than osteogenic lineage [45]. [score:5]
Three target sites of miR-204-5p on SOX11 3′UTR were identified in all of the above microRNA target prediction databases, including the position of 589-595 (miRmap score 99.41), 985–991 (miRmap score 96.12) and 5910–5916 (miRmap score 93.40) (Figure 5). [score:5]
As listed in Table 2, KLF7 and SOX11 were the predicted targets of miR-204-5p, while KIAA1462 and SVIP were targets of miR-335-3p. [score:5]
Huang et al. demonstrated that miR-204 inhibited osteogenesis and promoted adipogenesis of bone marrow stem cells through negative regulation of Runx2, an important transcription factor for chondrogenesis and osteogenesis [32]. [score:4]
In our current study, we found that miR-204-5p was 4.56-fold up-regulated in aged osteoblasts, which was validated in a GEO array of trabecular bone specimens from osteoporotic hip fractures in elderly women [26]. [score:4]
Of the two microRNAs identified, miR-204-5p was one of the upstream regulators (p-value of overlap = 8.15E-03, targeting EPHA5, PID1, PLAG1 and SOX11 in this dataset) identified in the IPA analysis result (Figure 4B). [score:4]
In our study, we proposed the role of miR-204-5p- SOX11 regulation in aging osteoblasts, and the potential downstream regulation of BMPR1A/Runx2 signaling by SOX11 (Figure 4B), a signaling pathway involved in osteoporosis and OA [41, 42]. [score:3]
The putative target genes for miR-204-5p in our database were identified as KLF7 and SOX11, with SOX11 the gene of interest. [score:3]
The network analysis revealed 10 out of 22 genes involved in a network associated with cancer, endocrine system disorders, organismal injury and abnormalities, and three of the four putative targets (KLF7, SOX11 and SVIP) by miR-204-5p and miR-335-3p predictions were involved. [score:3]
We then analyzed the binding site and sequence of miR-204-5p in the 3′UTR of SOX11 in miRmap, TargetScan and miRDB. [score:3]
Differentially expressed miR-204-5p and miR-335-3p in osteoporotic hip bone. [score:3]
The results suggest that the regulation of miR-204-5p on SOX11 may play a critical role in the aging process of human bone. [score:2]
Prediction of network of genes involved in the regulation of miR-204-5p in aging human osteoblasts. [score:2]
The results indicate that miR-204-5p may be a key regulator of altered bone health in geriatric population. [score:2]
Analysis of potential molecules involved in miR-204-5p regulation on SOX11. [score:2]
Potential molecules involved in miR-204-5p regulation on SOX11. [score:2]
Here, we proposed a novel finding of miR-204-5p- SOX11 regulation during the process of geriatric musculoskeletal physiological changes. [score:2]
MiR-204-5p has been reported to be a tumor suppressor microRNA in different cancer types [29– 31]. [score:2]
In a rat mo del of osteoporosis, miR-204-5p was one of the microRNAs associated with bone metabolism in bone marrow osteoblastic cells [33]. [score:1]
The putative binding site of SOX11 for miR-204-5p. [score:1]
The network of miR-204-5p related molecules with overlay tool in the IPA was used, and revealed that ALPL, CYP1B1, EGR1, GREM1, IGFBP5, PRDM1 and SOX11 are associated with differentiation of osteoblast and muscle cells, bone mineralization and mineral density, and osteoclastogenesis (Table 4). [score:1]
[1 to 20 of 29 sentences]
15
[+] score: 101
KEGG pathway analysis for the targets of miR-204, 4 differently expressed miRNAs at all postnatal development stages in Large White pig and 9 differently expressed miRNAs at all postnatal development stages in Min pig. [score:9]
GO categories of target genes of miR-204, 4 differently expressed miRNAs at all postnatal development stages in Large White pig and 9 differently expressed miRNAs at all postnatal development stages in Min pig. [score:9]
For example, overexpression of hsa-miR-204 inhibited the proliferation and promoted the apoptosis in breast cancer cells by targeting JAK2 [34]. [score:7]
In renal cell carcinoma, hsa-miR-204 directly targeted SOX4 to inhibit cell proliferation, migration, and invasion [35]. [score:6]
GO analysis identified 45 target genes that were enriched in cell proliferation, including Janus kinase 2 (JAK2) [34], SRY (sex determining region Y)-box 4 (SOX4) [35], insulin-like growth factor binding protein 5 (IGFBP5) [36], cyclin D2 (Ccnd2) [37], and sirtuin 1 (SIRT1) [38], all of which have been reported previously as the targets of miR-204 and involved in the regulation of cell proliferation. [score:6]
However, the target genes of ssc-miR-204 and its role of regulation during the skeletal muscle postnatal development process need further studies. [score:5]
To determine the biological function of ssc-miR-204, we obtained 554 predicted target mRNAs using TargetScan [26]. [score:5]
Moreover, hsa-miRNA-204 inhibition was reported to promote human cardiomyocyte progenitor cells (hCMPC) proliferation, and hsa-miRNA-204 was required for hCMPC differentiation by its target, the activating transcription factor ATF-2 [46]. [score:5]
0156780.g006 Fig 6 To determine the biological function of ssc-miR-204, we obtained 554 predicted target mRNAs using TargetScan [26]. [score:5]
In mice that were fed a high-fat diet, mmu-miR-204-5p was shown to be down-regulated in the adipose tissue [48]. [score:4]
Expression levels of miR-204 at five postnatal development stages between Large White and Min pigs. [score:4]
In addition, the expression of ssc-miR-204 was reported to be higher in Chinese Meishan pigs than that in LW pigs [49]. [score:3]
GO analysis for the targets of miR-204. [score:3]
Thus, we predicted that ssc-miR-204 inhibited skeletal muscle postnatal hypertrophy in M pig by controlling myoblast proliferation. [score:3]
Hsa-miR-204-5p was predicted to play a role in insulin sensitivity and high-density lipoprotein (HDL) cholesterol metabolism by targeting the ACACB transcript in human adipose tissue [47]. [score:3]
In our study, an enriched GO category of the ssc-miR-204 target genes was cellular biosynthetic process, including disheveled segment polarity protein 3 (DVL3), which was previously reported to be modulated by hsa-miR-204 to promote adipogenic differentiation [39] (S5 Table, S1 Fig). [score:3]
The KEGG pathway analysis identified 81 pathways that were enriched for the targets of miR-204. [score:3]
Pathway analysis for the targets of miR-204. [score:3]
Notably, ssc-miR-204, which was detected in all ten libraries, was significantly more highly expressed (P-value <0.01) in M compared with LW at all five developmental stages (S4 Table and Fig 6). [score:3]
Our results showed that ssc-miRNA-204 was significantly more highly expressed (P-value <0.01) in M compared with LW pigs at five postnatal developmental stages. [score:3]
In addition, we identified several potentially important miRNAs that may play regulatory roles in skeletal muscle postnatal hypertrophy and adipogenesis metabolism, especially ssc-miR-204. [score:2]
In future studies, pathway analysis may add further insights into the vital roles played by miR-204 during skeletal muscle postnatal development. [score:2]
MiR-204 had been shown to inhibit cell proliferation in various types of cell. [score:2]
In this study, a total of 263 DE miRNAs between two breeds were identified at one or more developmental stages, among them ssc-miR-204 was common. [score:2]
Another enriched GO category was cellular biosynthetic process, including disheveled segment polarity protein 3 (DVL3), which was shown previously to be modulated by miR-204 to promote the adipogenic differentiation [39] (S5 Table, S1 Fig). [score:1]
[1 to 20 of 25 sentences]
16
[+] score: 90
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-106a, hsa-mir-211
Silencing of hsa_circ_0001859 by small interfering RNAs (siRNAs) increased miR-204/211 expression and subsequently downregulated the miRNA target, ATF2, to suppress its function and thus promote inflammation in SW982 cells. [score:10]
Thus, we speculated that hsa_circ_0001859 can target miR-204/211 to inhibit its expression and hsa_circ_0001859 affects ATF2 expression by acting as a competing endogenous RNA (ceRNA) in the chronic inflammatory response. [score:9]
We suggest that hsa_circ_0001859 functions as a decoy to regulate ATF2 expression by acting as a sponge to directly inhibit miR-204/211 transcription. [score:7]
To confirm that the miR-204/211 inhibitor could reverse ATF2 repression via hsa_circ_0001859 knockdown, siRNA-circ0001859 and miR-204/211 inhibitor were cotransfected into SW982 cells. [score:6]
ATF2 expression was clearly decreased by siRNA-circ0001859 treatment, and this decrease was reversed by cotransfection with siRNA-circ0001859 and miR-204/211 inhibitor in SW982 cells (Figure 5(c)). [score:5]
Additionally, the mRNA and protein expression of IL-1 β, IL-6, and TNF was significantly decreased by siRNA-circ0001859 treatment, and these effects were reduced by cotransfection with siRNA-circ0001859 and miR-204/211 inhibitor in SW982 cells (Figure 5(b)). [score:5]
Empty vector, circ_0001859, siRNA-circ0001859, miR-204/211 inhibitor, or miRNA inhibitor control was then cotransfected into the SW982 cells. [score:5]
Mechanically, hsa_circ_0001859 directly inhibits the miR-204/211 family like a molecular sponge. [score:4]
These results demonstrate that the miR-204/211 family can directly target the ATF2 gene in SW982 cells by interacting with the 3′-UTR region. [score:4]
miR-204 has also been reported to inhibit the STAT3 protein, which is an important molecule for the survival of RA synovial fibroblasts, and this effect can be reversed by the corresponding anti-miRNA [10]. [score:3]
In additional, literature evidence showed that miR-204/211 might have a crucial function in bone remo deling and could inhibit the STAT3 protein, which has been identified as an important molecule for the survival of RA synovial fibroblasts [9, 10]. [score:3]
Hsa_circ_0001859 Inhibits the Transcription Activity of miR-204/211. [score:3]
Based on the endogenous expression of miR-204/211 in the SW982 cell line, we transfected different constructs into SW982 cells (Figure 3). [score:3]
Several studies have reported that miR-204/211 may have a crucial function in bone remo deling by inhibiting Wnt signaling pathways. [score:3]
ATF2 Is a Functional Target of miR-204/211 in SW982 Cells. [score:3]
In our study, we only focused on miR-204/211 as a candidate miRNA cluster that may target hsa_circ_0001859 and ATF2. [score:3]
To screen circRNAs that may be regulated by miR-204/211, we profiled the StarBase v2.0 database and identified 29 circRNAs with binding sites for miR-204/211 (Supplementary Table S6). [score:2]
Based on the previous computational studies, ATF2 was selected as the most RA-relevant gene in this interaction network, and the miR-204/211 family was selected as a potential miRNA regulator in RA progression at the epigenetic level. [score:2]
Here, miR-204 represents the mature sequence of the miR-204/211 family. [score:1]
A synthetic 3′-UTR of ATF2 with the putative miR-204/211 seed region was inserted into the multiple cloning site of the pmiR-RB-Report (Thermo Fisher, USA) vector. [score:1]
Our results showed that miR-204/211 binds the 3′-UTR of ATF2 and that hsa_circ_0001859 can shelter miR-204/211 binding sites. [score:1]
Four miRNAs (miR-204-5p, miR-30a, miR-106a, and miR-211) were identified as linked to the ATF2 gene in the CMM networks. [score:1]
Supplementary 6 Table S6: circRNAs with binding sites for miR-204/211. [score:1]
Hsa_circ_0001859 could compete with ATF2 for miR-204/211. [score:1]
However, miR-204/211 was more statistically significant than the other three miRNAs. [score:1]
Indeed, reduction of luciferase activity was observed when hsa_circ_0001859 and miR-204 were cotransfected into cells simultaneously (Figure 4). [score:1]
SW982 cells were cotransfected individually with wild-type 3′-UTR or the mutant sequence and miR-204 mimics (RiboBio, Guangzhou, China) or a small RNA negative control. [score:1]
