sort by

143 publications mentioning hsa-mir-199b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-199b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 292
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2
Thus, miR-199b emerges as a novel tumor suppressor in CRC and its downregulation is a common alteration which contributes to PP2A inhibition in this disease. [score:10]
In conclusion, our results show that miR-199 downregulation is a frequent alteration in metastatic CRC that emerges as a novel therapeutic target and a contributing mechanism to SET overexpression in this disease. [score:10]
Moreover, significant lower miR-199b was significantly downregulated in the subgroup of patients with SET overexpression (Figure 1D), suggesting that altered expression miR-199b is a molecular mechanism that contributes to deregulate SET and PP2A activation status in CRC patients. [score:9]
Association between miR-199b downregulation and molecular and clinical parameters are included in Table 1. Interestingly, we observed miR-199b dowregulated in 17 out of 32 cases with SET overexpression, suggesting that low miR-199 is a relevant contributing alteration to deregulate SET in a subgroup of CRC patients. [score:8]
The mean expression value of the global cohort (ΔCtcohort) was used to obtain the relative expression of each sample (ΔΔCt) and the fold change calculated as 2 [−ΔΔC]T. Downregulation of miR-199b was considered when the expression in a sample was lower than mean minus SD of the patient cohort, corresponding to 0.378 fold change. [score:7]
This observation together with the significant lower miR-199b expression found in the subgroup of SET -overexpressing mCRC patients suggest a role of miR-199b in SET -mediated PP2A inhibition in CRC. [score:7]
In order to assess whether miR-199b affects oxaliplatin sensitivity through SET inhibition, we modulated SET expression in oxaliplatin treated SW480 and HT-29 cells ectopically expressing miR-199b. [score:7]
Thus, we first quantified miR-199b in 5 CRC cell lines previously reported to have SET overexpression [6], observing that miR-199b was downregulated in 4 out of 5 cases. [score:6]
Transfection of pSET-3′UTRwt in SW480 cells ectopically expressing miR-199b showed decreased luciferase activity, indicating that miR-199b binds to the SET 3′UTR, negatively regulating its expression. [score:6]
Among those metastatic CRC patients without SET overexpression, we observed miR-199b downregulated in 7 out of 65 cases. [score:6]
Interestingly, we found that miR-199b and CD133 expression show a negative correlation (Supplementary Figure S9B), further suggesting that miR-199b deregulation could be affecting the CD133 expression status of CRC cells. [score:6]
Of importance, these findings would also indicate the existence of alternative mechanisms in those SET -overexpressing cases without miR-199b downregulation that should have to be elucidated in future studies. [score:6]
In this report, we identified miR-199b downregulation as a common alteration with high clinical relevance that represents a potential contributing mechanism to SET overexpression in metastatic CRC patients. [score:6]
Moreover, multivariate analyses demonstrated that miR-199b downregulation was an unfavorable independent factor associated with OS and PFS in mCRC, which further confirm its prognostic value in this disease. [score:6]
Therefore and considering that miR-199b seems to be a molecular cause of SET overexpression in a subgroup of metastatic CRC patients, we hypothesized that miR-199b downregulation could have clinical impact in metastatic CRC. [score:6]
Interestingly, we found low miR-199b expression associated with development of lymph metastasis (37.9% versus 19.1%, p = 0.049), presence of synchronous metastasis at diagnosis (32.8% versus 12.8%, p = 0.026) and SET overexpression (53.1% versus 10.8%, p < 0.001). [score:6]
In concordance with previous observations in medulloblastoma [23], we show lower miR-199b expression in CRC with metastatic disease. [score:5]
Interestingly, we observed that SET overexpression was able to restore oxaliplatin sensitivity (Supplementary Figure S5), suggesting that miR-199b regulates oxaliplatin sensitivity in CRC cells through a SET negative regulation. [score:5]
Of note, the transfection with anti-miR-199b only promoted a slight reduction in PP2A activity probably due to the low basal miR-199b expression together with the SET overexpression status in both SW480 and HT-29 cells. [score:5]
MiR-199b is downregulated and affects SET expression and PP2A activation status in CRC cells. [score:5]
Due to SET is an endogenous PP2A inhibitor and miR-199b negatively regulates SET, we analyzed whether miR-199b deregulation could modulate PP2A in CRC cells. [score:5]
Although 3-fold increase in CD133 expression was observed in DLD-1 colonospheres no expression of miR-199b was detected, similarly than in DLD-1 parental cells (data not shown). [score:5]
Moreover, miR-199b also functions as a tumor suppressor in medulloblastoma, hepatocellular carcinoma and breast cancers by affecting targets such as HEIS1, HIF1α or HER2 [23– 25]. [score:5]
Interestingly, low miR-199b levels inversely correlated with SET expression and independently predicted shorter overall and progression-free survival defining a subgroup of metastatic CRC patients with very poor outcome candidate to be treated with SET/PP2A targeting drugs such as FTY720. [score:5]
In their work, Garzia et al. provided relevant findings supporting that miR-199b downregulation in metastatic medulloblastoma cells was probably due to a methylation -based epigenetic regulation of this microRNA. [score:5]
In addition to SET, miR-199b has been reported to regulate other important targets such as HEIS1, HIF1α or HER2 in medulloblastoma, hepatocellular carcinoma and breast cancers [23– 25]. [score:4]
Importantly, we observed that miR-199b downregulation was predictive of clinical benefit in those patients who received oxaliplatin -based chemotherapy (N = 39; p = 0.018) (Table S3). [score:4]
We generated colonosphere-derived cells from the DLD-1, SW480 and HT-29 cell lines in which we observed CD133 enrichment together with miR-199b downregulation (Supplementary Figure S9A). [score:4]
We then evaluated molecular causes that could lead to SET overexpression in CRC, analyzing whether an altered expression of miR-199b could be involved in SET deregulation in CRC. [score:4]
Of relevance, multivariate analysis demonstrated that ECOG and miR-199b downregulation have an independent prognostic value in our patient cohort in both OS (Table 2) and PFS (Supplementary Table S4). [score:4]
Of importance, miR-199b downregulation determined poor outcome and clinical benefit in those cases treated with oxaliplatin -based chemotherapy. [score:4]
Thus, we found that miR-199b downregulation showed higher prognostic impact in both OS and PFS in the KRAS wild type subgroup. [score:4]
Prevalence of miR-199b downregulation in metastatic colorectal cancer and its association with molecular and clinical parameters. [score:4]
Moreover, the antitumor effects of miR-199b on cell growth is probably due to its role as negative SET regulator since the co -expression of miR-199b together with SET almost totally restored proliferation of CRC cells. [score:4]
Interestingly, we show here that miR-199b is downregulated after colonosphere generation, which are CD133-enriched cells. [score:4]
Clinical significance of miR-199b downregulation in metastatic colorectal cancer. [score:4]
Of importance, we observed that miR-199b downregulation determined substantially shorter OS in these patients (median OS, 11 versus 31.5 months, p = 0.052), although significance was not achieved probably by the low number of cases studied. [score:4]
Finally, we analyzed the potential role of miR-199b deregulation on CD133 expression. [score:4]
Interestingly, our findings indicate that miR-199 downregulation is a common event that plays an oncogenic role in CRC cells. [score:4]
Altogether, these preliminary results suggest that miR-199b overexpression could be playing a role in CRC liver metastasis development. [score:4]
Mir-199b was found downregulated in 24 of 97 cases (24.7%). [score:3]
Interestingly, a negative correlation was found between miR-199b and SET expression (Supplementary Figure S3). [score:3]
Interestingly, we found that miR-199b -overexpressing SW480 cells showed higher sensitivity to oxaliplatin treatment. [score:3]
This issue was further supported by the decrease in SET levels together with PP2A activation observed after miR-199b overexpression in CRC cell lines. [score:3]
Of importance, we also observed that ectopic expression of SET significantly restored cell proliferation in SW480 cells transfected with pre-miR-199b (Figure 2C). [score:3]
We next assessed the effects of miR-199b modulation on SET expression in SW480 cells using pre- and anti-microRNAs specific for miR-199b. [score:3]
Although transfection with anti-miR-199b induced PP2A inhibition significance was only achieved in HT-29 cells. [score:3]
Of relevance, we found that those patients with low miR-199b expression showed a substantially shorter OS (median OS, 9.7 versus 30 months, p < 0.001) (Figure 4A) and PFS (median PFS, 8.6 versus 15.4 months, p = 0.003) (Figure 4B). [score:3]
Clinical significance of miR-199b expression levels in metastatic CRC. [score:3]
Despite some data in the literature describe miR-199b tumor suppressor roles in human cancer [20– 25], nothing is known about its function in CRC. [score:3]
These findings are in concordance with the fact that anti-miR-199b only induced a discrete increase of cell viability whereas miR-199b overexpression led to a marked reduction of cell growth. [score:3]
For transfection experiments, CRC cells were seeded in 6-well plates and transfected with 10 μl of Lipofectamine 2000 (Life Technologies) and 2 μg of SET plasmidic vector or 20 nM of a miR-199b specific mirVana™ miRNA Mimic and Inhibitor (Ambion). [score:3]
These results prompted us to analyze SET and miR-199b expression levels in a cohort of 97 patients with metastatic CRC. [score:3]
These findings are concordant with the fact that miR-199b negatively regulates SET, which has been described to modulate resistance to oxaliplatin and 5-FU treatments in CRC [18]. [score:2]
Of importance, a negative feedback loop of regulation has been reported between miR-199b and HES1, a key Notch effector, then impairing the CD133+ stem cell-like subpopulation of tumor cells [23, 31]. [score:2]