The results showed that only the cells transfected with the 3′-UTR of ATF2 and miR-204 exhibited significantly lower luciferase activity. [score:1]
[1 to 20 of 28 sentences]
17
[+] score: 86
The four downregulated miRNAs miR-133a, miR-133b, miR-331-3p, and miR-204 had 1,836 potential target genes, 222 of which were significantly upregulated in our prior mRNA microarray study (Additional file 4: Table S4) [9], consistent with the proposed regulatory action of the miRNAs. [score:10]
Predicted targets for miR-133a, miR-133b, miR-331-3p, and miR-204 were retrieved from the miRNA–mRNA target databases TargetScan, Pictar, and MirTarget2 with the R package RmiR. [score:9]
Bioinformatic analysis predicted 222 genes (see Additional file 4: Table S4) with upregulated expression in AAA based on a prior microarray study [9] were targets of miR-133a, miR-133b, miR-331, or miR-204. [score:8]
Green molecules are the four down regulated miRNAs (miR-133a/miR-133b, miR-204, and miR-331-3p), yellow molecules are experimentally verified target genes of the four miRNAs, and grey molecules are predicted targets of the four miRNAs. [score:6]
We searched the literature for information on miR-133b, miR-133a, miR-204, miR-331-3p, and miR-30c-2*, the five miRNAs with confirmed downregulated expression between AAA and control abdominal aorta. [score:6]
A list of predicted target genes for miR-133a/miR-133b, miR-204, and miR-331-3p that were also upregulated in our prior microarray study. [score:6]
The three upregulated miRNAs were miR-181a* (MIMAT0000270), miR-146a (MIMAT0000449), and miR-21 (MIMA0000076), while five miRNAs, miR-133b (MIMAT0000770), miR-133a (MIMA000427), miR-331-3p (MIMAT0000760), miR-30c-2* (MIMAT0004550), and miR-204 (MIMA0000265), were significantly down regulated (Figure 1). [score:5]
Targets were predicted for qRT-PCR validated miRNAs (miR-133a, miR-133b, miR-331-3p, and miR-204), which were all down regulated in AAA. [score:4]
Bioinformatic analysis indicated that miR-133a, miR-133b, miR-331-3p, and miR-204 target apoptotic genes, which may play a role in the loss of vascular smooth muscle cells in AAA. [score:3]
Two tumor necrosis factor receptors, TNFRSF10B and TNFRSF8, were predicted targets of miR-133a/miR-133b and miR-204, respectively. [score:3]
This finding is highly relevant to AAA pathogenesis, since the decreased level of miR-204 could contribute to the increased mRNA and protein expression level of MMP9 seen in human AAA tissue (Figures 5 and 6), and thereby increase the degradation of the extracellular matrix in AAA [50]. [score:3]
Figure 3 A network of miRNAs miR-133a, miR-133b, miR-331-3p, miR-204, and their target genes. [score:3]
Eight genes (DNM2, DNAJB1, TGFBR1, TGOLN2, BCL11A, EDEM1, SFXN2, YTHDF3) were predicted targets of miR-204 and miR-133a/miR-133b. [score:3]
For example, MMP9 was identified as a target of miR-204 [49]. [score:3]
In the combined qRT-PCR analysis including all the 36 AAA tissue samples and seven controls, the differences in expression levels of the five miRNAs, miR-133b, miR-133a, miR-331-3p, miR-30c-2*, and miR-204, between AAA and control groups were highly significant (Figure 2). [score:3]
CD28, CD86, and ICOS, which are important co-stimulatory molecules, were predicted to be targets of miR-204, miR-133a/miR-133b, and miR-331-3p, respectively [40]. [score:3]
Two genes (APH1A and VHL) were predicted targets of miR-204 and miR-331-3p. [score:3]
Ingenuity Systems® Pathway Analysis tool was used to generate a network from 45 experimentally verified interactions of the four biologically active, validated, down regulated miRNAs (miR-133a, miR-133b, miR-331-3p, and miR-204) (Figure 5). [score:2]
Ingenuity Pathway Analysis® tool was used to generate the network from experimentally observed miRNA–mRNA interactions of miR-133a/miR-133b, miR-204, and miR-331-3p. [score:1]
Eight miRNAs (miR-133a, miR-133b, miR-146 a, miR-181a*, miR-204, miR-21, miR-30c-2*, miR-331-3p) which showed significant differences in their levels with an adjusted p < 0.05 in the microarray experiment were selected for qRT-PCR validation. [score:1]
The functions of miR-133b, miR-133a, and miR-204 have been thoroughly examined in a cardiovascular context [22- 28], but nothing was known about their role in AAA. [score:1]
[1 to 20 of 21 sentences]
18
[+] score: 64
Figure S5 Conservation of (A) Timp3 miR-1/206 targeting seed, (B) Rbm24 miR-125b-5p targeting seed, (C) Tgfbr2 miR-204 targeting seed, (D) Csnk2a2 miR-208b targeting seed. [score:9]
HPASM cells were selected since they express most of the miR-204 pathway components [33], together with the mRNA targets Timp3, Rbm24 and Csnk2a2 mRNA, and provide a mo del for assessing the translatability of predicted miR/mRNA interactions derived from rat, dog and monkey heart tissues. [score:7]
TGF-β receptor 2 (Tgfbr2) has been functionally associated with cardiovascular diseases [30], [32], [48], [53] and miR-204 was observed to directly inhibit Tgfbr2 mRNA in a direct manner both in HPASM cells and in a luciferase assay, thus extending the potential roles for miR-204 in cardiac pathogenesis. [score:6]
A subset of microRNAs (miR-1, miR-125b-5p, miR-204 and miR-208b) was selected for further cross-species analysis and their expression level relative to heart apex is shown in Figure 4. MiR-1 was highly expressed in all rat, dog and cynomolgus monkey heart structures except valves. [score:5]
Interestingly, Tgfbr2 was shown to be directly targeted by miR-204 in human epithelial cells [32], providing us with a suitable positive control for further confirmatory experiments. [score:4]
MiR-1, miR-204 and miR-125b were detected in rat cardiac tissue by in situ hybridization (ISH), and the staining patterns observed were consistent with the relative expression observed by microRNA sequencing and qPCR. [score:3]
We selected 4 genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2), respectively targeted by miR-1, miR-125b, miR-204 and miR-208b, for further analysis. [score:3]
Confirmation of microRNAs Distribution by in situ HybridizationMiR-1, miR-204 and miR-125b were detected in rat cardiac tissue by in situ hybridization (ISH), and the staining patterns observed were consistent with the relative expression observed by microRNA sequencing and qPCR. [score:3]
In contrast, expression profiles of miR-204/Tgfbr2 in canine and cynomolgus monkey, as well as miR-208b/Csnk2a2, in cynomolgus monkey were positively correlated. [score:3]
In summary, we have demonstrated that four genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2) important for cardiac/muscular physiology are post-transcriptionally regulated by miR-1, miR-125b-5p, miR-204 and miR-208b and exhibit conserved cardiac tissue miR-mRNA interactions across species. [score:2]
We have also identified novel microRNA -mediated post-transcriptional mRNA regulatory interactions with potentially important roles in cardiac/muscle physiopathology including miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2. [score:2]
MiR-125b-5p and miR-204 were highly enriched in the valves of all 3 species compared to all other structures although it is noteworthy that significant miR-125b-5p expression was observed in non-valve structures in dog. [score:2]
Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D). [score:1]
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
Figure S6 Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in the cardiac structures in 1 human donor. [score:1]
Here we focused on the characterization of four microRNAs, including myocardial specific miR-1 and miR-208b and valve enriched mir-204 and miR-125b-5p, based on their distinct heart-structure-specific distribution patterns and known roles in cardiac physiology, disease and pathological remo deling. [score:1]
0052442.g007 Figure 7 (A–D) Real-Time RT-PCR of Timp3, Rbm24, Tgfbr2 and Csnk2a2 in HPASM cells transfected with mimics for miR-1, miR-125b-5p, miR-204, miR-499 and miR-208b or with a mimic microRNA negative control. [score:1]
No signal for miR-204 was detected in the myocardium (Figure 5C), while valvular endothelial cells were clearly stained (Figure 5A and B) under the same conditions. [score:1]
The ISH signal for miR-1 was more intense in the myocardium than in the valves (Figure 5G, H and I), and staining for miR-204 and 125b-5p was more intense in the valves than in the rest of the heart (Figure 5A to F), ISH of the liver-enriched miR-122 was performed and used as a negative control (Figure 5J, K and L). [score:1]
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
0052442.g005 Figure 5Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization. [score:1]
0052442.g006 Figure 6 Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D). [score:1]
Similarly to miR-204, miR-125b-5p showed a strong signal in the cardiac valves and could not be detected in the ventricular cardiomyocytes (Figure 5D, E and F). [score:1]
Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in cardiac structures across species. [score:1]
miR-204 in valves (A–B) and ventricle (C). [score:1]
While signals for miR-1 and miR-125b-5p were strong, miR-204 was at the limit of detection, consistent with its relatively low abundance as determined by microRNA sequencing (Table S8). [score:1]
Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization. [score:1]
[1 to 20 of 27 sentences]
19
[+] score: 62
When we examined the expression levels of miR-21, miR-204, and let-7e in ARPE-19 at 48 h after TGF-β2 treatment, we found that the expression level of miR-21 was significantly upregulated by the TGF-β2 treatment, and the expression of miR-204 was significantly inhibited by TGF-β (Fig 3A and 3B). [score:12]
However, we found a significant reduction in miR-204 expression in the vitreous humor of RRD samples, suggesting that dedifferentiated RPECs may be involved in the downregulation of miR-204 expression [37]. [score:8]
Among the downregulated miRNAs in the vitreous of PVD eyes, expression of miR-204 and let-7e has also been reported to decrease, and to be associated with the development of fibrosis of the lung or kidney [26, 27]. [score:7]
As a result, we identified the expression levels of five miRNAs, including let-7e, miR-204, miR-216b, miR-9, and miR-139-5p as significantly downregulated in the PVD group, as shown by lower -ΔCT values (Fig 1C and 1D). [score:6]
When we examined the expression levels of miR-21, miR-204, and let-7e in the vitreous humor of primary fresh RRD samples without fibroproliferation, we found that the expression level of miR-204 in the vitreous humor of RRD eyes was significantly lower than that of the controls, but there were no obvious differences between the RRD and PVR eyes (Fig 2B). [score:5]
We therefore examined whether the TGF-β -induced EMT influenced the expression levels of miR-21 and miR-204 in RPECs. [score:3]
These results suggested that the altered expression of miR-21 and miR-204 in PVD was associated with TGF-β -induced EMT of RPECs. [score:3]
Fold changes in expression levels of miR-21(A), miR-204 (B), and let-7e (C) in RRD, PVR, and PDR samples were determined relative to the control MH sample. [score:3]
Comparisons of expression levels of miR-21, miR-204, and let-7e in the vitreous humor of MH, RRD, PVR, and PDR samples. [score:3]
Fold changes in expression levels of miR-21 (A), miR-204 (B), and let-7e (C) in TGF-β-stimulated ARPE-19 cells were determined relative to the unstimulated control cells. [score:3]
However, the expression levels of miR-204 and let-7e in the vitreous humor of PDR patients were significantly lower than in the control group (Fig 2B and 2C). [score:3]
Expression of MiR-21 and MiR-204 Is Regulated by TGF-β in Retinal Pigment Epithelial Cells. [score:3]
0158043.g002 Fig 2(A, B, and C) of quantitative PCR (qPCR) analyses of miR-21, miR-204, and let-7e levels from the vitreous humor of MH (n = 7), RRD (n = 5), PVR (n = 5), and PDR (n = 10) samples. [score:1]
To identify the miRNAs associated with the pathogenesis of retinal fibroproliferation, we chose to focus on three miRNAs: miR-21 [16– 25], miR-204 [26, 27], and let-7e [28, 29]. [score:1]
0158043.g003 Fig 3(A, B, and C) of quantitative (q) PCR analyses of miR-21, miR-204, and let-7e levels in TGF-β-stimulated ARPE-19 cells. [score:1]
[1 to 20 of 15 sentences]
20
[+] score: 59
This in silico analysis predicted miR- 125b-1* to target 3 mRNAs, miR-146a-5p to target 47 mRNAs, miR-181a-5p to target 14 mRNAs, miR-204-5p to target 12 mRNAs, miR-219a-5p to target 5 mRNAs, and miR-509-3p to target 1 mRNAs for a total 82 targets (see Table 2). [score:15]
Downregulation of miR-204-5p in human gliomas is correlated with poor patient prognosis, and overexpression of miR-204-5p inhibits the proliferation, migration and invasiveness of glioma cells in vitro and in vivo by directly targeting RAB22A (a member of the RAS oncogene family) [67]. [score:11]
In silico analysis using IPA analysis based on the research of targets experimentally validated in previously published studies indicated that miR-125b-1*, miR-146a-5p, miR-181a-5p, miR-204-5p, miR-509-3p and miR-219-5p were upregulated in SPARC expressed cells. [score:8]
Further, miR-204 was shown to regulate autophagy in renal clear cell carcinoma (RCC) by regulating the expression of LC3 [69]. [score:5]
We also demonstrate increased expression of miR-204 in SPARC overexpressed medulloblastoma cells. [score:5]
Several studies have also shown that miR-204-5p is frequently downregulated in papillary thyroid carcinoma, gastric cancer, colorectal cancer, neuroblastoma and endometrial carcinoma, suggesting a common role of miR- 204-5p in human tumorigenesis [64– 68]. [score:4]
We tested the expression of levels of six miRNAs (has-miR-125b-1*, has-miR-146a-5p, has-miR-181a-5p, has-miR-204-5p, has-miR-219-5p and has-miR-509-3p) which were found to be differentially regulated with. [score:4]
Validation of miR-125-b1*, miR-181a-5p, miR-146a-5p, miR-204-5p, miR-219-5p and miR-509-3p upregulation by quantitative real time PCR (qRT-PCR). [score:4]
qRT-PCR was performed on miR-125b-1* (FC = 1.57), miR-181a-5p (FC = 2.21), miR-146a-5p (FC = 1.68), miR-204-5p (FC = 1.57), miR-509-3p (FC = 1.73) and miR-219-5p (FC = 1.57) in SPARC overexpressed medulloblastoma cells (pSPARC) compared to empty vehicle (pEV) treated control samples. [score:2]
However, it remains to be determined whether mir-204 induces autophagy in SPARC mediated autophagy in medulloblastoma cells. [score:1]
[1 to 20 of 10 sentences]
21
[+] score: 49
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
Three of the 107 genes are previously identified targets of the downregulated miRNAs, including mmp14, a known target of miR-133 [64], mmp9 (targeted by miR-204 and miR-338) and timp2 (targeted by miR-24 and miR-204). [score:12]
Conversely, miR-204 was downregulated in zebrafish and bichir, miR-133a was downregulated in bichir, and miR-2184, miR-338 and miR-24 were downregulated in axolotl. [score:10]
S24 Table Zebrafish Ensembl gene identifiers for 107 genes upregulated in three mo dels with predicted miRNA binding sites for miR-2184, miR-204, miR-338, miR-133a and miR-24 and members of the network of commonly up- and downregulated genes with functional interactions to 11 blastema -associated genes. [score:7]
We performed similar analyses to capture potential target genes for the 5 commonly downregulated miRNAs (miR-2184, miR-204, miR-338, miR-133a and miR-24). [score:6]
S23 Table Zebrafish Ensembl gene identifiers for 205 genes upregulated in three mo dels with predicted miRNA binding sites for miR-2184, miR-204, miR-338, miR-133a and miR-24 in all three mo dels. [score:4]
Within this subset of differentially regulated zebrafish miRNAs, we identified 10 miRNAs: miR-21, miR-181c, miR-181b, miR-31, miR-7b, miR-2184, miR-24, miR-133a, miR-338 and miR-204, that showed conserved expression changes with both bichir and axolotl regenerating samples (Table 1). [score:4]
Ten genes were identified among those with the top 2% of interactions in the network, including fgf10, which is predicted to be targeted by miR-204, miR-338 and miR-2164. [score:3]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
Although zebrafish miRNAs have been examined in numerous studies [25, 27, 41– 43], our analysis revealed novel paralogs of 18 miRNAs that do not currently have zebrafish records in miRBase (version 21), including miR-181a, miR-20a, miR-23b, miR-24, miR-29a, miR-103, miR-128, miR-148, miR-181b, miR-199, miR-204, miR-212, miR-221, miR-338, miR-724, miR-2184, let-7b and let-7e. [score:1]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
[1 to 20 of 10 sentences]
22
[+] score: 48
Among the nine T-cell miRNAs affected by TNF-α and downregulated in RA T cells, the expression levels of miR-139-3p, miR-204, miR-214, and miR-760 were increased in patients using biologic agents. [score:6]
Each scatter spot representing average normalized expression level of miRNA in three repeats of each treatment; (b) 13 miRNAs exhibiting aberrant expression in Jurkat cells cultured with TNF-α (20 ng/mL) for 7 days; (c) decreased expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 in RA T cells miRNA, compared with normal T cells. [score:6]
Initially, our studies showed that among the expression of T cell miRNAs affected by TNF-α in Jurkat cells, the expression levels of miR-139-3p, miR-204, miR-760, miR-383, miR-524-5p, miR-136, miR-548d-3p, and miR-214 were significantly decreased in RA T cells. [score:5]
The expression levels of 12 miRNAs, including miR-139-3p, miR-204, miR-760, miR-432, miR-524-5p, miR-136, miR-548d-3p, miR-206, miR-214, miR-383, miR-224, and miR-887 were significantly lower, whereas the expression level of miR-146a was significantly higher, in Jurkat cells after being cultured with TNF-α for 7 days (fold change > 4, p < 0.05, Fig.   1b). [score:5]
Among other miRNAs affected by TNF-α in RA T cells, miR-204 was found to be downregulated in human retinal pigment epithelial cells after exposure to a mixture of inflammatory cytokines containing interferon gamma, TNF-α, and IL-1 beta [36]. [score:4]
The expression levels of miR-204 showed a significant correlation with the use of biologic agents. [score:3]
The expression levels of miR-139-3p, miR-204, miR-214, and miR-760 increased in RA patients receiving biologic agents. [score:3]
The expression levels of miR-139-3p, miR-204, miR-214, and miR-760 increased in RA patients using biologic agents. [score:3]
RA patients of male sex had a significant 0.27-fold decrease (p = 0.019; 95% CI 0.09–0.78) and the use of biologic agents had a significant 4.48-fold increase (p = 0.001; 95% CI 2.02–9.90) in miR-204 expression levels. [score:3]
Decreased expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 were noted in RA T cells. [score:3]
Expression levels of miR-139-3p, miR-204, miR-214, and miR-760 were correlated with the use of biologic agents. [score:3]
The fold changes of expression levels for these miRNAs were 0.42-fold for miR-139-3p, 0.43-fold for miR-204, 0.13-fold for miR-760, 0.32-fold for miR-524-5p, 0.45-fold for miR-136, 0.19-fold for miR-548d-3p, 0.37-fold for miR-214;0.36-fold for miR-383, and 0.14-fold for miR-887, compared with controls. [score:2]
The expression of miR-139-3p, miR-204, miR-760, miR-524-5p, miR-136, miR-548d-3p, miR-214, miR-383, and miR-887 was found to be significantly lower in RA T cells (p < 0.05), compared with controls (Fig.   1c). [score:2]
[1 to 20 of 13 sentences]
23
[+] score: 48
For example, the interaction of miR-204:P2rx7 (Figure 10) suggested a possibility that the down-regulation of miR-204 may lead to up-regulation of its target gene, P2rx7 at E17.5 in Pkd1 [-/- ]kidneys. [score:9]
miR-204 and miR-488 (A) were down-regulated in Pkd1 [-/- ]kidneys whereas miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429 (B) were up-regulated in Pkd1 [-/- ]kidneys. [score:7]
Similarly, down-regulation of miR-10a, miR-126-5p, miR-204, and miR-488 at E17.5 were inversely correlated with up-regulation of Ltbp1, Edil3, P2rx7, and Fgfr3 respectively (Additional file 21). [score:7]
For example, miR-30a-5p may be involved in histone deactylase inhibitor pathways, apoptosis, calcium and Wnt signaling (Figure 9); miR-10a may be involved in TGF-β and hedgehog signaling; miR-204 may be involved in calcium signaling while miR-488 may be involved in MAPK signaling by targeting Fgfr3 (Figure 9). [score:5]
Expression of 9 miRNAs (miR-204, miR-488, miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429), predicted to target significantly regulated genes at E14.5 was assayed using miRNA-qPCR. [score:5]
Among the 9 miRNAs tested at E14.5, only two miRNAs, miR-488 and miR-204, were down-regulated in Pkd1 [-/- ]kidneys compared to WT, miR-96 did not change, and the remaining 6 miRNAs were up-regulated in Pkd1 [-/- ]kidneys compared to WT (Figure 7). [score:5]
Expression of 9 miRNAs (miR-10a, miR-126-5p, miR-200a, miR-204, miR-429, miR-488, miR-96, miR-182 and miR-30a-5p), predicted to target significantly regulated genes at E17.5 was evaluated using miRNA-qPCR assays. [score:3]
We tested this hypothesis by determining the differential expression of 9 miRNAs (mmu-miR-10a, mmu-miR-30a-5p, mmu-miR-96, mmu-miR-126-5p, mmu-miR-182, mmu-miR-200a, mmu-miR-204, mmu-miR-429, and mmu-miR-488) between WT and Pkd1 [-/- ]genotypes at E14.5 and E17.5 (Figures 7 and 8). [score:3]
Therefore, by targeting P2rx7, miR-204 may disrupt calcium signaling. [score:3]
We observed that miRNAs: miRs-10a, -30a-5p, -96, -126-5p, -182, -200a, -204, -429, and -488; and the such as miR-126-5p-Fgf10, miR-488-Fgfr3, miR-182-Hdac9, miR-204-P2rx7 and miR-96-Sox6 (as shown in Table 6) have not been previously reported in ADPKD. [score:1]
[1 to 20 of 10 sentences]
24
[+] score: 47
Other miRNAs from this paper: hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-30a, hsa-mir-132, hsa-mir-155
Zhang et al. identified that ubiquitin-specific peptidase 47 (USP47) and Ras-related protein Rab-22A (RAB22A) were direct functional targets of miR-204-5p in GC and that miR-204-5p inhibited GC cell proliferation by downregulating USP47 and RAB22A [24]. [score:9]
A very recent review believes that miR-204 acts as a tumor suppressor via promoting apoptosis, decreasing resistance of cancer cells to chemotherapy, and suppressing the self-renewal of cancer stem cells [32]. [score:5]
For example, Sacconi et al. demonstrated that miR-204 targeted B cell lymphoma-2 (Bcl-2) mRNA and increased responsiveness of GC cells to 5-fluorouracil and oxaliplatin treatment, and ectopic expression of Bcl-2 counteracted miR-204 proapoptotic activity [15]. [score:5]
Together, these results indicate that regulation of miR-204 expression may hold therapeutic promise for human GC. [score:4]
In the present study, we identified 4 significantly downregulated miRs, hsa-miR-204-5p, hsa-miR-155-5p, hsa-miR-132-3p, and hsa-miR-19b-3p, in human GC tissues by a combination of the high-throughput miR sequencing approach as well as subsequent qRT-PCR validation. [score:4]
Taken together, our data demonstrated a downregulated miR profiling in human GC tissue, which was further agreed by in vitro results for hsa-miR-204-5p, hsa-miR-155-5p, and hsa-miR-132-3p. [score:4]
Interestingly, the altered miR expression pattern was consistent with the previous studies for hsa-miR-155-5p [21, 22], hsa-miR-19b-3p [23], and hsa-miR-204-5p [15, 24] in human GC. [score:3]
This approach allowed us to identify 5 differentially expressed miRs, hsa-miR-132-3p (A, p = 0.013), hsa-miR-155-5p (B, p = 0.031), hsa-miR-19b-3p (C, p = 0.002), hsa-miR-204-5p (D, p = 0.016), and hsa-miR-30a-3p (E, p = 0.019), that were significantly modulated between tumoral and peritumoral tissues (Figure 1). [score:3]
Accumulating studies demonstrated that the expression of miR-204 was drastically downmodulated in various types of cancer, including ovarian cancers, colorectal cancer, pediatric renal tumors, breast cancers, and glioblastoma [28– 30]. [score:3]
Interestingly, several research groups tentatively documented the underlying mechanisms that how miR-204 functions in GC development [15, 24, 31, 33]. [score:2]