Altogether, these results would indicate that SET regulation is a key event which mediates miR-199b -induced antitumor effects in CRC. [score:2]
We next stratified our cohort by KRAS mutation status, observing that miR-199b shows higher prognostic value in those patients with wild-type KRAS (median OS, 8.6 versus 30 months, p = 0.001; median PFS, 5.8 versus 15.4 months, p = 0.017) than in those cases with mutated KRAS (median OS, 13.5 versus 31.5 months, p = 0.032; median PFS, 8.7 versus 12.6 months, p = 0.080) (Figure 5). [score:2]
These findings could have a potential therapeutic relevance since FTY720, a PP2A-activating drug that binds and blocks SET [28], has recently shown to resensitize CRC cell to cetuximab [29] and our results suggest that miR-199b could be playing a role via SET regulation. [score:2]
MiR-199b is a SET inhibitor [19, 20] which has also been involved in acquired chemoresistance in chronic myeloid leukaemia or ovarian cancer [21, 22]. [score:2]
Prognostic impact of miR-199b in metastatic CRC patients stratified by KRAS mutation status. [score:2]
Analysis using the same construct with the mutated miR-199b seed region showed no changes in luciferase activity, confirming that miR-199b directly binds to SET (Supplementary Figure S1). [score:2]
In order to investigate whether miR-199b is deregulated in CRC patients, we analyzed miR-199b expression levels in a cohort of 97 patients with metastatic CRC. [score:2]
To investigate its biological relevance as a potential tumor suppressor in CRC, we assessed the effects of miR-199b modulation on cell growth. [score:1]
However, only slight effects on cell growth were found by anti-miR-199b in SW480 and HT-29 cells (Figure 2B and Supplementary Figure S4B). [score:1]
Therefore, these observations would indicate a potential SET-independent prognostic value for miR-199b which needs to be further confirmed in forthcoming studies. [score:1]
As indicated above, miR-199b has been reported to have prognostic value in hepatocellular and papillary thyroid carcinomas [24, 26]. [score:1]
Moreover, miR-199b had significant prognostic value in OS in both subgroups of patients younger (median OS, 11.9 versus 34.2 months, p = 0.003) and older than 70 years (median OS, 3.9 versus 26.9 months, p = 0.002). [score:1]
As expected, we observed PP2A activation in both SW480 and HT-29 cells after pre-miR-199b transfection. [score:1]
Although miR-199b predicted PFS in younger patients (median PFS, 9.7 versus 22.5 months, p = 0.009), significance in PFS was not achieved in the subgroup of elderly cases (median PFS, 3.8 versus 12 months, p = 0.119) (Supplementary Figure S6). [score:1]
Interestingly, we observed a reduced proliferation in SW480 cells transfected with a pre-miR-199b in comparison with those transfected with a negative control (Figure 2A). [score:1]
These results would indicate a potential relationship between miR-199b and CD133 in CRC cells that needs to be further explored in forthcoming studies. [score:1]
Association between miR-199b and clinical and molecular parameters in 97 patients with metastatic CRC. [score:1]
We quantified miR-199b levels using Taqman Low Density Arrays (TLDAs) panel A (Applied Biosystems). [score:1]
As expected, we found decreased and increased SET levels in SW480 cells transfected with pre- and anti-miR-199b, respectively (Figure 1B). [score:1]
This observation is in concordance with our in vitro results and further supports that miR-199b increases sensitivity to oxaliplatin in CRC cells. [score:1]
Furthermore, miR-199b has been reported to be involved in acquired resistance to different antitumor therapies in human cancer such as imatinib in chronic myeloid leukemia [21], cisplatin in ovarian cancer [22] or trastuzumab in breast cancer [25]. [score:1]
Moreover, we analyzed CD133 in 64 metastatic CRC patients observing a negative correlation between CD133 and miR-199b. [score:1]
We first performed luciferase assays to validate the role of miR-199b as a negative SET regulator in CRC. [score:1]
SW480 cells were transfected with 20 nM of pre-miR-199b (Ambion) and a pmiR-Glo construct empty or including the SET 3´UTR with the wild type or mutated miR-199b seed region. [score:1]
Similarly, we observed an enhanced sensitivity to 5-FU treatment in both SW480 and HT-29 cells transfected with pre-miR-199b (Figure 3B). [score:1]
[1 to 20 of 80 sentences]
2
[+] score: 252
Other miRNAs from this paper: hsa-mir-100, hsa-mir-4270
Obviously, decreased expression of SIRT1 was detected when miR-199b was overexpressed, whereas the inhibition of miR-199b led to upregulation of SIRT1 at both the mRNA and protein level (Figure 5C, D). [score:10]
SIRT1 is upregulated while KISS1 is downregulated in CRC tissues and SIRT1 is antagonistically associated miR-199b expression. [score:9]
In addition, after the overexpression of miR-199b, SW480 and SW620 cells showed a dramatic mesenchymal-epithelial transition (MET)-like transformation with significant upregulation of E-cadherin, as well as downregulation of Vimentin, MMP-2, and MMP9 (Figure 3E). [score:9]
Meanwhile, the suppression of miR-199b expression resulted in upregulation of SIRT1. [score:8]
Since our previous studies showed that SIRT1 was significantly overexpressed in CRC [23], and the results obtained by the application of the online prediction software TargetScan 6.2, DIANA LAB, and PicTar all indicated the presence of miRNA responsive elements within the 3′UTR of SIRT1 as putative miR-199b targets (Figure 5A), we further evaluated whether SIRT1 was the direct target of miR-199b. [score:8]
Silencing of SIRT1 expression resulted in functional inhibition of invasion and migration of CRC cells, an effect was similar to that of miR-199b overexpression. [score:7]
This is the first investigation to directly analyze miR-199b expression in primary CRC tissues and matching liver metastatic tissues and to show significantly downregulated expression of miR-199b in metastatic lesions. [score:7]
Of these miRNAs, miR-4270 exhibited the highest degree of upregulation, whereas miR-199b expression manifested the most considerable decrease. [score:6]
C. The effects of overexpression of miR-199b on SIRT1 expression at mRNA level and protein level. [score:5]
Underexpressed miR-199b was found to target HIF-1oin hepatocellular carcinoma [27] and prostate cancer [28]. [score:5]
The average gene expression from NCM460 was designated as 1. B. Relative expression of miR-199b after transfected with miR-199b mimics and its negative control (NC), detected by qRT-PCR. [score:5]
In contrast, the knockdown of SIRT1 also led to appreciable effects on miR-199b expression, suggesting that there might be a loop regulation between miR-199b and SIRT1. [score:5]
E. showed the expression levels of invasion related molecules MMP2 and MMP9, the epithelial-mesenchymal transition (EMT) marker E-cadherin and Vimentin after overexpression of miR-199b. [score:5]
Association of SIRT1 expression level with miR-199b expression in CRC tissue samples. [score:5]
D. The effects of inhibition of miR-199b on SIRT1 expression at mRNA level and protein level. [score:5]
Lauvrak et al. [30] reported that miR-199b-5p and miR-100-3p were downregulated in highly aggressive osteosarcoma cell lines. [score:4]
SIRT1 is a direct target of miR-199b. [score:4]
Moreover, Joshi et al. [29] discovered that miR-199b downregulation was closely associated with imatinib resistance in chronic myeloid leukemia. [score:4]
In the present investigation, we showed that miR-199b could significantly inhibit the expression of SIRT1 by directly combining to the 3′UTR of SIRT1 mRNA. [score:4]
The average miRNA expression from NC was designated as 1. C. The invasive ability of SW480 and SW620 cells was assessed by Transwell assay after overexpression of miR-199b. [score:4]
Therefore, we concluded that the regulation of SIRT1 might be one of the mechanisms by which miR-199b exerts its metastasis suppressor functions. [score:4]
Figure 3Metastasis suppressive effects of miR-199b in CRC cell lines in vitro and in vivo A. Relative miR-199b expression level in six CRC cell lines compared to the normal colorectal cell line NCM460. [score:4]
For example, downregulation of miR-199b with increased mTOR was observed in endometrioid endometrial carcinoma [26]. [score:4]
The results above strongly indicated that downregulated miR-199b predicted poor prognosis in patients of CRC. [score:4]
We further evaluated the expression level of SIRT1 mRNA and protein after the regulation of miR-199b expression. [score:4]
The expression level of miR-199b in tissue samples and its relevance to prognosis. [score:3]
Therefore, the investigation of the mechanism underlying the dysregulation of miR-199b in CRC might provide important clues to improve the understanding of CRC progression, contribute to the development of potential biomarkers for CRC prognosis, and guide the exploration of effective therapeutic targets for CRC. [score:3]
B. Relative miR-199b expression level in CRC tissues and CRN tissues (n=60). [score:3]
Metastasis suppressive effects of miR-199b in CRC cell lines in vitro and in vivo. [score:3]
In the present study, we sought to identify SIRT1 as a target of miR-199b and explore the effects of miR-199b/SIRT1/KISS1 signaling in the progress of CRC metastasis. [score:3]
We demonstrated that the decreased miR-199b expression is correlated with poor prognosis in patients with CRC, and is closely associated with the late TNM stage and distant metastasis, whereas it is not related to tumor size, differentiation, and lymphatic invasion. [score:3]
These findings strongly support the implication that miR-199b exerts suppressive effect in CRC metastasis. [score:3]
B. Spearman correlation was performed to assess relationship between expression levels of SIRT1 and miR-199b (r=−0.5425). [score:3]
Transwell and healing wound assays indicated that the upregulation of miR-199b resulted in a weaker ability of invasion and migration in both SW480 and SW620 cells (Figure 3C, D). [score:3]
In addition, multivariate analysis showed that the low miR-199b expression and distant metastasis were two independent prognostic factors for a poor overall survival rate of CRC patients. [score:3]
Figure 5 A. Illustration of SIRT1 3′UTR as well as the seed sequence of miR-199b showing the predicted target region on the 3′UTR of SIRT1 mRNA. [score:3]