Interestingly, we observed a strong difference of the expression levels of hsa-miR-204-5p in all three human GC cell lines, MGC-803 (t = 4.261, p = 0.002), BGC-823 (t = 4.694, p = 0.001), and GTL-16 (t = 18.544, p = 0.000), when compared with that in the normal gastric epithelial cell line, GES-1 (Figure 3). [score:2]
As shown above, the miR sequencing and qRT-PCR results agreed with each other for the modulation pattern of hsa-miR-132-3p, hsa-miR-155-5p, hsa-miR-19b-3p, and hsa-miR-204-5p in human GC. [score:1]
For example, Zhang et al. demonstrated that miR-204-5p was significantly downmodulated in a GC cohort [24]. [score:1]
Another study evidenced that a downmodulation of miR-204 promoted GC cell invasion by activating the SIRT1- (sirtuin type 1)-LKB1 (liver kinase B1) pathway [31]. [score:1]
[1 to 20 of 14 sentences]
25
[+] score: 39
The effect of miR-204 on the increased expression of K [IR]7.1 was caused by miR-204's suppressing action on TGF-βR2, through an unknown mechanism, followed by reduced signaling of protein kinase C which resulted in increased expression of K [IR]7.1. [score:7]
From their data, Wang et al. (2010) proposed that the effect of miR-204 on the increased expression of K [IR]7.1 was caused by miR-204's suppressing action on TGF-βR2 followed by reduced signaling of protein kinase C which resulted in increased expression of K [IR]7.1 as noted by others (Zhang et al., 2008; Figure 2C). [score:7]
Little is known about the physiological role of miR-204 and coupled with a high expression of K [IR]7.1 in the RPE (Yang et al., 2008), Wang et al. (2010) examined if miR-204 regulated K [IR]7.1. [score:4]
miR-204 indirectly suppresses K [IR]7.1 (KCNJ13) in retinal pigment epithelium. [score:4]
Further, they confirmed, with an anti-miR-204 approach as described above, that anti-miR-204 increased the expression of TGF-βR2 of the hfRPE. [score:3]
Initially, Wang et al. (2010) conducted a miRNA expression profile in native human fetal RPE (hfRPE) by qRT-PCR and identified that miR-204 was a highly enriched miR. [score:3]
Wang et al. (2010) identified that the 3′UTR of transforming growth factor - beta receptor 2 (TGF-βR2) was a potential target of miR-204. [score:3]
They demonstrated that anti-miR-204 reduced the expression of K [IR]7.1 compared with control cells, thus suggesting that K [IR]7.1 is regulated by miR-204. [score:3]
Using a luciferase approach, the authors transfected HEK cells with miR-204 mimic and either wt-TGF-βR2-3′-UTR or mutant-TGF-βR2-3′-UTR. [score:1]
miR-204 mimic reduced the luciferase activity for only wt-TGF-βR2-3′-UTR. [score:1]
They further identified miR-204 in fetal RPE culture and native fetal retina and RPE by Northern blot. [score:1]
Wang et al. (2010) have provided the first report of miR-204 in the modulation of K [IR]7.1 in the RPE. [score:1]
Therefore, they conducted semi-quantitative immunoblot experiments in which they transfected hfRPE with anti-miR-204 or anti-miR -negative control oligonucleotide and probed for K [IR]7.1. [score:1]
[1 to 20 of 13 sentences]
26
[+] score: 36
A. Expression of miR-21 and miR-23a, B. Expression of miR-30b and miR-130a, C. Expression of miR-133b and miR-191, D. Expression of miR-204 and miR-208b. [score:9]
Moreover, in a recent study by Courboulin A et al showed the downregulation of miR-204 in human PH subjects and in experimentally induced PH rat mo del and discovered a new regulatory pathway involving miR-204, which was critical to the etiology of PH. [score:5]
The expression of miR-130a and miR-204 did not show any significant pattern changes among the male and female subjects, compared to their total expression. [score:4]
Our data corroborated with the finding of upregulation of both miR-21 and miR-204. [score:4]
Our data also revealed another set of miRNAs that include miR-133b, miR-204 and miR-208b which were significantly upregulated in all moderate PH subjects but, showed further increment in severe PH subjects. [score:4]
The study showed that delivery of synthetic miR-204 to the lungs of animals with PH significantly mitigated disease severity [39]. [score:3]
The expression of miR-204 was increased to 4.42±1.29-fold (p<0.05) in the moderate PH subjects and was further elevated to 7.48±3.8 fold (p<0.01) in severe PH subjects, compared to their controls (Fig. 4B). [score:2]
It is of note that the expression of miR-133b, miR-191 and miR-204 were not significant in severe PH subjects, compared to their moderate counterparts. [score:2]
Mi-130a, mir-133b, miR-191, miR-204 and miR-208b are highly elevated in PH subjects. [score:1]
From this study, we present evidence that a set of increased plasma miRNA level that include miR-21, miR-130a, miR-133b, miR-191, miR-204 and miR-208b, can be used as biomarker for assessment of PH. [score:1]
Furthermore, we included another miRNA which was reported to be involved in PH (e. g. miR-204). [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 33
Expression profiling and computational biological approaches confirmed that miR-204 suppression could up-regulate genes involved in cell cycle and extracellular matrix remo deling associated to cancer metastasis and/or poor prognosis. [score:8]
Predicted miR-204 targets that are up-regulated in HNSCC are significantly related through their biological functions, mainly participating in proteolysis, cell adhesion, cell cycle regulation and cell proliferation. [score:7]
Indeed, miR-204 overexpression is sufficient to suppress cell-matrix interaction, motility and invasiveness in vitro, as well as experimental lung colonization of SQ38 HNSCC tumors in vivo, demonstrating that it represents a potent suppressor of metastasis. [score:7]
Expression pattern of 19 miR-204 targets identified a subtype of HNSCC tumors exhibiting an EGFR-pathway signature [145] and predicted earlier relapse, which suggested a potentially important role of miR-204 in HNSCC prognosis. [score:5]
Using microarray expression profile to analyze 96 cancer-related miRNAs, Hu and coworkers were able to identify ten miRNAs (miR-200a, miR-9, miR-10b, miR-183, miR-204, miR-24, miR-181a, miR-193b, miR-146b and miR-10a) related to cervical cancer survival. [score:3]
The expression of one of these miRNA, miR-204, was highly reduced in HNSCC tumors and this was related to the genomic imbalanced 9q21.1–22.3 locus corresponding to host gene transient receptor potential melastatin 3 cation channel (TRPM3) that has been associated with genetic predisposition for head and neck cancer [144]. [score:3]
[1 to 20 of 6 sentences]
28
[+] score: 30
Up-regulation of miR-204 results in suppression of several target genes involved in neurogenesis, cell-motility, and epithelial-to-mesenchymal transition (EMT), consistent with a role in determining and/or maintaining epithelial cell fate [43], [44]. [score:8]
In Trpm3 -null mice the gene -targeting site is located in exon-17 [49], well downstream from Mir204 located in intron-8, and would not be expected to interfere with ocular expression of the miR-204 transcript. [score:5]
In addition, the I-to-M mutation is located upstream of the human MIR204 homolog hosted in intron-8 of TRPM3 (Figure 3a) and, although it is unlikely, we cannot rule out a deleterious effect on the ocular expression of MIR204. [score:4]
Based on its Pax6 -driven ocular expression pattern, Trpm3/Mir204 represents an intriguing locus for eye disease. [score:4]
By contrast, early ocular expression of both Mir204 and Trpm3 is lost in Pax6 -null mice [40]. [score:2]
Recently, the paired-box transcription factor gene, Pax6, has been shown to co-regulate Trpm3 and Mir204 during mouse eye development, and an evolutionarily conserved mechanism has been described in medaka fish [40]– [42]. [score:2]
In mice, both Trpm3 and its intronically hosted, non-coding micro -RNA gene (Mir204) are co-expressed in ocular tissues, particularly the ciliary-body, lens epithelium, and retinal pigment epithelium [37]– [39]. [score:2]
In the autism family, a paternal deletion of exons 1–9 that included MIR204 was shared by two affected sons and an unaffected daughter [24]. [score:1]
However, no rare variants were found in the maternal copy of TRPM3/MIR204 in the affected sons. [score:1]
The micro -RNA gene, MIR204, is located in intron 8. The predicted I-to-M substitution (red) identified in the family studied here is located in a putative calmodulin -binding (CaM) motif [31] near the N-terminus of isoform k and the novel lens isoform. [score:1]
[1 to 20 of 10 sentences]
29
[+] score: 29
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
VHL-regulated MiR-204 suppresses tumor growth through inhibition of LC3B -mediated autophagy in renal clear cell carcinoma. [score:5]
Network mo deling identifies molecular functions targeted by miR-204 to suppress head and neck tumor metastasis. [score:5]
Downregulation of miR-204 activates Ras in gastric cancer cells (Lam et al., 2011) and reduces lung metastasis of squamous cell carcinomas of the head and neck (Lee et al., 2010). [score:4]
miRNA Gene targets miR-134Brain-derived neurotrophic factor (BDNF) and cAMP response element -binding factor (CREB) miR-204 BDNF and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) miR-211 BDNF and AMPA miR-505 BDNF and AMPA miR-590-3p BDNF and CREBMiR-134 has an important role in the brain, where it is essential for activity -dependent dendritic outgrowth, nerve growth cone guidance, and size of dendritic spines of hippocampal neurons (Schratt et al., 2006; Khudayberdiev et al., 2009; Han et al., 2011). [score:3]
MiR-204 is proposed to play critical roles in the development and progression of malignant peripheral nerve sheath tumors (Gong et al., 2012); it also suppresses tumor cell growth of renal clear cell tumors (Mikhaylova et al., 2012). [score:3]
Transfection of miR-204 into human trabecular meshwork cells increased levels of apoptosis, decreased viability, and increased the accumulation of oxidized proteins, decreased induction of endoplasmic reticulum stress response markers, and reduced expression of inflammatory mediators (Li et al., 2011). [score:3]
miRNA Gene targets miR-134Brain-derived neurotrophic factor (BDNF) and cAMP response element -binding factor (CREB) miR-204 BDNF and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) miR-211 BDNF and AMPA miR-505 BDNF and AMPA miR-590-3p BDNF and CREB MiR-134 has an important role in the brain, where it is essential for activity -dependent dendritic outgrowth, nerve growth cone guidance, and size of dendritic spines of hippocampal neurons (Schratt et al., 2006; Khudayberdiev et al., 2009; Han et al., 2011). [score:3]
Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. [score:2]
MicroRNA-204 critically regulates carcinogenesis in malignant peripheral nerve sheath tumors. [score:1]
[1 to 20 of 9 sentences]
30
[+] score: 27
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
While up-regulation of miR-20 was associated with higher complete remission rates and overall survival [105], miR-204 expression was reduced in AML patients and low miR-204 expression was correlated with short patient survival [114]. [score:8]
A possible explanation is that mir-204 inhibits cell proliferation by targeting the transcription factor SOX4, which was reported in T-cell acute lymphoblastic leukemia [136]. [score:5]
miR-204 expression was reduced in AML patients and low miR-204 expression was correlated with short patient survival [114]. [score:5]
After patients received induction chemotherapy (daunorubicin plus cytarabine), high expression of miR-204 was associated with complete remission [114]. [score:3]
MicroRNA-204 inhibits cell proliferation in T-cell acute lymphoblastic leukemia by down -regulating SOX4. [score:3]
miR-204 targeted HOXA10 and MEIS1 genes [115], which perturb myeloid differentiation and might lead to AML. [score:3]
[1 to 20 of 6 sentences]
31
[+] score: 27
miR-221 was upregulated in TAA, while miR-204 was downregulated in TAA, whereas miR-145 and miR-204 were downregulated in AAA (p < 0.01) (Figure 2). [score:10]
Interestingly, miR-126 and miR-486-5p were found to be upregulated commonly by both qRT-PCR and microarray in TAA patients, while miR-204 was found to be downregulated, indicating the validity of correlation among two different platforms of gene expression analysis. [score:9]
One of the potential treatments for TAA might be the use of miRNA mimics or miRNA antagomirs, specifically for miR-126-3p, miR-204, and miR-486-5p, as expression of these miRNAs were found to be upregulated in TAA specimens. [score:6]
The real-time PCR assay was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems) for miRNAs (miR-1, miR-21, miR-29a, miR-30c-2*, miR-124a, miR-126, miR-133a miR-145, miR-146a, miR-155, miR-204, miR-221, miR-222 miR-331-3p, and miR-486-5p); and RNU44, internal control to analyze specific miRNA expression following the 2−ΔΔ Ct method. [score:2]
[1 to 20 of 4 sentences]
32
[+] score: 24
As mentioned above, these miRNAs such as miR-203, miR-204, miR-205 and miR-217 negatively regulate RUNX2 expression, raising a possibility that miRNA -induced down-regulation of RUNX2 contributes to the suppression of malignant properties of pancreatic cancer cells such as drug resistance (Fig. 4). [score:9]
Meanwhile, Huang et al. found the inverse relationship between the expression levels of miR-204/miR-211 and RUNX2 during adipocyte differentiation, and also demonstrated for the first time that miR-204/miR-211 bind to the 3’-untranslated region of RUNX2, and attenuate its expression, indicating that miR-204/miR-211 act as the negative regulators of RUNX2 [160]. [score:8]
Huang J Zhao L Xing L Chen D MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiationStem Cells. [score:3]
Chen et al. reported that miR-204 is highly expressed in normal pancreatic ductal tissues relative to pancreatic cancer tissues, and promotes pancreatic cancer cell death [169]. [score:3]
Chen Z Sangwan V Banerjee S Mackenzie T Dudeja V Li X Wang H Vickers SM Saluja AK miR-204 mediated loss of Myeloid cell leukemia-1 results in pancreatic cancer cell deathMol Cancer. [score:1]
[1 to 20 of 5 sentences]
33
[+] score: 23
The expression of Runx2 mRNA is regulated by several miRs: miR-30b, miR-133a, and miR-204 (Table 1). [score:4]
Conversely, miR-204 was upregulated from days 3 to 10 when Mg [2+] (2 mM) was added to the calcifying condition. [score:4]
This decrease is similar to what was described in primary mouse aortic SMC in [17], where the expression of miR-204 constantly decreased from day 3 until day 14. [score:3]
For miR-204, the overall expression profile in the calcifying condition showed a constant but not significant decrease from day 3 until day 10. [score:3]
In Figure 2(b), the expression levels of miR-204 stay within the control range at days 1 and 3 and slightly decrease from day 7 onwards in the presence of Pi 3 mM. [score:3]
3.3. miR-29b and miR-204 Expression Is Markedly but Not Significantly Altered. [score:3]
Furthermore, the high variability among the tested donors might have prevented us from obtaining statistical significance in the Pi -induced regulation of miR-29b, miR-204, and miR-223. [score:2]
For both miR-29b and miR-204, further investigations should be conducted in HAVSMC or in other human vascular mo dels to clarify the role that these miRs as well as their putative targets play in the VC process. [score:1]
[1 to 20 of 8 sentences]
34
[+] score: 23
Taken together, miR-204/211 may be a relevant target for diseases involving loss of RPE integrity and RPE dedifferentiation. [score:5]
miR-204 is highly expressed in the RPE, neural retina, lens, and ciliary body, and it plays a critical role in the proper development of the optic cup and lens by regulating Meis2 and modulating Pax6 activity. [score:5]
In a human fetal RPE mo del, miR-204 knockdown led to decreased transepithelial resistance and decreased expression of claudins 10, 16, and 19 [44]. [score:4]
In the RPE, miR-204 and the closely related miR-211, are the two most highly expressed miRNAs. [score:3]
In the human trabecular meshwork, miR-204 has been found to target genes in multiple functional pathways, including apoptosis, endoplasmic reticulum stress, and inflammation [42]. [score:3]
In the medaka fish, knockdown of miR-204 led to microphthalmia, coloboma, and abnormalities in the lens [43]. [score:2]
miR-204/211 has also been shown to be a critical factor in maintaining RPE differentiation [45]. [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Interestingly, one of the key validated targets for miR-204-5p is SPARC (secreted protein acidic and rich in cysteine), a matricellular protein that regulates cell adhesion, matrix assembly and remo deling [44], and one whose spatial pattern of mRNA expression closely resembles that of miR-204-5p. [score:6]
Among the clearest examples of these, miR-196b-5p experienced a 45-fold increase in expression between the caput and caudal regions, while conversely miR-204-5p was down-regulated by approximately 39-fold over the same regions (Fig 5C). [score:6]
Specific examples include miR-204-5p, which was down-regulated by approximately 39-fold between the caput/caudal regions, and has an estimated 530 predicted gene targets in the mouse [43]. [score:6]
Similarly, within the differentially expressed pool of miRNAs, 10 were identified that are intimately involved in regulating intracellular trafficking pathways, including: miR-7b-5p, miR-9-5p, miR-31-5p, miR-92a-3p, miR-106-5p, miR-126-3p, miR-150-5p, miR-204-5p, miR-222-3p, and miR-322-5p (S2 Fig). [score:4]
[1 to 20 of 4 sentences]
36
[+] score: 22
Down-regulation of miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a separated melanoma from normal skin; and down-regulation of miR-203, miR-205, miR-211 (and its homologue, miR-204), miR-23b, miR-26a and miR-26 distinguished melanoma from nevus. [score:7]
NS libraries; and for miR-203, miR-204-5p (and its homologue, miR-211-5p), miR-205-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p down-regulated in PCM vs. [score:4]
Examining a specific KEGG pathway by down-regulation of miR-203, miR-204-5p, miR-205-5p, miR-211-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p in melanoma highlighted the mitogen-activated protein kinase (MAPK) signaling pathway. [score:4]
NS; and miR-203, miR-211-5p (and its homologue miR-204-5p), miR-205-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p were down-regulated in PCM vs. [score:4]
For example, miR-205, miR-23b, miR-26a and miR-26b converge on PDGFRA or miR-211 and miR-204 converge on MAPK1, demonstrating a combinatorial effect of miRNAs on the same target. [score:3]
[1 to 20 of 5 sentences]
37
[+] score: 22
Another report described downregulation of miR-204 in highly invasive melanoma sub-line compared to its non-invasive isogenic counterpart [19], supporting our findings regarding the invasion-inhibiting activity of miR-204 (Fig. 4C). [score:5]
miR-204 did not inhibit the proliferation of HAG cells (Figure 4B). [score:3]
A single report showed that miR-204 inhibited metastasis in head and neck squamous cell carcinoma [41]. [score:3]
In contrast, miR-204 markedly inhibited the invasion activity of HAG cells (Figure 4C). [score:3]
Three miRNAs were within expression range (miR-34a, miR-185 and miR-204, Figure 2C) and two which were silenced (miR-31 and miR-184, Figure 2B) in the HAG cells. [score:3]
Most current studies on miR-184 and miR-204 focus on their roles in development and morphogenesis, which could be predicted computationally (Supplementary Table S1). [score:2]
Tube formation activity was substantially inhibited by miR-34a and miR-185, and more mildly by miR-31 and miR-184, but not by miR-204, as compared to control (Figure 5, A–F). [score:2]
In contrast, very little is known about miR-184, miR-185 and miR-204 in cancer. [score:1]
[1 to 20 of 8 sentences]
38
[+] score: 21
While subsequent confirmed upregulation of miR-182 and downregulation of miR-204 in tumor vs. [score:7]
Although the increased expression, as determined by miRNA microarray, of miR-204 in AA tumors compared to CA tumors could not be confirmed by, our analysis did confirm that of previous reports indicating downregulation of miR-204 in tumor vs. [score:5]
miR-204 was downregulated 3.6-fold in tumor vs. [score:4]
In addition, miR-204, which has been previously reported to be downregulated in tumors (29– 34) was also considered as a potential biomarker. [score:3]
Of the 5 miRNA with both race and tumor main effects, we noted the prominence of miR-182 and miR-204, which were identified based on RANOVA analysis of the SBU miRNA profiles alone (data not shown) and confirmed by the combined data sets. [score:1]
Other miRNAs (i. e., miR-135b and miR-204) exhibited significant difference between tumor and normal tissues only. [score:1]
[1 to 20 of 6 sentences]
39
[+] score: 21
Ectopic expression of miR-204 could inhibit proliferation, migration and invasion of T-ALL cells, indicating that miR-204 may act as a tumor suppressor in the regulation of cell growth and metastasis in T-ALL cells [64]. [score:8]
Moreover, the sex determining region Y-box 4 (SOX4), a transcription factor in development which belongs to the C subgroup of SRY-related HMG box (SOX) transcription factor family [65], was a direct target of miR-204. [score:5]
MiR-204 was decreased in T-ALL, and its ectopic expression suppressed cell proliferation, migration and invasion [64]. [score:4]
Its inactivation could partially mediate the tumor suppressor role of miR-204 in T-ALL [64]. [score:3]
MiR-204 expression was decreased in T-leukemic cells compared to normal T-cell samples. [score:1]
[1 to 20 of 5 sentences]
40
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Top conserved miRNAs in the MaSC/basal population include miR-204 (may target ERα), miR-221/222 (targets ERα and c-Kit) [37, 38], and miR-205 (targets Pten and Bcl-2) [39, 40]. [score:7]
Expression of the MaSC/basal-specific miRNAs miR-34b, miR-204 and miR-218 is upregulated in luminal cells of Ezh2 -deficient samples compared to littermate controls. [score:5]
For example, expression of the BTG4 gene, which harbors the MaSC/basal-specific miRNAs miR-34b and miR-34c, and the TRP3 gene that encompasses miR-204, is not detectable in mammary epithelium. [score:3]
MiR-34b, miR-204 and miR-218 are expressed highly in the MaSC/basal subset. [score:3]
a Track files or read coverage graphs for H3K4me3 and H3K27me3 marks present in the 3 kb upstream region of miR-34b (top panel), miR-204 (middle panel) and miR-218 (bottom panel) in each epithelial subset. [score:1]
Representative track file histograms for the MaSC/basal-specific miRs-34b/c, miR-204 and miR-218, highlighting the distribution of H3K27me3 and H3K4me3 peaks, are shown in Fig.   6a. [score:1]
MiRNAs were extracted from MaSC/basal and luminal cells sorted from either control or Ezh2 -deficient mouse mammary glands, and quantitative RT-PCR was then performed for the MaSC/basal-specific miRNAs miR-34b, miR-204 and miR-218, as their promoter regions were enriched for H3K27me3 marks in the luminal subsets (Fig.   6a). [score:1]
[1 to 20 of 7 sentences]
41
[+] score: 20
Our results revealed up-regulation of miR-20a-5p and miR-451a, and down-regulation of miR-204-5p, miR-424-5p, miR-126-3p, miR-26a-5p and miR-9-5p in the sera of CHD-PAH patients. [score:7]
We found that two miRNAs (miR-20a-5p and miR-451a) were significantly up-regulated and five miRNAs (miR-204-5p, miR-424-5p, miR-126-3p, miR-26a-5p and miR-9-5p) were significantly down-regulated in CHD-PAH sera compared to the healthy controls (Fig. 7). [score:6]
The down-regulation of miR-204 is found in PAH-PASMCs and pulmonary delivering of miR-204 reduces disease severity in a PAH animal mo del 32. [score:6]