The results indicated that miR-199b was significantly downregulated in the liver metastatic tissues (Figure 2A, P <0.01), which exhibited a good consistency with the results of the microarray assay. [score:3]
We analyzed the correlation of miR-199b and SIRT1 expression in CRC tissue samples. [score:3]
The relationship between miR-199b expression and the clinicopathological features of CRC was analyzed by the Pearson's χ2 test. [score:3]
Functionally, we observed a weaker invasion and migration ability and elevated sensitivity of CRC cells to chemotherapeutic medicines after miR-199b overexpression. [score:3]
Verification of the decreased expression of miR-199b in CRC liver metastatic tissues. [score:3]
Spearman's correlation showed that the expression of miR-199b was inversely related to that of SIRT1 in tissues (Figure 6B). [score:3]
Thus, these clinical and experimental findings described above clearly and strongly support the conclusion that miR-199b is a suppressor of CRC metastasis. [score:3]
A final concentration of 50 nM SIRT1 siRNA, miR-199b mimics, miR-199b inhibitor, or their corresponding negative controls (Ribobio Co. [score:3]
A. Illustration of SIRT1 3′UTR as well as the seed sequence of miR-199b showing the predicted target region on the 3′UTR of SIRT1 mRNA. [score:3]
The results revealed that the decreased miR-199b expression level in tumor tissues (Figure 2B) predicted a higher occurrence rate of late TNM stage (P=0.038) and distant metastasis (P=0.044), whereas no significant association with age, gender, tumor size, tumor differentiation, or lymph node metastasis (Table 2) was found. [score:3]
MiR-199b directly targets SIRT1 in SW620 cells. [score:3]
Meanwhile, the lower miR-199b expression level indicated a poorer prognosis in CRC patients who displayed a shorter median survival (Figure 2C). [score:3]
However, it is suggested that the context -dependent function of miR-199b in different types of cancer might be highly dependent on its targets of signaling pathways [31, 32]. [score:3]
Futhermore, miR-199b caused a suppressive effect on metastasis progression in these cells. [score:3]
In this study, we acquired both clinical and experimental evidence supporting the critical role of miR-199b in the suppression of SIRT1/CREB/KISS1 signaling pathway in the metastasis process of CRC. [score:3]
Our findings clearly evidenced a novel and negative role of miR-199b in the regulation of SIRT1, leading to the activation of CREB/KISS1 in CRC cells. [score:2]
A. Relative miR-199b expression level in six CRC cell lines compared to the normal colorectal cell line NCM460. [score:2]
For distant metastases assay, miR-199b-overexpression SW620 cells were injected into the caudal vein of mice. [score:2]
Importantly, we revealed that SIRT1 was negatively regulated by miR-199b, causing a subsequent increase of the level of acetylated CREB, which in turn activates the KISS1 signaling pathway. [score:2]
C. Kaplan-Meier survival curve for overall survival assay by miR-199b expression in 60 CRC patients. [score:2]
MiR-199b suppressed CRC cell invasion and migration both in vitro and in vivo. [score:2]
All of the above results suggest that miR-199b might be a novel prognostic predictor in CRC. [score:1]
To validate the microarray data, we used qRT-PCR to evaluate the miR-199b expression level in another 30 paired samples of primary CRC tissues and such of liver metastasis. [score:1]
It has been suggested that miR-199b plays a central role in cancer progression and metastasis, including breast cancer [8], prostate cancer [9], osteosarcoma [10], and medulloblastoma [11]. [score:1]
In summary, our current investigation identified miR-199b as a miRNA type that is a significant suppressor of metastasis in CRC. [score:1]
Other researchers found that miR-199b was associated with metastasis and prognosis in renal clear cell carcinoma [31]. [score:1]
To explore the role of miR-199b in chemotherapy, we treated SW480 and SW620 cells with different concentrations of 5-FU and oxaliplatin, the two leading chemotherapeutic drugs used for clinical treatment of CRC. [score:1]
The relationship between miR-199b expression and clinicopathologic characteristics in CRC patients. [score:1]
The relationship between the expression of miR-199b and SIRT1 was evaluated by Spearman's correlation. [score:1]
After transfection with miR-199b mimics, the IC [50] of SW480 cells were significantly decreased both for 5-FU (5.56 vs. [score:1]
However, the function of miR-199b in CRC and CRC metastasis is still not clarified. [score:1]
In addition, miR-199b appears to be an effective prognosis predictor in patients with CRC. [score:1]
More importantly, we used an in vivo study to convincingly demonstrate that miR-199b significantly repressed distant metastasis of CRC cells. [score:1]
Recently, a growing body of evidence has indicated that miR-199b is involved in the process of metastasis in various types of cancers. [score:1]
Metastases in lungs were observed in NC group but little in miR-199b group. [score:1]
In a nude mice mo del, the transfection with miR-199b lentivirus consistently repressed the metastasis of tumor cells in lungs and livers (Figure 3F and Supplementary Figure S1). [score:1]
Furthermore, multivariate analysis confirmed that, together with distant metastasis, miR-199b was an independent prognostic factor for CRC (Table 3). [score:1]
SW620 cells in 24-well plates were co -transfected with luciferase vectors (wild or mutant) for SIRT1 and either miR-199b mimics or NC mimics or were co -transfected with luciferase vectors containing the KISS1 promoter sequences with or without CREB luciferase reporter plasmids. [score:1]
Figure 2 A. Relative expression of miR-199b in 30 pairs of CRC tissues and CRM tissues measured by qRT-PCR. [score:1]
In this study, we focused on elucidating the role of miR-199b in CRC progression. [score:1]
First, pmiR-RB-ReportTM-WT-SIRT1 and pmiR-RB-ReportTM–MUT-SIRT1 were co -transfected with miR-199b mimics into SW620 cells. [score:1]
The miR-199b -transfected-SW620 cells displayed a similar result of IC [50] changes (4.26 vs. [score:1]
Decreased miR-199b indicated poor prognosis of CRC patients. [score:1]
Ltd, Shanghai, China) containing miR-199b (LV-miR-199b) or negative control sequences were applied to infected CRC cells for conducting an animal study. [score:1]
[1 to 20 of 80 sentences]
3
[+] score: 156
Atrasentan up-regulated miR-199b-5p expression, down-regulated klotho expression, and increased the antioxidant ability of HK-2 cells exposed to a high concentration of glucose. [score:11]
To further demonstrate the relationship between miR-199b-5p and klotho, the HK-2 cells were transfected with a miR-199b-5p mimic or inhibitor to overexpress or down-regulate the expression of miR-199b-5p (Fig. 5A,E). [score:10]
However, when cells were co-incubated with the histone deacetylase inhibitor Trichostatin A (TSA), miR-199b-5p expression levels were up-regulated at higher levels (Fig. 4A). [score:8]
org data bank and that the activation of miR-199b-5p inhibited the 3′ UTR activity of klotho and down-regulated its expression level in HK-2 cells. [score:8]
MiR-199b-5p also targeted klotho and down-regulated its expression, illustrating a potential mechanism for the protective effect of atrasentan against renal tubular injury in DN. [score:7]
A luciferase reporter assay showed that the miR-199b-5p mimic significantly decreased the 3′ UTR activity of klotho (Fig. 5B) and inhibited its expression (Fig. 5C,D), whereas the miR-199b-5p inhibitor had the opposite effects (Fig. 5F–H). [score:6]
miR-199b-5p targeted klotho and regulated its expression in HK-2 cells. [score:6]
Atrasentan improved renal function, decreased miR-199b-5p expression, and increased klotho expression in STZ -induced DN mice. [score:5]
Increased miR-199b-5p expression (Fig. 3A) and decreased klotho expression (Fig. 3B) were observed in the HK-2 cells exposed to a high concentration (20 mmol/L) of glucose. [score:5]
The HK-2 cells were transfected with an miR-199b-5p mimic/inhibitor or NC, and the expression of miR-199b-5p was quantified by real-time PCR (A,E). [score:5]
Recently, He et al. found that klotho was a target gene of miR-199a-5p in cancer 18, suggesting that the miR-199 family may be involved in the regulation of klotho in DN. [score:4]
Atrasentan led to a decrease in histone acetylation, suggesting one possible mechanism by which it may down-regulate miR-199b-5p. [score:4]
In current study, we focused on the function of miR-199b-5p in the regulation of klotho expression in renal tubular injury of DN. [score:4]
The HK-2 cells were exposed to various concentrations of TSA (0.1, 0.5 and 1.0 μmol/L) for 72 h and the expression of miR-199b-5p was then quantified by real-time PCR (A). [score:3]
org database, klotho is a potential target of miR-199b-5p (Suppl. [score:3]
Atrasentan altered the expression of miR-199b-5p and klotho and the antioxidant ability of HK-2 cells. [score:3]
Administrated cells with methylase 5′-Aza-dC, no alteration of miR-199b-5p expression was observed (data not shown). [score:3]
U6 and β-actin served as control genes to normalize the expression of miR-199b-5p and klotho, respectively. [score:3]
Real-time PCR was used to detect serum and renal tubular epithelial cell miR-199-5p expression (D). [score:3]
miR-199b-5p participated in the effects of atrasentan on the expression of klotho, antioxidant activities, and caspase activity of HK-2 cells. [score:3]
Atrasentan altered the miR-199b-5p and klotho expression levels of STZ -induced DN mice. [score:3]
The miR-199b-5p mimic reversed the atrasentan -induced increase in the expression of klotho (Fig. 6A). [score:3]
We also found that miR-199b-5p targeted klotho at two binding sites using the MicroRNA. [score:3]
The expression levels of miR-199b-5p and klotho were assessed with a real-time PCR system (Applied Biosystems 7900 Fast Real-Time PCR System, USA) with Power SYBR® Green PCR Master Mix (Applied Biosystems, USA). [score:3]
How to cite this article: Kang, W. -L. and Xu, G. -S. Atrasentan increased the expression of klotho by mediating miR-199b-5p and prevented renal tubular injury in diabetic nephropathy. [score:3]
In the present study, high glucose (20 mmol/L) significantly increased the expression level of miR-199b-5p in HK-2 cells. [score:3]
Interestingly, the effects of the miR-199b-5p mimic on klotho expression, antioxidant ability, and caspase-3 activity were all dramatically reversed in the HK-2 cells treated with 20 mmol/L glucose. [score:3]
The expression of miR-199b-5p was quantified by real-time PCR (A). [score:3]
As shown in Fig. 7, overexpressed miR-199b-5p resulted in an increase in renal function parameters such as urinary albumin/creatinine, serum BUN, serum creatinine, urinary KIM-1, urinary NGAL and urinary NAG (Fig. 7A–F). [score:3]
Fluorescence quantitative PCR of cDNA was performed with primers specific for miR-199b-5p and klotho expression. [score:2]
The mice treated with atrasentan were also injected intravenously with AAV- miR-199b-5p (with or without 20 mg/kg klotho by intraperitoneal injection) or a control vector twice per week for 8 weeks. [score:1]
As shown in Table 2, the serum miR-199b-5p level was negatively related to serum BUN, creatinine, and klotho concentrations. [score:1]
3.6 The effects of miR-199b-5p and klotho on renal function in vivo. [score:1]
Atrasentan altered the epigenetic modification of the miR-199b-5p promoter in HK-2 cells. [score:1]
Atrasentan decreased histone deacetylation of the miR-199b-5p promoter in HK-2 cells exposed to high glucose. [score:1]
The increase in the level of klotho, mediated by miR-199b-5p, may be a possible mechanism by which atrasentan prevents renal tubular injury in DN. [score:1]
Serum miR-199b-5p levels were significantly decreased in the subjects with abnormal albuminuria and the highest level was in the macroalbuminuric subjects. [score:1]
The relative expression levels of miR-199b-5p and klotho were calculated with the 2 [−ΔΔCT] method. [score:1]
To investigate the effects of miR-199b-5p and klotho on renal function in vivo, the STZ -induced diabetic mice were injected with AAV-miR-199b-5p to overexpress miR-199-5b. [score:1]
The miR-199b-5p mimic also canceled the elevated activities of the antioxidant indicators (T-AOC, SOD, and CAT, and GSH) and the reduced caspase-3 activity induced by atrasentan (Fig. 6B–F). [score:1]
Importantly, we found that high glucose enhanced histone H3, but not H4, binding to the miR-199b-5p promoter and that atrasentan markedly weakened this binding. [score:1]
Univariate correlations with serum miR-199b-5p level were also performed. [score:1]
In addition, Fragments of the 3′ UTR of klotho containing putative miR-199b-5p binding sites were amplified by PCR technology and then cloned into pMIR- RB-REPORTTM vectors (Guangzhou RiboBio Co. [score:1]
As expected, the additional injection of klotho reversed the negative effects of AAV-miR-199b-5p on renal function in vivo. [score:1]
The effects of miR-199b-5p and klotho on the renal function of STZ -induced DN mice. [score:1]
We observed that high glucose increased histone H3 acetylation in the miR-199b-5p promoter region, which led to the activation of this miRNA. [score:1]
The effects of miR-199b-5p and klotho on renal function in vivoTo investigate the effects of miR-199b-5p and klotho on renal function in vivo, the STZ -induced diabetic mice were injected with AAV-miR-199b-5p to overexpress miR-199-5b. [score:1]
Univariate correlations with serum miR-199b-5p levels concentrations. [score:1]
An AAV-miR-199b-5p/empty vector, with or without 20 mg/kg of klotho by intraperitoneal injection, was intravenously injected into the mice twice every week for 8 weeks. [score:1]
An miR-199b-5p mimic (100 mmol) or an NC was then transfected into the cells. [score:1]
In STZ induced diabetics mice, additional injection of klotho reversed the negative effects of AAV-miR-199b-5p on renal function. [score:1]
The constructs were then co -transfected with pre-mir-199b-5p or a negative control (NC) with Lipofectamine2000 (Invitrogen, USA) according to the manufacturer’s recommendations. [score:1]
The epigenetic modification of the miR-199b-5p promoter was explored in HK-2 cells. [score:1]
[1 to 20 of 53 sentences]
4
[+] score: 148
Other miRNAs from this paper: hsa-mir-99b
To confirm that CCNL1 was a target gene of miR-199b-5p, the A673 and TC252 cells were collected and the total protein was extracted following the overexpression of miR-199b-5p at 72 h. Western blotting revealed that the protein expression levels of CCNL1 markedly decreased (Fig. 4A). [score:7]
These results suggested that miR-199b-5p markedly inhibited cell proliferation, inhibited the cell cycle transition, induced cell apoptosis and suppressed the invasion of ES cells. [score:7]
Overexpression of miR-199b-5p inhibits proliferation and invasion, inhibits cell cycle progression, and induces apoptosis in ES cells. [score:7]
The expression of miR-199b-5p was downregulated in a wide variety of tumor types, including ovarian cancer, breast cancer, thyroid cancer and osteosarcoma. [score:6]
Expression of miR-199b-5p is downregulated in ES cells. [score:6]
In conclusion, the present study has demonstrated that miR-199b-5p acted as a tumor suppressor by targeting CCNL1 in ES cell lines. [score:5]
Therefore, miR-199b-5p may inhibit ES cells by targeting CCNL1 in vitro. [score:5]
In addition, in A673 and TC252 cells the expression of miR-199b-5p was downregulated compared with the levels in human MSCs, indicating that miR-199b-5p may be involved in ES. [score:5]
Functional experiments indicated that the forced expression of miR-199b-5p suppressed cell proliferation rate, cell invasion, arrested the cell cycle and induced cell apoptosis in each ES cell line. [score:5]
Therefore, the G1- to S-phase transition was inhibited by the overexpression of miR-199b-5p. [score:5]
It was demonstrated that miR-199b-5p was a tumor suppressor in these ES cell lines, which inhibited cell proliferation and cell invasion, arrested cell cycle progression, and promoted apoptosis. [score:5]
Additionally, miR-199b-5p may act as a tumor suppressor by repressing the expression of CCNL1 in ES cells. [score:5]
RT-qPCR revealed that the expression levels of miR-199b-5p were downregulated in the ES cell line compared with the human MSCs, as shown in Fig. 1A. [score:5]
Therefore, the present study determined potential target genes of miR-199b-5p using Targetscan (www. [score:5]
miR-199b-5p may be downregulated by activation of the JAG1-Notch1 signaling pathways in ovarian cancer (14). [score:4]
Notably, CCNL1 was demonstrated as a direct target gene of miR-199b-5p by measuring luciferase activity and protein expression levels. [score:4]
The overexpression of miR-199b-5p significantly inhibited the cell proliferation compared with the scramble control in vitro, as shown in Fig. 2A. [score:4]
In addition, it was revealed that miR-199b-5p directly targeted CCNL1 to perform this function in ES cells. [score:4]
In addition, the cell invasive ability was determined following the forced expression of miR-199b-5p in ES cells. [score:3]
The present study assessed the expression levels of miR-199b-5p in ES A673 cells. [score:3]
Bioinformatic prediction revealed CCNL1 as a predicted target gene of miR-199b-5p. [score:3]
Garzia et al (18) demonstrated that the expression of miR-199b-5p correlated with metastasis in medulloblastoma tumor and indicated that miR-199b-5p may be combined with radiation and chemotherapy as an auxiliary treatment to improve the antitumor effect and life quality of patients. [score:3]
The expression of mature miR-199b-5p in the A673 cells was similar to the result in TC252 cells. [score:3]
The expression levels of the miR-199b-5p mimic were subsequently detected in the A673 and TC252 cells. [score:3]
Won et al (17) revealed that miR-199b-5p is involved in the Notch signaling pathway in osteosarcoma and suggested the inhibitor of miR-199b-5p may be a potential treatment strategy to prevent osteosarcoma metastasis. [score:3]
CCNL1 is the target gene of miR-199b-5p. [score:3]
The quantity of cells in the G1 phase increased significantly following the forced expression of miR-199b-5p (Fig. 2B). [score:3]
A mature miR-199b-5p mimic and scramble mimic were constructed and transfected into the cells in vitro to overexpress the levels of miR-199b-5p in the A673 and TC252 cells. [score:3]
Furthermore, miR-199b-5p may be a novel diagnostic marker or therapeutic target for the treatment of human ES in the future. [score:3]
miR-199b-5p has been demonstrated to inhibit cancer cell migration and colony formation in breast cancer (15) and reduces the proliferation of thyroid follicular cancer cells (16). [score:3]
CCNL1 was revealed as a possible target gene of miR-199b-5p in ES cells using a luciferase activity assay. [score:2]
The Matrigel invasion chamber assays demonstrated that the invasive ability of cells with overexpression of miR-199b-5p significantly decreased (Fig. 2D). [score:2]
Since cell proliferation was directly associated with the cell cycle, the effect of the miR-199b-5p mimic on the cell cycle was analysed. [score:2]
Taken together, the present study successfully identified miR-199b-5p as a key regulator in ES cells. [score:2]
The results revealed that the relative luciferase activity of the CCNL1-WT was significantly inhibited following transfection with the miR-199b-5p mimic compared with scramble control. [score:2]
miR-199b-5p represses CCNL1 to regulate ES cells. [score:2]
Sequence analysis demonstrated that the 3′UTR of CCNL1 contained the miR-199b-5p binding sites (Fig. 3A). [score:1]
Taken together, these findings suggested that miR-199b-5p may act as a negative modulator in ES cells. [score:1]
These studies provided to suggest the benefit in identifying the role of miR-199b-5p in ES cells. [score:1]
The miRNA-199b-5p mimic and scramble control molecules were obtained from Dharmacon (Chicago, IL, USA) and were transfected into the A673 and TC252 cells at a final concentration of 60 nM. [score:1]
The number of early apoptosis cells following transfection with the miR-199b-5p mimic was then assessed. [score:1]
The A673 and TC252 cells were harvested separately following transfection with miR-199b-5p mimic and scramble control at 0, 24, 48 and 72 h. The activity of A673 cells was subsequently assessed at different time points. [score:1]
[1 to 20 of 42 sentences]
5
[+] score: 55
In conclusion, a more sensible and specific quantification of miRNAs by absolute Q-PCR analysis highlighted common up-regulation of miR-206, miR-223, miR-199a-5p, miR-199b*, miR-27a, miR-128a, miR-31 and miR-142-5p, and down-regulation of miR-17 in dystrophic fibres isolated from TA, DIA and VA of the adult mdx mouse (Figure S1). [score:7]
In comparison with data already published by Eisenberg et al. and Greco et al. [15], [16], single-fibres based-analysis allowed the discovery of new muscular miRNAs whose expression levels are up-regulated in dystrophic murine muscle (miR-15b, miR-27a, miR-128a and miR-199b*). [score:6]