We first performed first screen by pooling serum samples of 24 healthy subjects and 24 patients with CHD-PAH and fourteen miRNAs (miR-451a, miR-9, miR-424, miR-223, miR-204, miR-150, miR-328, miR-21, miR-34a, miR-34b, miR-26a, miR-27b, miR-126 and miR-20a) changed more than 1.5-fold. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Using morpholino -based knockdown approach, they demonstrated that the depletion of miR-204 resulted in a number of eye development malformations including eye cup impairment, small eyed embryos, impaired lens development, defect in lens epithelial cells patterning, misplacement and disorganization of primary fiber cells, lens herniation, and failure of optic fissure closure. [score:4]
Conte et al. (2010) have showed that miR-204 targets meis2 and modulates Pax6 transcriptional pathway in medaka Oryzias latipes. [score:3]
Several miRNAs, such as miR-96, miR-124a, miR-181a, miR-181b, miR-182, miR-183, miR-184, and miR-204 are expressed in eye of zebrafish embryo (Cavodeassi et al. 2005). [score:3]
Huang et al. (2010) showed direct negative regulation of Runx2 by miR-204/miR-211 in stroma and myoblast cell lines. [score:3]
Kapsimali et al. (2007) miR-204 Medaka Knockdown, ISH, luciferase reporter assays, qRT-PCR Lens development Conte et al. (2010) let-7 Zebrafish Luciferase reporter assays, qRT-PCR, knockdown Müller glia cells differentiation Ramachandran et al. (2010) miR-7 and miR-454a Zebrafish and medaka ISH ? [score:2]
Ason et al. (2006) miR-7, miR-9, miR-34b, miR-96, miR-124a, miR-125b, miR-132, miR-181b, miR-182, miR-183, miR-184, and miR-204, miR-215, miR-216, miR-217 Zebrafish Microarray, ISH ? [score:1]
Soares et al. (2009) let-7i, miR-15b, miR-17a-3p, miR-21, miR-92b, miR-128, miR-133, miR-146a,b, miR-150, miR-194a, miR-204, miR-210-3p, miR-301a, miR-429, miR-730, miR-733, miR-738, Zebrafish Microarray, northern blot, qRT-PCR, ISH Yin, Lepilina, et al. (2012) Muscle miR-1, miR-21, miR-133a,b,c, miR-203b Zebrafish NGS, qRT–PCR ? [score:1]
miR-30a, miR-184, and mir-204 were localized in lens. [score:1]
Soares et al. (2009) let-7b, miR-9, miR-30a, miR-92b,miR-96 miR-124, miR-181a,b, miR-182, miR-183, miR-184, and mir-204 Zebrafish ISH ? [score:1]
The evolutionary conservation of Pax6-miR-204 pathway is demonstrated in mouse ocular tissues (Shaham et al. 2013). [score:1]
[1 to 20 of 10 sentences]
43
[+] score: 20
Irrespective of wild type or mutated or null p53, after radiation treatment, miR-302a and miR-302c up-regulated, and miR-518f down-regulated in colon cancer cells, whereas after SN38 treatment up-regulated miRNAs were miR-133a, miR-155, miR-204, miR-22, miR-512-3p, miR-517a, miR-517c and miR-708 in the all colon cancer cell lines. [score:10]
Irrespective of p53 status, after radiation miR-302a and miR-302c up-regulated, and miR-518f down-regulated in the all cell lines, whereas after SN38 treatment up-regulated miRNAs were miR-133a, miR-155-3p, miR-204, miR-22, miR-512-3p, miR-517a, miR-517c and miR-708 in the all cell lines (Figure 3, Table 1a). [score:10]
[1 to 20 of 2 sentences]
44
[+] score: 19
It is reported that overexpression of miR-204 repressing migration, invasion and extracellular matrix-adhesion in endometrioid-type endometrial cancer cell line by targeting FOXC1 [38]. [score:5]
Another miRNA, miR-204 is also reported to inhibit invasion and reverse EMT in esophageal cancer by directly binding to the 3’-UTR of FOXM1 mRNA [61]. [score:4]
MEIS2 is a homeobox transcription factor, which exerts multiple functions in vertebrate eye development and has been earlier identified as a miR-204 target [42]. [score:4]
Besides contributing to tumorigenesis, as a target of miR-204, FOXC1 was also confirmed in the trabecular meshwork related to the miR-204-MEIS2 (myeloid ecotropic viral integration site 1 homolog 2) regulatory pathway [40, 41]. [score:4]
Figure 2 A. TXNIP/miR-124a/FoxA2/IAPP; B. miR-204/MEIS2-FOXC1/PAX6/ITGβ1; C. resveratrol/miRNA-520h/PP2A/C/Akt/NF-κB/FOXC2; D. Gα12/AP-1/miR-135b/FOXO1-Gα12/miR-194/MDM2/FOXO1; E. miR-22-miR-486/PTEN/PI3K/AKT/FOXO1; F. TGF-β/FOXO1/miR-21/AKT/NF-KB/Snail; G. AR/PI3K/AKT/FOXO3/AP-1/miR-21/PTEN; H. miR-34a-146b-132-21-217/Sirt/FOXO1. [score:1]
A. TXNIP/miR-124a/FoxA2/IAPP; B. miR-204/MEIS2-FOXC1/PAX6/ITGβ1; C. resveratrol/miRNA-520h/PP2A/C/Akt/NF-κB/FOXC2; D. Gα12/AP-1/miR-135b/FOXO1-Gα12/miR-194/MDM2/FOXO1; E. miR-22-miR-486/PTEN/PI3K/AKT/FOXO1; F. TGF-β/FOXO1/miR-21/AKT/NF-KB/Snail; G. AR/PI3K/AKT/FOXO3/AP-1/miR-21/PTEN; H. miR-34a-146b-132-21-217/Sirt/FOXO1. [score:1]
[1 to 20 of 6 sentences]
45
[+] score: 19
The downregulated miR-204, which has been found to be also dysregulated head and neck cancer [30], displayed very high expression in NRCs with expression level of on average 5.8% (range 1.1 to 8.2%), of the total miRNAs, but gradually decreased following the sub-groups order of no recurrence, recurrence and metastatic sub-groups. [score:9]
Of the 41 downregulated miRNAs, miR125a-5p, miR-204-5p and miR-10a/b-5p were the most abundantly expressed in the normal kidney cortex tissues. [score:6]
Of the most abundantly expressed miRNAs, miR-21, miR-451, miR-125a and miR-204 together contributed to 27% and 18% of total miRNAs in ccRCC and normal kidney tissue. [score:3]
Of interest, miR-204, located on chromosome 9 in intron 6 of the potential Ca2+ channel TRPM [31] may proof to be a robust classifier if validated in an independent set of ccRCC/NRC samples. [score:1]
[1 to 20 of 4 sentences]
46
[+] score: 19
Specifically, the authors showed that miR-192 and miR-204 directly suppress HOTTIP in vitro and further identified the GLS1 gene, which plays a critical role in glutaminolysis and tumorigenesis, as a putative downstream target of HOTTIP. [score:6]
The role of miRNAs in HOTTIP regulation has been further unraveled by Ge et al., who observed a negative correlation between HOTTIP and miR-192/204 in 48 tumor-normal paired liver samples and showed that HOTTIP expression can be regulated by miR-192 and miR-204 via the canonical Argonaute2 mediated interference (siRNA) [136]. [score:5]
Ge Y. Yan X. Jin Y. Yang X. Yu X. Zhou L. Han S. Yuan Q. Yang M. Mirna-192 and mirna-204 directly suppress lncrna hottip and interrupt gls1 -mediated glutaminolysis in hepatocellular carcinomaPLoS Genet. [score:4]
By sponging and competitive binding to miR-204, MALAT1 releases the miR-204 -mediated suppression of sirtuin 1, which in turn promotes HCC migration and invasion [63]. [score:3]
Hou Z. Xu X. Zhou L. Fu X. Tao S. Zhou J. Tan D. Liu S. The long non-coding rna malat1 promotes the migration and invasion of hepatocellular carcinoma by sponging mir-204 and releasing sirt1Tumour Biol. [score:1]
[1 to 20 of 5 sentences]
47
[+] score: 18
During MC3T3 osteogenic differentiation, miR-29b-3p, miR-29c-3p and miR-204 expression was upregulated, both at day 3 and at day 7 of differentiation, while miR-146b-5p and miR-20a-5p were upregulated only at day 7 of differentiation, which is in agreement with microarray results (Figure 2A; Supplementary Figure 1). [score:9]
Considering absolute values of log fold change larger than 1, seven miRNAs (mmu-miR-2137, mmu-miR-204-5p, mmu-miR-762, mmu-miR-146b-5p, mmu-miR-711, mmu-miR-222-3p, mmu-miR-25-5p) were differently expressed after 7 days, while two miRNAs (mmu-miR-3473b, mmu-miR-204-5p) were differently expressed after 3 days of osteogenic differentiation versus basal conditions at the same time points (Supplementary Table 1). [score:5]
Upregulation of miR-146b-5p and miR-204 was not demonstrated in primary human MSC osteogenesis (Figure 2B, Supplementary Figure 1). [score:4]
[1 to 20 of 3 sentences]
48
[+] score: 18
However, only a few miRNAs were differentially expressed between ASC populations (miR-143 downregulated and miR-204 upregulated in MAPC with respect to MSC; miR-129 and miR-199b downregulated and miR-204 upregulated in MAPC respect to MSC and miR-424 downregulated in MSC respect to ADSC) and those differences were smaller than those observed between ESC and ASC. [score:18]
[1 to 20 of 1 sentences]
49
[+] score: 17
We used the miRDB[91, 92] to identify novel miRNA targets (Additional file 2), and we found that the 9 different miRNAs that increased in CD30 [hi] lymphocytes target several genes associated with neoplastic processes (Additional file 2): gga-mir-204 targets FAS apoptosis inhibitory molecule 2, RAB22A (a RAS oncogene family member) and HDAC 9; gga-mir-489 targets FAS associated factor 1 (FAF1) and gga-mir-7 targets RAS related viral oncogene homolog 2. Except FAF1 (which was unchanged) none of these proteins were identified and so we cannot confirm the upregulated miRNA’s potential effects on neoplasia in CD30 [hi] cells. [score:16]
Of these, nine (gga-mir-1b, gga-mir-7, gga-mir-7b, gga-mir-10b, gga-mir-31, gga-mir-130b, gga-mir-204, gga-mir-215, gga-mir-489) are increased, and five (gga-mir-223, gga-mir-124b, gga-mir-140, gga-mir-183, gga-mir-222a) are decreased in CD30 [hi] cells. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 16
ADIPOR2 is targeted by the downregulated miRNAs miR-181d, miR-92a, miR-204 and miR-196b-5p. [score:6]
MiR-204, miR-148a, miR-30a, miR-196b, and miR-17a were downregulated with fold changes of < -1.5 and p values < 0.05. [score:4]
It has target sites for miR-9-5 and miR-204. [score:3]
MiR-204 is also downregulated in adipose tissue of obese mice [68]. [score:3]
[1 to 20 of 4 sentences]
51
[+] score: 15
Other miRNAs from this paper: mmu-mir-203, mmu-mir-204, hsa-mir-203a, hsa-mir-203b
In further support of its pro-tumorigenic properties, Sam68 overexpression may drive tumor progression by downregulating tumor suppressive miRNAs, including miR-203 and miR-204 [13, 16]. [score:8]
In some cancers, high expression of Sam68 correlates with low expression of certain miRNAs shown to target Sam68, such as in the case of miR-203 and miR-204 observed in neuroblastoma and breast cancer, respectively [13, 16]. [score:7]
[1 to 20 of 2 sentences]
52
[+] score: 15
Huang and co-workers [18] recently demonstrated that miR-204 and miR-211, which were up-regulated during adipogenesis of human bone marrow stem cells, also target RUNX2. [score:6]
However, we found that miR-204 and miR-211 were expressed at extremely low levels - for example, below our 0.03% threshold - while miR-30 represented 4.9% of the miRNA reads in adipocytes. [score:3]
miR-103, miR-143, miR-17~92, miR-21, and miR-204/211 have been reported to promote adipogenesis [14- 18], while the miR-27 family inhibits this process [19]. [score:3]
Thus, in our system, this very low abundance of miR-204 and miR-211 suggests that their impact on RUNX2 and differentiation is minor when compared with the highly expressed miR-30 family. [score:2]
This is probably not due to a deep sequencing cloning bias, as miR-204 detection was above average and better than that of miR-30 in a synthetic equimolar miRNA panel that we sequenced in similar conditions (data not shown). [score:1]
[1 to 20 of 5 sentences]
53
[+] score: 15
Restoring miR-204 expression in glioma cells restrains the development of the stem cell-like phenotype of glioma cells [93], suggesting that miR-204 plays a role in the development or maintenance of GSC stemness. [score:5]
Interestingly, miR-204 is markedly downregulated in both GSC and neural stem cells. [score:4]
Ying Z. Li Y. Wu J. Zhu X. Yang Y. Tian H. Li W. Hu B. Cheng S. Y. Li M. Loss of miR-204 expression enhances glioma migration and stem cell-like phenotype Cancer Res. [score:3]
Sex-determining region Y-box 4 (SOX4), a stemness-governing transcriptional factor, is a miR-204 target. [score:3]
[1 to 20 of 4 sentences]
54
[+] score: 15
Based on the collected miRNA-circRNA interactions and the deregulated RNA molecules, we collected several abnormally expressed miRNAs, including 11 downregulated miRNAs (miR-124-3p, miR-129-5p, miR-135a-5p, miR-153-3p, miR-204-5p, miR-208a-3p, miR-211-5p, miR-218-5p, miR-488-3p, miR-490-3p, and miR-504-5p) and 1 upregulated miRNA (miR-373-3p). [score:10]
Interestingly, in deregulated miRNAs, based on canonical miRNAs, we found that some pairs of miR-#-5p and miR-#-3p showed consistent downregulation, including miR-204-5p (log [2]⁡FC = −3.41, FDR < 0.0001) and miR-204-3p (log [2]⁡FC = −3.17, FDR = 0.0146). [score:5]