Interestingly the expression profile of miR-199b was shown parallel to disease progression, suggesting a strong correlation with the quality of resting dystrophic muscle or with accumulating muscle damage and fibrosis. [score:5]
Interestingly the expression of miR-199b was not triggered by acute muscle damage, further supporting the strong correlation between its expression levels and the accumulation of chronic muscle damage, as previously demonstrated in the mdx mouse (Figure 2B). [score:5]
In the case of the FRG1 over -expressing mice, only 4 of the tested miRNAs were found over-expressed in all muscle analyzed (miR-206, miR-223, miR-199a-5p and miR-199b), while the remaining 10 miRNAs showed a heterogeneous behaviour depending on the muscle considered. [score:4]
Absolute quantification confirmed common up-regulation of miR-206, miR-199a-5p, miR-223 and miR-199b* in all mdx single fibres tested (Figure S1). [score:4]
Dystrophic muscle fibres isolated from different animal mo del of MDs were commonly characterized by the over -expression of several miRNAs (miR-15b, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) with an expression profile strictly dependent on muscle impairment and damage accumulation (Figure 7). [score:3]
We identify fourteen miRNAs associated to dystrophic fibres (miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) that may mediate muscle regeneration and remo delling in animal mo dels of MDs and acute muscle damage, and confirm over -expression of the previously identified regeneration -associated myomiR-206. [score:3]
Data obtained evidenced a group of miRNAs whose expression does not change during muscle repair afterwards acute damage (miR-15b, miR-17, miR-128a, miR-221, miR-199a-5p miR-199b and miR-199b*) (Table 1), and a group of miRNAs that are triggered afterwards CTX delivery (miR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223) (Table 1), suggesting major involvement of the latter in muscle regeneration. [score:3]
Since miR-199b* is mouse-specific, the expression of this miRNA was not considered for the analyses. [score:2]
The expression levels of miR-21, miR-142-5p, miR-199a-5p, miR-199b*, miR-206, miR-223 and miR-335-5p were instead strictly related to the type of muscle considered, underling a relationship with muscle-type dependent impairment (Figure 2B). [score:2]
In particular, the dysregulation was limited to miR-199b*, miR-31, miR-142-5p and miR-221 in dystrophic TPZ; to miR-128a, miR-21, miR-221 and miR-35-5p in dystrophic DIA; and to miR-15b, miR-17, miR-27a, miR-142-5p, miR-128a, miR-335-5p, miR-21, miR-31 in dystrophic VA (Figure 3B). [score:2]
Otherwise, single muscle fibres isolated from lower affected TA and VA of the mdx mouse were respectively associated to 7 (miR-206, miR-199a-5p, mir-223, mir-199b, miR-199b*, miR-21 and miR-221) and 5 (miR-206, miR-199a-5p, mir-223, mir-199b and miR-199b*) dysregulated miRNAs (Figure 1). [score:2]
Fourteen miRNAs were found dysregulated in dystrophic muscle fibres of the mdx mouse with differences linked to the originating muscle (miR-206, miR-199a-5p, miR-223, miR-199b, miR-199b*, miR-21, miR-221, miR-17, miR-15b, miR-31, miR-128a, miR-142-5p, miR-335-5p and miR-27a). [score:2]
In agreement with data already published characterizing the miRNome of mdx and DMD muscle [15], [16], [17], the over -expression of several miRNAs (miR-21, miR-31, miR-199a-5p, miR-199b, miR-142-5p, miR-221, miR-223 and miR-335-5p) was confirmed in murine dystrophic single muscle fibres. [score:1]
MiR-199b dysregulation was statistically significant only in single muscle fibres of dystrophic TA (Figure S1A), nevertheless an increment was observed in fibres of dystrophic DIA and VA. [score:1]
The array analysis evidenced a dystrophic miRNA-signature not dependent to the muscle type of origin which include the regeneration -associated miR-206; miR-199a-5p, miR-199b, miR-199b* and miR-223. [score:1]
In support to this: miR-335 and miR-21 were found in human mesenchymal stromal cells [50] and in mesenchymal stem cells (MSCs) together with miR-21, miR-27a, miR-128a, miR-199b [51] miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-199a, miR-199b, miR-221 and miR-335-5p were found in MSCs and in MSC secreted microparticles [49], [52], [53]. [score:1]
Otherwise, single muscle fibres based-analyses highlighted new miRNAs (miR-17, miR-27a, miR-128a and miR-199b*) associated to dystrophic and/or damaged muscle. [score:1]
[1 to 20 of 19 sentences]
6
[+] score: 34
A) K562 miRNA Host Transcript miRNA:Host transcript Status miR-342 EVL Downregulated miR-548e SHOC2 Downregulated miR-486 ANK1 Upregulated B) HL60 miRNA Host Transcript miRNA:Host transcript Status miR-22 C17orf91 Downregulated miR-151 PTK2 Downregulated miR-199b DNM1 Upregulated miR-25 MCM7 Upregulated miR-618 LIN7A Upregulated The analysis of microarray data revealed induction in the expression of some of the miRNA biogenesis genes (RNASEN, DGCR8, XPO5, RAN) in K562 cell line (Table 3). [score:27]
A significant number of differentially expressed miRNAs of HL60 (downregulated-miR-101, 126, 27b, 7; up regulated- let-7a, let-7d, miR-181a, -181a*, -181b and miR-199b) were mapped to chromosome 9 (Figure 8). [score:7]
[1 to 20 of 2 sentences]
7
[+] score: 24
The target sequence for miR-199a-3p also targets miR-199a1, miR199-a2, and miR-199b, whereas the target sequence against miR-199a-5p only binds to miR-199a1 and miR-199a2. [score:7]
In the lung metastases, miR-199-3p showed a 14-fold and miR-199-5p showed a 25-fold upregulation in the stroma compartment compared to the tumor compartment (p < 0.0001) and a 5-fold (miR199-3p; p = 0.03) and 9-fold (miR-199-5p; p = 0.0004) upregulation compared to the normal lung tissue. [score:5]
miR-199-3p and miR-199-5p were 500-fold upregulated in the stroma compartment of the liver metastases compared to the tumor compartment (p < 0.0001), respectively, but did not show a significant upregulation compared to the normal liver tissue. [score:5]
It remains speculative but those data might explain why an increased expression of miR-199-3p in the stromal compartment is associated with a better clinical outcome. [score:3]
Intriguingly, we found that the expression of miR-199-3p in the stromal compartment of liver metastases was significantly associated with an improved survival (p = 0.05; Table 4). [score:3]
Since miR-199a1, miR-199a2, and miR-199b are all located on different chromosomes, we decided to include both miRNAs in the final analysis. [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 23
However, only a few miRNAs were differentially expressed between ASC populations (miR-143 downregulated and miR-204 upregulated in MAPC with respect to MSC; miR-129 and miR-199b downregulated and miR-204 upregulated in MAPC respect to MSC and miR-424 downregulated in MSC respect to ADSC) and those differences were smaller than those observed between ESC and ASC. [score:18]
An inverse correlation between expression of ZIC3 and miR-137, miR-152, miR-154 and miR-155; LIN28 and let-7c, miR-137 and miR-152 and NANOG and miR-199a and miR-199b expression was found in ASC and NTERA-2 cells (Figure 5). [score:5]
[1 to 20 of 2 sentences]
9
[+] score: 23
In more detail, the expression level of miR-199b in BSMC exosomes was 3.75±0.81 folds increase at day 4 of osteogenic differentiation compared to that of day 0. miR-218 has a 2.81±1.01 over expression on day 3 osteogenic differentiation relative to that of day 0. There was a 3.11±0.94 increase of expression levels of miR-148a on day 1 compared to that of day 0. miR-135b has 2.99±o. [score:5]
TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
0114627.g002 Figure 2. TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
Nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 7 days. [score:3]
nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were further quantitated by TaqMan miRNA assays (Applied Biosystems). [score:2]
miR-199b was known to be possibly involved in the control of osteoblast differentiation by Runx2. [score:1]
Furthermore, we found that let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b were significantly increased in individual exosomal samples from human BMSCs. [score:1]
Two-dimensional grid matrix displaying 5 differential miRNAs (miR-199b, miR-218, miR-148a, miR-135b, and miR-221) was obtained by the functional heat-map in R. Columns refer to time course comparison: human BMSC culture at 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 7 days. [score:1]
[1 to 20 of 8 sentences]
10
[+] score: 23
Real time PCR confirmed overexpression of miR-126, miR-199b, and miR-451 and down-regulation of miR-29a expression in canine OS tumors as compared to normal canine osteoblasts (p ≤ 0.01). [score:7]
Transfection with a miR-199b-5p inhibitor diminished cell invasiveness and decreased Notch signaling by reducing HES1 expression [52]. [score:5]
Real-time PCR was performed to independently validate changes in miRNA expression for 4 representative differentially expressed miRNAs (miR-29a, miR-126, miR-199b, miR-451) in a subset of primary canine osteoblasts cultures, osteoblast cell line (Ob, n = 5), and fresh primary canine OS tissues (OS, n = 16). [score:5]
Specifically, we verified the overexpression of miR-126, miR-199b, miR-451 in OS samples relative to normal osteoblasts. [score:3]
Lastly, overexpression of miR-199b-5p in human OS cell lines activates Notch signaling and promotes cell proliferation. [score:3]
[1 to 20 of 5 sentences]
11
[+] score: 19
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-143, hsa-mir-145
miR-199b-5p directly targets PODXL and DDR1 and decreased levels of miR-199b-5p correlate with elevated expressions of PODXL and DDR1 in acute myeloid leukemia. [score:6]
Two highly conserved targets, Podocalyxin (PODXL) and Discoidin Receptor 1 (DDR1), are listed as predicted targets of miR-199b-5p by (Garcia et al., 2011; Favreau et al., 2012). [score:5]
Experimental validation via transfection of miR-199b-5p mimics in cell lines confirmed that PODXL and DDR1 are targets of miR-199b-5p at both the mRNA and protein levels (Favreau et al., 2012). [score:3]
While studying the functional role of miR-199b-5p in acute myeloid leukemia (AML), was used to examine potential targets of miR-199b-5p based on seed match and conservation. [score:3]
Further validation by 3′ UTR luciferase assays confirmed that PODXL and DDR1 are true targets of miR-199b-5p (Favreau et al., 2012). [score:2]
[1 to 20 of 5 sentences]
12
[+] score: 18
The third category had a high expression level on day 1 and down-regulated expression on day 7, and included miR-132, miR-186, miR-199, miR-338, and miR-219. [score:8]
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 17
This toggle switch is known to play an important role in several types of cancer leading to different cell populations during oncogenesis, thus explaining why mir-199 had been reported as an ambiguous marker in several types of cancer, being either upregulated or downregulated in different samples of the same tumor. [score:7]
One of them is the Brm gene (also known as Smarca2) whose translation is controlled by mir-199 (Sakurai et al., 2011). [score:3]
Interestingly, the 3′UTR region of Brm is targeted by both the mature versions of mir-199, i. e., mir-199-3p and mir-199-5p (Sakurai et al., 2011). [score:3]
In turn Brm is able to silence the mir-199, mir-214 cluster by silencing Egr1 which is known to be a strong activator of the cluster (Sakurai et al., 2011), thus closing in an indirect way a double negative feedback loop between Brm and mir-199. [score:2]
However, it is deeply linked with the previous ones, since mir-199 is located in the same cluster of mir214 and is known to form a common precursor with mir-214 (Loebel et al., 2005), and is thus controlled by the same PRC2 complex discussed in the previous examples. [score:1]
The BRM - mir199 loop. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 17
MicroRNA expression has been found to be decreased in FECD CE, with MIR199B being the most underexpressed by array analysis [42]. [score:5]
Array analysis identified the down-regulation of 87 miRNAs in FECD compared with normal endothelium, with MIR199B having the largest change in expression [42]. [score:5]
MethyLight reactions were designed to represent the five SLC4A11 probes (two promoter, three gene body), one GUCY2C probe (promoter), and one MIR199B probe (promoter) that were all found to be hypermethylated in FECD samples (Fig 5). [score:1]
Using this cut-off, two reactions (SLC4A11-MIM and MIR199B-M1B) were methylated in the FECD samples but were unmethylated in the control samples. [score:1]
We found MIR199B promoter DNA hypermethylation in FECD patient samples by both Illumina HM450 array and MethyLight analyses. [score:1]
For the MIR199B-M1B reaction, the mean PMR value was 11 for FECD samples and 4 for control samples. [score:1]
Our HM450 array analysis unveiled promoter DNA methylation of MIR199B. [score:1]
MethyLight analysis for SLC4A11, MIR199B, and GUCY2C in FECD and control endothelial tissues. [score:1]
0175112.g006 Fig 6MethyLight analysis for SLC4A11, MIR199B, and GUCY2C in FECD and control endothelial tissues. [score:1]
[1 to 20 of 9 sentences]
15
[+] score: 15
Thus, downregulation of miR-199a-3p and miR-199b-3p might be a part of the regulatory changes leading to increased proliferation of HCC cells. [score:5]
When performing standard pathway analysis for miR-199a-3p and miR-199b-3p, no cancer -associated pathways were enriched (human, TargetScan). [score:3]
While the function of miR-199a-3p and miR-199b-3p is not fully defined, they target members of Raf/MEK/ERK signaling [23]. [score:3]
The liver filter thus identified the known association of miR-199a-3p and miR-199b-3p with Raf/MEK/ERK signaling through associated regulatory pathways. [score:2]
First, we analyzed miR-199a-3p and miR-199b-3p. [score:1]
2011.01.001 24 Callegari E, Elamin BK, D’Abundo L, Falzoni S, Donvito G, Moshiri F, et al Anti-tumor activity of a miR-199 -dependent oncolytic adenovirus. [score:1]
[1 to 20 of 6 sentences]
16
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
In contrast, the miRNAs up-regulated in the liver (miR-199-3p, miR-199-5p, miR-21, miR-214 and miR-210) showed significantly higher levels in mouse serum at 12 weeks post infection (Fig. 2), however these failed to differentiate S. mansoni infected from uninfected humans (Fig. S4). [score:4]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infectionBetween weeks 6 and 12, female parasites continue to produce ∼300 eggs per day [51], resulting in an increase in the number of granulomas in the liver and the development of fibrosis [45]. [score:4]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infection. [score:3]
Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1). [score:2]
The 5 host miRNAs were detectable in serum (miR-21, miR-199-3p, miR-199-5p, miR-210, miR-214) but showed variable abundance and failed to differentiate ‘egg -positive’ and ‘egg -negative’ participants (Fig. S4). [score:1]
[1 to 20 of 5 sentences]
17
[+] score: 13
The relationship between expression level of miR-199 and 200 families and expression level of three fibrosis related genes. [score:5]
Figure S2Comparison of the expression level of miR-199 and 200 familes in several cell lines and human liver tissue. [score:3]
The expression level of miR-199 and 200 families in human liver biopsy specimen by real-time qPCR. [score:3]
The miR-199 and miR-200 families have are circumstantially related to liver fibrosis. [score:1]
The sequences of mmu-miR-199a-5p, mmu-miR-199b, mmu-miR-199b, mmu-miR-200a, and mmu-miR-200b in mouse miRNA corresponded to the sequences of hsa-miR-199a, hsa-miR-199a*, hsa-miR-199a, hsa-miR-200a, and hsa-miR-200b in human miRNA, respectively (Table S3). [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
MiR-206, miR-133, miR-199, miR-100 and miR-195 were implicated in the autophagy pathway targeting BCL2, MTOR and SQSTM1 as possible autophagy gene targets (Table 6). [score:5]
However, miR-199 (p value = 0.01) and miR-200 (p value = 0.004) in contrary to the microarray results were significantly upregulated in cbs [+/–] in comparison with the control cbs [+/+] (p value < 0.05). [score:4]
MiRNAs (miR-199 and miR-200) were significantly upregulated in cbs [+/–] in comparison with the control ([*] p < 0.05, [**] p < 0.01). [score:4]
[1 to 20 of 3 sentences]
19
[+] score: 12
While most miRNAs (e. g. miR-18b up-regulation and miR-145 down-regulation) showed an ER status independent differential expression, miR-199 and miR-214 were down-regulated in proliferating samples only in the 38 ER -negative samples (both with TNoM p<0.01, see Table S6). [score:12]
[1 to 20 of 1 sentences]
20
[+] score: 12
In medulloblastoma cells, miR-199b-5p directly targets HES1, a transcription factor of the Notch signaling pathway (Garzia et al., 2009). [score:4]
Another study showed that miR-199b-5p downregulation was associated with metastatic spread in medulloblastoma. [score:4]
MiR-199b-5p blocks Notch signaling, inhibiting the self-renewal capacity of medulloblastoma cells by reducing the CD133 [+] subpopulation (Garzia et al., 2009). [score:2]
Therefore, miR-199b-5p and miR-34a are important for the self-renewal potential of GSCs via the Notch signaling pathway. [score:1]
MicroRNA-199b-5p impairs cancer stem cells through negative regulation of HES1 in medulloblastoma. [score:1]
[1 to 20 of 5 sentences]
21
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Targets of miR-199 were endothelin-1 and HIF1α, loss of miR-199 expression increased endothelial HIF1α levels [63]. [score:5]
In addition, alcohol decreased the expression of miR-199 in human and rat liver sinusoidal endothelial cells [63]. [score:3]
Yeligar S. Tsukamoto H. Kalra V. K. Ethanol -induced expression of ET-1 and ET-BR in liver sinusoidal endothelial cells and human endothelial cells involves hypoxia-inducible factor-1alpha and microRNA-199 J. Immunol. [score:3]
[1 to 20 of 3 sentences]
22
[+] score: 11
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-214
They found that miR-199 and miR-214 are upregulated during early brain development and differentially modulate extracellular signal regulated kinase (ERK)/mitogen-activated protein kinase (MAPK) and AKT signaling pathway. [score:6]
Inhibition of miR-199 or miR-214 expression in MeCP2 -deficient neural progenitor cells rescued the related signaling pathway and ameliorated the alterations in neuronal differentiation (Mellios et al., 2018b). [score:5]
[1 to 20 of 2 sentences]
23
[+] score: 10
For example, miR-199b-5p-levels are significantly higher in UPS as compared with leiomyosarcoma, while miR-320a is upregulated in leiomyosarcoma, whilst being downregulated in UPS [48]. [score:6]
Contrary to leiomyosarcoma, miR-199b-5p is significantly upregulated in UPS [48]. [score:4]
[1 to 20 of 2 sentences]
24
[+] score: 10
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2
Furthermore, we demonstrated that nuclear overexpression of GSK-3β and tumor proliferation in RCC are negatively regulated by miR-199, the only microRNA known to target GSK-3β [21]. [score:6]
In human RCC specimens, aberrant GSK-3β overexpression that is negatively regulated by miR-199 [21] was observed in 68 out of 74 (92 %) cases, suggesting clinical relevance of RCC biology [20]. [score:4]
[1 to 20 of 2 sentences]
25
[+] score: 10
By counting eGFP-anillin expressing CMs, which could be identified according to their H2B-mCh fluorescence, increased cell cycle activity after treatment with miR-199 compared to the scramble miR control could be directly detected without further stainings (Fig.   8b). [score:3]
Further we noticed an increase in the fraction of binucleated CMs in miR-199 -treated CMs (Fig.   8g). [score:1]
Binucleation was determined as 17.7 % of total CMs for miR-199 treatment and only 9.8 % for controls. [score:1]
Ventricles from P2 mice were dissociated and the cells were transfected with either microRNA 199, (miR-199) which was reported to strongly enhance the rate of proliferation in postnatal CMs [10] or scramble miRs as a negative control. [score:1]
Surprisingly, treatment with miR-199 led to an increase of binucleated CMs, indicating induction of cell cycle variations. [score:1]
As a proof of concept, we were able to verify the proliferation-inducing effect of miR-199, as previously published [10]. [score:1]
While in transfections with scramble miRs, a basal cell cycle activity (6.6 %) could be determined, this was significantly (p = 0.0015) enhanced (19.1 %) after transfection with miR-199 (Fig.   8c). [score:1]
b Fluorescence pictures of dissociated αMHC-H2B-mCh/CAG-eGFP-anillin double transgenic hearts (P2), transfected with the cell cycle-modifying miR-199 and a miR-NC. [score:1]
[1 to 20 of 8 sentences]