[1 to 20 of 2 sentences]
55
[+] score: 14
Two miRs, hsa-miR-204 (up-regulated in hypoxia) and hsa-miR-222 (down-regulated in hypoxia), displayed correlated expression patterns in prostate tumors (Pearson R = 0.66, p < 0.0001), and showed statistically significant inverse correlations with tumor T stage, N stage and Gleason score (Table 5). [score:9]
Among these, 15 miRNAs (miR-143, miR-146a, miR-181a, miR-204, miR-222, miR-27a, miR-335, miR-433, miR-491, miR-502, miR-521, miR-92a, miR-127, miR-135b and miR-451) target 211 mRNAs when the confidence limit was set as “Experimentally Observed” only. [score:3]
In another study, Tadorova et al. showed that miR-204 is dysregulated in metastatic PCa in vitro [29]. [score:2]
[1 to 20 of 3 sentences]
56
[+] score: 14
In mouse eye development, miR-204 has been linked to the transcription factor Pax6, as Pax6 directly upregulates miR-204 in order to repress multiple genes, such as Sox2, Sox9 and Sox11 (Conte et al., 2010; Shaham et al., 2013). [score:6]
miR-204 is required for lens and retinal development via Meis2 targeting. [score:4]
Pax6 regulates gene expression in the vertebrate lens through miR-204. [score:4]
[1 to 20 of 3 sentences]
57
[+] score: 14
Downregulation of miR-204 also occurred in PLs and CLs with upregulation of miR-21 in both PLs and CLs. [score:7]
Although expression of miR-204 and miR-328 was variable in lung and PA of the current study, our findings were generally congruent with published data in human PAH specimens [13, 14]. [score:3]
Among these the miR-17–92 cluster, miR-21, miR-145, miR-204 and miR-210 are dysregulated in PASMCs, miR-124 is primarily dysregulated in fibroblasts in the adventitia, and miR-17, miR-21, miR-424, and miR-503 appear to play important roles in PAECs. [score:3]
Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated. [score:1]
[1 to 20 of 4 sentences]
58
[+] score: 13
They showed up-regulation of the expressions of miR-204 and miR-206 and down-regulation of miR-9, miR-100, miR-223, and miR-200c in CD133 [+] cells using RT PCR. [score:9]
Guo and colleagues reported that the expression levels of miR-204, miR-206, miR-223, miR-9, miR-100, and miR-200c were dysregulated in CD133 [+] OVCAR3 human ovarian cancer cells [12]. [score:4]
[1 to 20 of 2 sentences]
59
[+] score: 13
Whether the NRN1 expression level is also regulated by miR-204 in melanoma was not further analyzed by us. [score:4]
This is in agreement with the detection of low expression levels of miR-204 in melanoma [36] eventually accompanied by high NRN1 levels. [score:3]
The deduction is that low miR-204 levels in melanoma allow a high expression rate of NRN1. [score:3]
However, Gao and colleagues described the suppression of NRN1 via miR-204 in rat Schwann cells [35]. [score:3]
[1 to 20 of 4 sentences]
60
[+] score: 13
Mir-24 and mir-204/211 are microRNAs experimentally confirmed to be expressed in the TM and to affect expression of some glaucoma-relevant genes [25, 26]. [score:5]
Among the interesting features of the ten genes is that five (ALDH1A1, CDH11, CH13L1, FGF2, and IGFBP5) were predicted by TargetScanHuman to be targeted by microRNA-23a and −23b cluster microRNAs (mir-23ab, mir-24, mir-27ab) and mir-204/211 (Table 7). [score:5]
It would be of interest to determine if mir-24 and mir-204/211, predicted to target IGFBP-5 mRNA, may selectively affect specific isoforms. [score:3]
[1 to 20 of 3 sentences]
61
[+] score: 13
Other miRNAs from this paper: rno-mir-204
ATF-2 overexpression promoted human cardiac progenitor cell proliferation, further demonstrating the role played by ATF-2 as a target gene of miRNA-204. [score:5]
Therefore, miRNA-204 is required for human cardiomyocyte progenitor cell differentiation and ATF-2 is a target gene of miRNA-204 in human cardiac progenitor cells. [score:3]
The FOSL1 promoter has multiple ATF-2 binding sites and ATF-2 is a target for SMADS (Kannan et al. 1997) and miRNA-204 (Xiao et al. 2012). [score:3]
This study indicates that miRNA-204 is among the regulators that drive progenitor cell proliferation and differentiation, and miRNA-204 might be used to influence cell fate. [score:2]
[1 to 20 of 4 sentences]
62
[+] score: 13
The top 5 upregulated miRNAs were miR-431-5p, miR-3169, miR-371a-3p, miR-1537 and miR-593-3p, and the top 5 downregulated miRNAs were miR-30a-5p, miR-193a-3p, miR-204-5p, miR-184 and miR-29b-3p (Figure 1B). [score:7]
We previously found that miR-204 inhibited epithelial-mesenchymal transition (EMT) by directly targeting SMAD4 in human posterior capsule opacification [19]. [score:6]
[1 to 20 of 2 sentences]
63
[+] score: 13
MiR-204 inhibits osteogenesis of human aortic VICs by directly targeting Runx2 [24]. [score:5]
Cui et al. identified miR-204 as a regulator of vascular smooth cell calcification in vitro and in vivo by targeting Runx2 [14]. [score:4]
Xiao, X. et al. LncRNA MALAT1 sponges miR-204 to promote osteoblast differentiation of human aortic valve interstitial cells through up -regulating Smad4. [score:2]
A new study confirmed that LncRNA MALAT1 sponges miR-204 to promote osteoblast differentiation of human aortic VICs through up -regulating Smad4 [38]. [score:2]
[1 to 20 of 4 sentences]
64
[+] score: 12
Therefore, low-level expression of miR-204 may create a suitable microenvironment for the nerves repair by lightening the transcriptional inhibition of neuritin transcription [137]. [score:5]
MiR-204 promotes apoptosis in oxidative stress -induced rat Schwann cells by suppressing neuritin expression. [score:4]
MiR-204 augmenting the susceptibility of RSC96 Schwann cells to H [2]O [2] -induced apoptosis through down -regulating the expression of neuritin, which act as a neurotrophin and play crucial role in plasticity and repair following nervous system injury. [score:3]
[1 to 20 of 3 sentences]
65
[+] score: 12
According to RNA-seq and qPCR data, miRNA-204-5p was regulated neither in the FC nor in the CB of sCJD, while miRNA-5701 was upregulated only in the CB of sCJD cases. [score:5]
analysis of the housekeeping U6 snRNA (A) and miRNA-378a-3p, miRNA-26a-5p and miRNA-204-5p (B) in the CSF of control (n = 12) and sCJD cases (n = 12). [score:1]
1006802.g008 Fig 8 analysis of the housekeeping U6 snRNA (A) and miRNA-378a-3p, miRNA-26a-5p and miRNA-204-5p (B) in the CSF of control (n = 12) and sCJD cases (n = 12). [score:1]
miRNA-204-5p was selected as negative control, since no changes were detected between control and sCJD cases with small RNA-Seq and analysis. [score:1]
In agreement with this, miRNA-204-5p and miRNA-5701 levels were unchanged in RISC immunoprecipitates between control and sCJD cases (Fig 2B). [score:1]
As negative controls, miRNA-204-5p and miRNA-5701 were tested. [score:1]
Of these, only miRNA-204-5p displayed decreased levels in sCJD cases. [score:1]
Finally, miRNA-204-5p, a miRNA presenting no alterations in the FC and CB of sCJD by RNA-seq analysis, was used as negative control showing no changes among groups at qPCR level. [score:1]
[1 to 20 of 8 sentences]
66
[+] score: 12
Other miRNAs from this paper: hsa-mir-1-2, hsa-mir-206, hsa-mir-1-1
LINC01234 was significantly overexpressed in GC and functioned as a ceRNA for miR-204-5p, leading to the derepression of its endogenous target core -binding factor β (CBFB) [17]. [score:5]
Chen X Long noncoding RNA LINC01234 functions as a competing endogenous RNA to regulate CBFB expression by sponging miR-204-5p in gastric cancerClin. [score:4]
In addition, LINC01234 can function as a ceRNA for miR-204-5p, leading to the derepression of its endogenous target core -binding factor β (CBFB) in GC [17]. [score:3]
[1 to 20 of 3 sentences]
67
[+] score: 12
miRNAs may also indirectly regulate LKB1 signaling, as evidenced by the observation that miR-204 downregulation promotes migration and invasion through upregulation of Sirtuin1 (SIRT1), which leads to downregulation of LKB1 [82]. [score:12]
[1 to 20 of 1 sentences]
68
[+] score: 11
Note: While this manuscript was under review, Wang et al. [56] reported on the expression of miRNAs in fetal human RPE and the possible role of miR-204 and miR-211 in regulating epithelial physiology. [score:4]
Although all the tested miRNAs, including miR-204 and miR-224, were found to be expressed in ARPE-19 cells, the majority did not respond to 4HPR treatment. [score:3]
We also tested miR-204 and miR-224 because they are reported to be expressed in mouse RPE [29, 30]. [score:3]
An exception is the reported detection of miR-204 and miR-224 in mouse RPE using in situ hybridization [29, 30]. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 11
Other miRNAs from this paper: hsa-mir-184, hsa-mir-1469, hsa-mir-4279
In contrast to the above results, the mRNA levels of miR204, miR184, TGFβR2, TGFβR3, and BMP4, which have been previously shown to be downregulated by TGFβ2 in HLE cells (Dawes et al., 2007; Wang et al., 2013), were expectedly downregulated by the TGFβ2 treatment (Fig.   4). [score:7]
There were no apparent differences in the mRNA levels of miR204, miR184, and TGFβR2 in the cells on the unmodified or AGE‐modified BME, possibly because these mRNA levels were already highly downregulated by TGFβ2. [score:4]
[1 to 20 of 2 sentences]
70
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
LncRNA ADNCR (adipocyte differentiation -associated long noncoding RNA) suppressed adipocyte differentiation by function as a ceRNA for miR-204, whose target gene-SIRT1 was known to repress PPARγ activity and inhibit adipocyte differentiation [13]. [score:7]
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 11
The following qRT-PCR analyses showed that radically resected PDAC patients with high miR-204 expression had significantly longer survival times than those with low expression (P = 0.0054) expression [55]. [score:7]
Finally, a recent TaqMan miRNA array for 365 miRNAs identified 24 miRNAs whose expression was altered in two gemcitabine resistant pancreatic cancer cell lines, including the miR-211 homolog miR-204 (sharing the same seed sequence with miR-211). [score:3]
However this association was observed only in the gemcitabine -treated group, supporting the hypothesis that the prognostic role of mir-204/miR-211 is possibly tumor specific, as well as treatment-related. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 11
For instance, the up-expressed miR-143 and miR-138 can, respectively, target the genes, HK2 and HK1, which are the crucial enzymes in glycolysis and so that lead to potential glycemia [28, 29]; miR-9 and miR-204 were reported that they can regulate the insulin secretion by targeting the gene, SIRT1 [30– 32], while miR-96 can decrease the expression of NOC2 which is involved in the insulin secretion [33]. [score:10]
Among the 24 specific miRNAs, 13 of them, such as miR-182/196a/381/499a/99a [6], miR-183 [6, 23], miR-409 [23], miR-146b [6, 24], miR-143 [6, 24], miR-148a [24, 25], miR-204 [5], and miR-9 [6], have been reported to involve in T2D process in mouse or rat. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 10
They described that miR-204 directly targets Meis2 and regulates the Meis2/Pax6 pathway in both lens and retina development. [score:6]
Conte et al. have demonstrated that miR-204 is expressed in the lens placode and presumptive RPE during early medaka development [32]. [score:4]
[1 to 20 of 2 sentences]
74
[+] score: 10
miR-204 shows proadipocytic and antiosteoblastic differentiation effects on MSCs by inhibiting runx2 expression [80], while miR-637 shows similar effects by directly suppressing osterix expression [81]. [score:10]
[1 to 20 of 1 sentences]
75
[+] score: 9
Gga-miR-204 has been shown in mammals to be transcribed in the pancreatic beta-cells to block insulin production by down regulating MAFA, an insulin transcription factor [49]. [score:2]
This hypothesis is supported by the different plasmatic contents found in the R+ and R− lines of three highly conserved miRNAs with a key regulatory role in energetic metabolism (gga-miR-204, gga-miR-let-7f-5p and gga-miR-122-5p) (Table 2). [score:2]
Furthermore, gga-miR-204, which was expected to be significant only between feeding conditions, also exhibited significant differential abundance for the Line contrast (Figure 5). [score:1]
However, only two (gga-miR-204 and gga-miR-2188-5p) of the four miRNAs that were previously identified as differentially abundant between feeding conditions (Condition) were found to be significant (Figure 5). [score:1]
However, only the six miRNAs (miR-2954, gga-miR-2188-5p, gga-miR-365-3p, gga-miR-193b-3p, gga-miR-204 and mmu-miR-145a-5p) which compose Cluster 1 are found to be almost three-fold more abundant when concurrently considering R− and R+ animals (Table S2). [score:1]
In chicken, the plasma levels of gga-miR-204 increase significantly under the feed deprived condition in both chicken lines. [score:1]
The miRNAs were selected among those found differentially abundant in the Condition comparison (gga-miR-204, gga-miR-2188-5p and gga-miR-365-3p), in the Line comparison (gga-miR-2188-3p, and gga-miR-122-5p) or in both (gga-let-7f-5p). [score:1]
[1 to 20 of 7 sentences]
76
[+] score: 9
The gain of this chromosome arm was previously associated with papillary RCCs [83], and our observation in clear cell RCC implies a possible regulatory relation between miR-204/211 and the genes in this region as an alternate mechanism of up-regulation of this group of genes. [score:5]
One example in ccRCC is the miR-204/211 family, which was significantly down-regulated in ccRCC samples. [score:4]
[1 to 20 of 2 sentences]
77
[+] score: 9
More interestingly, they found that MSC exosomes suppressed the hypoxic activation of STAT3 and un-regulated the levels of miR-204, which could be inhibited by STAT3. [score:6]
miRNA(s) Source Donor cell Recipient cell Target gene Reference miRNA-210 Cell culture BEC Fibroblast ATG7Fujita et al., 2015 miRNA-191,miRNA-126, miR125a Cell culture EC MacrophagesSerban et al., 2016 miR-204 Mouse lung MSC Lung immune cells and immune cells STAT3 pathwayLee et al., 2012 miR-146a, miR-155 Cell culture DC Immune cellAlexander et al., 2015 BEC, bronchial epithelial cell; EC, endothelial cell; MSC, mesenchymal stem cell; DC, dendritic cell. [score:3]
[1 to 20 of 2 sentences]
78
[+] score: 9
Real-time PCR revealed that hsa-miR-133b, hsa-miR-204-5p, hsa-miR-30e-5p, hsa-miR-4270, hsa-miR-129-2-3p, hsa-miR-202-3p, hsa-miR-195-5p, hsa-miR-664b-3p, hsa-miR-497-5p, hsa-miR-34b-5p, hsa-miR-513a-5p, and hsa-miR-101-3p were statistically upregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3A). [score:3]
Figure 3 A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
[1 to 20 of 3 sentences]
79
[+] score: 9
During disease progression, massive corneal vascularization is also observed, which is associated with increased expression of angiopoietin-1 and downregulation of miR-204, a negative regulator of angiopoietin-1 [94]. [score:9]
[1 to 20 of 1 sentences]
80
[+] score: 9
We previously detected that miR-204-5p could directly regulate EMT by targeting SMAD4 in posterior capsule opacification (PCO) known as a complication of cataract surgery [17]. [score:5]
In our previous study [17], we found that miR-204-5p, miR-30a-5p, miR-204-3p, and miR-184 were significantly downregulated in PCO samples. [score:4]
[1 to 20 of 2 sentences]
81
[+] score: 9
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-138-2, hsa-mir-138-1, hsa-mir-346
miR-204 inhibits osteoblast differentiation of BMSCs, while adipocyte differentiation is promoted when miR-204 is overexpressed in these cells [14]. [score:5]
For example, miR-138, miR-204, and miR-20a have been reported to regulate osteoblast differentiation by targeting various osteoblast genes [13]– [15]. [score:4]
[1 to 20 of 2 sentences]
82
[+] score: 9
Other miRNAs from this paper: hsa-mir-4431
Two microRNAs, ssc-miR-204 and ssc-miR-4431, were found to target viral haemagglutinin (HA) and non-structural protein (NS), respectively, and inhibit viral replication, providing insights into virus–host interaction and control of the virus in swine population. [score:5]
Zhang S. Wang R. Su H. Wang B. Sizhu S. Lei Z. Jin M. Chen H. Cao J. Zhou H. Sus scrofa miR-204 and miR-4331 Negatively Regulate Swine H1N1/2009 Influenza A Virus Replication by Targeting Viral HA and NS, RespectivelyInt. [score:4]
[1 to 20 of 2 sentences]
83
[+] score: 9
For example, it has been reported that NEAT1 can promote lung cancer progression through the miR-377-3p–E2F3 axis, regulate EMT through the miR-204/ZEB1 pathway in nasopharyngeal carcinoma, and serves as a downstream target of ERα to play a critical role in carcinogenesis of prostate cancer 12, 20, 28. [score:4]
Moreover, NEAT1 could regulate the miR-377-3p/E2F3 pathway in non-small cell lung cancer, and regulate the miR-204/ZEB1 axis in nasopharyngeal carcinoma 19, 20. [score:3]
Lu Y The long non-coding RNA NEAT1 regulates epithelial to mesenchymal transition and radioresistance in through miR-204/ZEB1 axis in nasopharyngeal carcinomaTumour Biol. [score:2]
[1 to 20 of 3 sentences]
84
[+] score: 9
The differentially expressed miRNAs relative to fibroblasts included the strongly upregulated miR-363 (∼12 fold up), miR-204 (∼ 5 fold up), miR-582-5p (∼ 3 fold up) and the significantly downregulated miR-608 (∼70% down), miR-34a (∼60% down), miR-768-5p (∼80% down), and miR-582-3p (∼70% down). [score:9]
[1 to 20 of 1 sentences]
85
[+] score: 8
[36] As expected, inflammation -associated miRNAs 146a and 146b were significantly upregulated in unstable plaques in comparison with adjacent quiescent tissue, whereas miR-29 and miR-204, which are inversely associated with osteoblastogenesis and arterial calcification, were downregulated in mineralized regions of the atherosclerotic plaque. [score:7]
MicroRNA-204 regulates vascular smooth muscle cell calcification in vitro and in vivo. [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 8
Of all miRNA-mRNA pairs, we also selected hsa-miR-409-5p, which played roles in cell proliferation and apoptosis [16], along with its predicted target genes, SMARCC1 and EFNB1, and another two miRNAs, hsa-miR-19-3p and hsa-miR-204-5p to validate the microarray results. [score:3]
The expression of hsa-miR-138 (a), hsa-miR-409 (b), hsa-miR-19 (c) and hsa-miR-204 (d) were tested in fetal hippocampus tissues of DS and control group. [score:3]
The expression of hsa-miR-19 and hsa-miR-204 were reduced in DS group compared to control group. [score:2]
[1 to 20 of 3 sentences]
87
[+] score: 8
For example, in mammals, miR-7, miR-129-5p, miR-490-3p and miR-204 and miR-211 have been proven to act as tumor suppressors [21], inhibiting the progression and proliferation of hepatocellular carcinoma [22], pulmonary and intestinal carcinoma [23] and breast cancer [24]. [score:5]
Lee H. Lee S. Bae H. Kang H. Kim S. J. Genome-wide identification of target genes for miR-204 and miR-211 identifies their proliferation stimulatory role in breast cancer cellsSci. [score:3]
[1 to 20 of 2 sentences]
88
[+] score: 8
MiR-204 has been demonstrated to have a dual function as a tumor-suppressive miRNA and/or an oncomiR in different cancers [44– 46]. [score:3]
In prostate cancer, miR-204 acted as an oncomiR in neuroendocrine-like prostate cancer cells but as a tumor suppressor in prostatic adenocarcinoma cells [47]. [score:3]
Even in the same cancer type, miR-204 also had a dual regulatory function in different cancer subtypes. [score:2]
[1 to 20 of 3 sentences]
89
[+] score: 8
MicroRNA-204 decreased the expression of FOXC1 as well as its target genes: CLOCK, PLEKSHG5, ITGβ1, and MEIS2, indicating its involvement in the disease [38]. [score:6]
Rats with increased IOP due to a hypertonic saline eye injection had decreased expression of MicroRNA-181c, MicroRNA-497, MicroRNA-204, Let-7a, MicroRNA-29b, MicroRNA-16, MicroRNA-106b, and MicroRNA-25 in their retinas [34]. [score:2]
[1 to 20 of 2 sentences]
90
[+] score: 8
Considering only the specimen-specific miRNAs, miR-122-5p was the most expressed in plasma exosome samples (median reads = 32,512 reads) while miR-655-5p (median reads = 792 reads), miR-204-5p (median reads = 750 reads) and miR-4741 (median reads = 28 reads) were the most abundantly expressed in stool, urine, and cervical scrapes, respectively (Supplementary Figure 2C). [score:5]
However, these variants were detected by imposing two and three 5′ mismatches on a 14- and 15 nt sub-sequence of miR-204, respectively. [score:1]
The only exceptions were two 5′ variants of miR-204. [score:1]
All the miRNAs analysed were associated with a high chi-square statistic (merit) in the attribute selection analysis with miR-204-5p, miR-5698, and miR-335-3p associated with the highest merit (Supplementary Table 2D). [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 8
miR-204 is overexpressed in ccRCC and results in concomitant downregulation of THRB expression. [score:8]
[1 to 20 of 1 sentences]
92
[+] score: 8
EphB2 is posttranscriptionally regulated by miR-204, which is downregulated in both glioma cells and neural stem cells. [score:5]
Given the ability of miR-204 to target SOX4, it is suggested that altered abundances of SOX4 and EphB2 together are involved in modulating stemness and migration of glioma cells [72]. [score:3]
[1 to 20 of 2 sentences]
93
[+] score: 7
miRNA-940 was the most down-regulated one with a more than fourfold change between the two examined groups while miRNA-204 was the most up-regulated one (∼3.6-fold). [score:7]
[1 to 20 of 1 sentences]
94
[+] score: 7
Dedifferentiation of cultured fetal HRPE cells is a consequence of the decreased expression of miR-204 and miR-211 resulting from the downregulation of microphthalmia -associated transcription factor [39]. [score:6]
Wang et al. reported that miR-204 and miR-211 play critical roles in maintaining epithelial physiology and barrier function of RPE [38]. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 7
MiR-940 was found as most down-regulated and miR-204 as most up-regulated miRNA [9, 10, 13]. [score:7]
[1 to 20 of 1 sentences]
96
[+] score: 7
Deletion of the miR-221/222 binding site in the Angptl2-3′UTR reporter (Fluc-Angptl2-3'UTR-Δ 221/222) was performed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer's instructions miR-221, miR-222, miR-211, miR-204 or miR-135a overexpression vectors were constructed by inserting sequences including the full-length mature microRNA sequences into pBApo-CMV (Takara Bio). [score:3]
Relative luciferase activity in NRCMs harbouring the reporter and transfected with control pcDNA3.1 vector or miR-221, miR-222, miR-211, miR-204 or miR-135a expression vectors. [score:3]
org database identified five candidates, including miR-135a, miR-204, miR-211, miR-221 and miR-222, predicted to bind to the Angptl2 mRNA 3′UTR. [score:1]
[1 to 20 of 3 sentences]
97
[+] score: 7
The miRNAs downregulated the most included the miR-141/miR-200 and miR-30 families, as well as miR-192, miR-204, and miR-215, which play key roles in maintaining epithelial cell phenotype [17, 18], and their downregulation is in accordance with the EMT-like change occurring in cultured BCD cells. [score:7]
[1 to 20 of 1 sentences]
98
[+] score: 7
Other miRNAs from this paper: hsa-mir-203a, hsa-mir-211, hsa-mir-203b
Xiong et al. showed that miR-204 inhibited the proliferation and invasion of renal cell carcinoma cells by inhibiting the expression of RAB22A [17]. [score:7]
[1 to 20 of 1 sentences]
99
[+] score: 7
Down-regulation of miRNA-204 by LMP-1 enhances CDC42 activity and facilitates invasion of EBV -associated nasopharyngeal carcinoma cells. [score:4]
has also been shown to suppress cellular miR204 to increase cdc42 and NPC cell line invasion and metastasis (Ma et al., 2014). [score:3]
[1 to 20 of 2 sentences]
100
[+] score: 7
Among miRNA analyzed, miR-23b, miR-30d, miR-132, miR-140-3p, miR-145, miR-150, miR-204 were up-regulated in OA chondrocytes whereas miR-22, miR-25, miR-26, miR-30c, miR-92b, miR-127, miR-194, miR-197, miR-296-5p, miR-342-3p, miR-488 were down-regulated in OA chondrocytes (Figure  1B). [score:7]
[1 to 20 of 1 sentences]