26
[+] score: 9
Using microarray analysis, miRNA expression pattern in hearts revealed that miR-1, miR-29, miR-30, miR-133, and miR-150 have often been found to be down-regulated while miR-21, miR-125, miR-195, miR-199, and miR-214 are up-regulated with hypertrophy. [score:9]
[1 to 20 of 1 sentences]
27
[+] score: 9
Leukemia inhibitor factor (LIF) mRNA was found to be a direct target of two, miR-199 and miR-346. [score:6]
A luciferase reporter construct containing the 3’UTR of LIF showed miR-199 and miR-346 could both bind putative target sites in LIF [75]. [score:3]
[1 to 20 of 2 sentences]
28
[+] score: 9
42) 13 hsa-mir-199b dbDEMC, HMDD, miR2Disease 38 hsa-mir-206 dbDEMC 14 hsa-mir-181a dbDEMC, miR2Disease 39 hsa-mir-192 dbDEMC 15 hsa-mir-29a dbDEMC, HMDD, miR2Disease 40 hsa-mir-335 literature 16 hsa-let-7e dbDEMC 41 hsa-mir-365 literature 17 hsa-mir-107 HMDD 42 hsa-mir-30a miR2Disease 18 hsa-mir-18a higher RWRMDA (No. [score:9]
[1 to 20 of 1 sentences]
29
[+] score: 9
Mir-152 targets HLA-G in JEG3 cells [42], miR-34a targets Notch1 and Jagged1 in HeLa and JAR cells [43], and miR-199b targets SET (protein phosphatase 2A inhibitor) in BeWo and JAR cells [44]. [score:9]
[1 to 20 of 1 sentences]
30
[+] score: 9
On the basis of the opposite functions of CBX7, as oncogene and oncosuppressor, it was not surprising to find that CBX7 was able to regulate in opposite sense miRNAs that have recognized to have oncogenic functions, such as miR-199 (negatively regulated) and miR-155, miR-221 and miR-222 (positively regulated). [score:6]
The results presented in Fig.   1 confirm a drastic overexpression of miR-181, miR-137, miR-199, miR-706 and miR-719 and repression of miR-155 in Cbx7 KO MEFs in comparison with the WT ones. [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 9
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-34a, hsa-mir-199a-2
Forced expression of miR-199b in SH-SY5Y-TR1 cells, however, failed to induce downregulation of AXL at either the mRNA (Supplementary Figure S3c) or protein (Supplementary Figure S3d) level. [score:6]
We also assessed the contribution of miR-34a and miR-199a/b, the two acknowledged modulators of AXL expression, [24] noting a decrease in miR-199b levels in the TAE684-resistant cells relative to the sensitive ones (Supplementary Figure S3b). [score:3]
[1 to 20 of 2 sentences]
32
[+] score: 9
Specifically, miR-205 and miR-200 family members (in particular miR-200b and miR-200c) were exclusively expressed by pancreatic cancer epithelial cells, and miR-145 and miR-199 family members (miR-199a and miR-199b) were exclusively expressed by TAS cells [8]. [score:5]
Of note, the other two stroma-specific miRNAs we previously identified, the miR-199 family members (miR-199a/-199b), have also been identified as tumor suppressive miRNAs [34, 35]. [score:3]
Likewise, TAS miRNA signature miR-145 and miR-199 family members miR-199a/199b were present in MVs and EXOs derived from TAS cells, and miR-145 concentrations were augmented in comparison to parental cell levels (difference = 4.04 ± 0.58, p < 0.001 for PDAC-MVs; and 5.95 ± 0.75, p < 0.001 for PDAC-EXOs) (Figure 3D). [score:1]
[1 to 20 of 3 sentences]
33
[+] score: 9
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-191
miR-199b-5p has identical targets, e. g. HIF1a, PODXL, DDR1, etc, as miR-199a-5p, probably because their sequences are almost identical with only two different base pairs (miR-199a-5p: cccaguguucagacuaccuguuc; miR-199b-5p: cccaguguuuagacuaucuguuc) [37], [38]. [score:3]
Therefore, it is likely that miR-199b-5p also targets MAFB. [score:3]
miR-199b locates in Chromosome 9, being antisense of one intron of DNM1 while miR-199a-1 locates in Chromosome 19 and is within an intron of DNM2 and miR-199a-2 locates in Chromosome 1 and is within an intron of DNM3. [score:1]
Previous studies, mostly done in cancers, especially breast and bone cancers, suggested that only miR-199b-5p is functional [34]– [36]. [score:1]
There is another miRNA, miR-199b, highly homologous to miRNA-199a [33]. [score:1]
[1 to 20 of 5 sentences]
34
[+] score: 9
A previous study shown that miR-199b-5p was down-regulated in medulloblastoma by methylation of a CpG island 3 kb upstream of the 5′-site of miR-199b-5p promoter [14]. [score:4]
Since DNA methylation can affect large regions of chromatin and regulate the transcription of distant genes, it is necessary to investigate whether miR-219-2-3p is down-regulated and regulated by methylation as miR-199b-5p in cancer. [score:4]
Interestingly, miR-199b and miR-219-2-3p genes are located at proximity to a segment of chromosome 9q34.11 (Fig. 1A ). [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 9
Of the 186 miRNAs the expression of which was altered, nine were up-regulated at both time points (miR-125a-3p, miR-297c, miR-421, miR-452, miR-483, miR-574-3p, miR-574-5p, miR-669a, miR-720) and 11 were down-regulated at both time points (let-7g, miR-107, miR-10a, miR-15a, miR-15b, miR-199b*, miR-26a, miR-29c, miR-324-5p, miR-331-3p, miR-342-3p). [score:9]
[1 to 20 of 1 sentences]
36
[+] score: 9
They found that miR-199b-5p and miR-100-3p were downregulated and miR-155-5p, miR-135-5p, and miR-146-5p upregulated in more aggressive osteosarcoma cell lines. [score:7]
In addition to this study, Guled et al. demonstrated miRNAs including miR-199b-5p, miR-320a, miR-199a-3p, miR-126, and miR-22 were differentially expressed in LMS and undifferentiated pleomorphic sarcoma (UPS) as compared to mesenchymal stem cells (control) (Guled et al., 2014). [score:2]
[1 to 20 of 2 sentences]
37
[+] score: 9
This study identified 68 up-regulated and 2 down-regulated miRNAs between the ISCCs and normal epithelial tissues, with miR-199s, miR-9, miR-199a*, miR-199a, miR-199b, miR-145, miR-133a, miR-133b, miR-214 and miR-127 being among the miRNAs most overexpressed. [score:9]
[1 to 20 of 1 sentences]
38
[+] score: 9
rno-miR-novel-8, rno-homolog-miR-26, and rno-homolog-miR-199 miRNAs were selected from Tier 1, and rno-miR-sno-57 miRNA was selected from Tier 2. In addition, we analysed the expression of miR-741-3p and miR-743a-3p and found that, in accordance with sequencing data, they were highly expressed in rat PSCs. [score:5]
rno-homolog-miR-26 and rno-homolog-miR-199 miRNAs were expressed in EFs, ESCs and iPSCs, which is consistent with the data obtained from sequencing. [score:3]
Four novel miRNAs with the following coordinates: chrX:−:151288045–151288101 (rno-miR-novel-8); chr7:+:70463555–70463594 (rno-homolog-miR-26); chr3:+:16697111–16697143 (rno-homolog-miR-199); and chr18:−:69422790–69422857 (rno-miR-sno-57) were selected for the validation. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 8
Among the top differentially expressed miRNAs, miR-183 and miR-182 are most up-regulated in cancer samples (highest fold change) while miR-1247 and miR-199b-5p were most down-regulated in cancer samples compared to normal samples (Table  1). [score:8]
[1 to 20 of 1 sentences]
40
[+] score: 8
NFATc4 was targeted by miR-133 in cardiac hypertrophy [20] and miR-199b has been shown to regulate the calcineurin/NFAT signaling pathway by targeting Dyrk1A [25]. [score:6]
Da Costa Martins P. A. Salic K. Gladka M. M. Armand A. -S. Leptidis S. el Azzouzi H. Hansen A. Coenen-de Roo C. J. Bierhuizen M. F. van der Nagel R. MicroRNA-199b targets the nuclear kinase Dyrk1a in an auto-amplification loop promoting calcineurin/NFAT signalling Nat. [score:2]
[1 to 20 of 2 sentences]
41
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Similarly, loss of miR-217 and miR-199b expression has been correlated with resistance to ABL tyrosine kinase inhibitors [53, 54]. [score:5]
In agreement with these results, Wang et al. [65] identified miR-23a, miR-27a, miR-27b, miR-150, miR-199a, miR-199b, miR-221 and miR-340 as miRNAs differentially expressed in patients with ALL when compared to AML. [score:2]
De Leeuw et al. identified miRNA-23a, miRNA-27a, miRNA-199b, miRNA-221, and miRNA-223 as the most lineage-discriminative miRNAs between AML and ALL [63, 64]. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
MiRNA expression profiling in sputum of subjects exposed to ozone inhalation revealed significantly up-regulated expression of 10 miRNAs: miR-132, miR-143, miR-145, miR-199a-3p, miR-199b-5p, miR-222, miR-223, miR-25, miR-424 and miR-582-5p [94]. [score:8]
[1 to 20 of 1 sentences]
43
[+] score: 8
In HCC, miR-122 and miR-199 are frequently downregulated, suggesting a tumor suppressor role whereas miR-21 and miR-221 are often hyperexpressed [17– 19]. [score:8]
[1 to 20 of 1 sentences]
44
[+] score: 8
Likewise, miR-199b-5p also functions as a tumour suppressor since overexpression of this miRNA leads to reduced tumour growth in MB [113]. [score:5]
Other studies further support miR-199b to be responsible for regulating BTICs within MB [114] by regulating the Notch pathway [113]. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 7
In another study, bronchial airway epithelial cells from current and never smokers differed in the expression of 28 miRNAs (especially miR-218, miR-15a, miR-199b, miR-125a/b, miR-294) in comparison to smokers, whereas the majority of deregulated miRNAs were downregulated in smokers [97]. [score:7]
[1 to 20 of 1 sentences]
46
[+] score: 7
Comparison of 5p and 3p expression among 50 top-ranked miRNAs found in primary human chondrocytes demonstrated that three miRNAs, miR-320a, miR-28 and miR-103a-2, showed expression of their 3p arm only and four miRNAs, miR-199b, miR-98, miR-186 and miR-16-1, expressed their 5p arm only. [score:7]
[1 to 20 of 1 sentences]
47
[+] score: 7
Other miRNAs such as miR-29a, miR-199-5p, miR-339-5p, miR-590-5p and miR-19b-1 are overexpressed in both the training and validation set, but have barely been described in cancer in general and in NSCLC in particular. [score:3]
Regarding the analyzed miRNAs, the overexpression of miR-182, miR-31, miR135b, miR-199b, miR-224 and miR-196b and miR-34a have been detected in both the training and validation set. [score:3]
Regarding miR-199-5p, only one study in lung cancer and miRNA changes related to asbestos has reported the same results [72]. [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 7
From Table S1, it is indicated, for example, that miR-199b-5p participates in angiogenesis, nucleotide excision repair, the PDGF signaling pathway, the cadherin/Wnt/integrin signaling pathway, apoptosis and the MAPK signaling pathway, according to its regulation of the transcription/translation regulator and signaling transducer proteins enriched in its target gene set. [score:7]
[1 to 20 of 1 sentences]
49
[+] score: 7
Torres and coworkers [29] found that the expression of miR-99a, miR-100 and miR-199b was up-regulated in plasma of EEC patients, and a combination of miR-99a and miR-199b was more accurate in distinguishing EEC disease when compared with single miRNAs. [score:7]
[1 to 20 of 1 sentences]
50
[+] score: 7
The most significantly upregulated human miRNAs were miR-513a-3p, miR-298, and miR-206; whereas miR-99a, miR-200 family, miR-199b-5p, miR-100, and miR-335 were the most significantly downregulated miRNAs. [score:7]
[1 to 20 of 1 sentences]
51
[+] score: 7
microRNAs downregulated in quiescent cells included miR-18, miR-20, miR-29, and miR-7, and microRNAs upregulated with quiescence included let-7b, miR-125a, miR-30, miR-181, miR-26, and miR-199. [score:7]
[1 to 20 of 1 sentences]
52
[+] score: 7
MiR126, miR146a, miR34a, and miR493 were published as down-regulated (Lodygin et al., 2008; Saito et al., 2009; Veerla et al., 2009; Ueno et al., 2012), and miR199b and miR26b were published as up-regulated in BC (Gottardo et al., 2007; Veerla et al., 2009). [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 6
The miR-214 and miR-199 showed maximum differential expression. [score:3]
In a mice mo del study of infected liver cells, highly elevated expression of miR-34c, miR-199, miR-134, miR-223, and miR-214 at 45dpi had been noticed (Cai et al., 2013b). [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 6
Mtb infection upregulated multiple microRNAs, including miR27a, miR125b and miR199, all of which are predicted suppressors of the PIK3CD, MLST8 and MKNK1 mRNAs (Fig 8E). [score:6]
[1 to 20 of 1 sentences]
55
[+] score: 6
We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b). [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
In mice with AFL, miR-199-3p, miR-214, miR-93, miR-146a, miR-191, and let-7b are downregulated and miR-129, miR-490, miR-21, miR-503, miR-183, and miR-185 are upregulated compared with healthy mice [103]. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
B. Real-time PCR further revealed that human miR-221-3p, miR-409-5p, miR-1290, miR-155-5p, miR-31-3p, miR-7-5p, miR-362-5p, miR-493-5p, miR-296-5p, and miR-199b-5p were statistically expressed at lower levels in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
In contrast, hsa-miR-221-3p, hsa-miR-409-5p, hsa-miR-1290, hsa-miR-155-5p, hsa-miR-31-3p, hsa-miR-7-5p, hsa-miR-362-5p, hsa-miR-493-5p, hsa-miR-296-5p, and hsa-miR-199b-5p were statistically downregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3B). [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 6
Hydrogen regulates expressions of miR-9, miR-21, and miR-199, and modifies expressions of IKK-β, NF-κB, and PDCD4 in LPS-activated retinal microglia cells [64]. [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 6
Comparison of the miRNA expression profiles between the control and SFN treated samples revealed a number of miRNA including miR-214, miR-145, miR-199a, and miR-199b that were significantly upregulated in SFN -treated H460 cells and were reported to be involved in tumorigenesis and progression (Supplementary Figure 3A & 3B). [score:6]
[1 to 20 of 1 sentences]
60
[+] score: 6
confirmed overexpression of miR-21, miR-122 and miR-210 and downregulation of miR-199 and miR-532 (Figure 4). [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 5
Among the miRNAs strongly down-regulated at all tested times were miR-199b-5p (decreased 70-fold), miR-214 (decreased 37-fold), and miR-143 (decreased 13-fold), known to promote differentiation of ESCs, neuroblasts, and smooth muscle progenitors, respectively [46], [47]. [score:4]
Several miRNAs involved in maintenance of pluripotency (miR-294, -146a, -133a) and differentiation (miR-199b-5p, -214, -143) were selected for validation of the microarray results. [score:1]
[1 to 20 of 2 sentences]
62
[+] score: 5
Some miRNAs that are not localized in Alus occur almost exclusively in the ‘development’ category: hsa-mir-199b (which validated target LAMC2 is involved in epidermis development), hsa-mir-149, -500, -512-5p -519b, -519e* and 527. [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
Among the less abundantly present miRNAs in senescent sEV we found miR-17-3p and miR-199b-5p, both were already published to be downregulated intracellularly in skin of elderly [53] and in senescence of mesenchymal stem cells [54]. [score:4]
Surprisingly, out of these, only two miRNAs (miR-23a-5p, miR-137) were more abundant in sEVs at both time points (Fig. 5C), while five miRNAs (miR-17-3p, miR-625-3p, miR-766-3p, miR-199b-5p, miR-381-3p) were less abundant in sEVs of senescent cells (Fig. 5D). [score:1]
[1 to 20 of 2 sentences]
64
[+] score: 5
All of these signaling proteins collectively regulate myoblast proliferation and differentiation; therefore, blocking this signaling pathway through excessive miR-199-5a in dystrophic muscle would likely affect myogenesis and muscle regeneration [99]. [score:2]
miR-199-5a regulates the levels of several Wnt signaling pathway proteins, including Frizzled 4 (FZD4), Jagged1 (JAG1), and WNT2 [99]. [score:2]
In contrast, miR-199-5a is increased in mdx muscle [85]. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 5
MiR-199 targets hepatocyte growth factor receptor, mammalian target of rapamycin (mTOR), and hypoxia-inducible factor (HIF1α), thereby regulating receptor tyrosine kinase and mTOR activation [15]. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2
Although the precise molecular mechanisms underlying miR-199a-5p/Akt in MM needs to be fully elucidated, these results provide insights on miR-199a-5p-Akt pathway cross-talk in MM indicating the occurrence of a regulatory negative loop where miR-199a-5p downregulates functional AKT which, in turn, represses miR-199-5p [70]. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
Correspondingly, the highly expressed miRNAs in cancerous penile tissues were let-7f-5p, let-7a-5p, let-7b-5p, let-7c-5p, miR-140-3p, miR-199b-3p, let-7g-5p, miR-199a-3p, let-7e-5p and miR-143-3p possessed the top abundant expression levels. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 5
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-122
MiR-199b-5p, which has a very similar nucleotide sequence, is also predicted to target DDR1. [score:2]
Therefore, the regulatory function of miR-199b-5p was not further assessed in this study. [score:2]
However, miR-199b-5p was only detectable in four out of 24 tissue samples in a miRNA microarray assay (data not shown) and it has never been reported to be de-regulated in HCC in literature. [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Xia et al. (2011) Heart miR-218a-1/2 Zebrafish Knockdown, overexpression, ISH, luciferase reporter assay, qRT-PCR Heart field migration Fish et al. (2011) miR-138 Zebrafish Knockdown, antagomiR, ISH, luciferase reporter assay, qRT-PCR Cardiac patterning Morton et al. (2008) miR-21, miR-218a Zebrafish Knockdown, overexpression, ISH, qRT-PCR, luciferase reporter assay Heart valve formation Chiavacci et al. (2012) and Banjo et al. (2013) let-7e,f,g,h,i,j,k,l,m,n,o, miR-1a, miR-20, miR-21a,b,c, miR-29a,b, miR-103, miR-125, miR-126a,b, miR-128c, miR-145, and miR-199b Asian seabass qRT–PCR ? [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
To date, investigation of the decreased expression of miR-199b in human choriocarcinoma by Chao et al indicated that epigenetic mechanisms play an important role in increasing the expression levels of protein phosphatase 2A inhibitor and contribute to the pathogenesis of human choriocarcinoma (14). [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 5
The observed 30% reduction of reporter expression is comparable to the in vitro effects of miR-199b and miR-214, targeting Dyrk1a and Ncx1, respectively, which have been shown to modify cardiac performance (22, 24). [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
mRNA targets of these two groups of miRNAs were identified using Tarbase 48, 49. miRPath was then used with the group of mRNAs targeted by miR-181a-5p, miR-150-5p, miR-145-5p, miR-425, miR199b-5p, miR-328-3p, miR-766-3p, and miR-142-3p to identify a list of enriched mRNA -associated pathways, identified at p < 0.0001 of statistical significance. [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 5
miR-199-5p also inhibits tumor growth by blocking Notch signaling, which inhibits the self-renewal ability of the CD133 [+] population [27]. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
For example, the upregulated miRNAs from Rooij et al. ' experiment are also enriched in miR-199a cluster (P = 4.33 × 10 [-3]), miR-199 family (P = 4.33 × 10 [-3]), cell cycle (P = 6.37 × 10 [-3]), stem cell regulation (P = 1.82 × 10 [-6]), inflammation (P = 3.14 × 10 [-3]), and onco-miRNAs (P = 5.73 × 10 [-5]). [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
Figure 1C shows some examples of miRNAs exhibiting good correlations between miRNA gene expression scores and actual miRNA expression values in this independent test set, such as hsa-miR-10b, hsa-miR-199b-5p, and hsa-miR-409-3p. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
MiR-199b-5p regulates the Hes1 gene, a key effector of the Notch pathway, and inhibits proliferation and survival of MB CD133 [+] cancer-stem-cell populations. [score:3]
We and others have described several miRNAs that are involved in MB development, including miR-125b, miR-324-5p, miR-326 and miR-199b-5p [6], [7], [8]. [score:2]
[1 to 20 of 2 sentences]
77
[+] score: 4
Amongst other over expressed miRNAs, miR199b has transcription factors like SOX4 and has been shown to be involved in liver cancer and muscular dystrophy [10, 11]. [score:3]
Apart from the let-7 family, other miRNAs like miR199b, miR22 & miR143 were also significantly overrepresented in both the intracellular and the extracellular hES-MSC samples. [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 4
The miR-199–miR-214 cluster is of particular interest because it is downregulated in the majority of hepatocellular carcinomas (HCCs) [25, 26], bladder [27], ovarian [28], and renal carcinomas [29] and in cancer-derived cell lines in experimental neoplastic and preneoplastic conditions [30]. [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 4
In addition, Juan et al. [39] showed that the expression of miR-199/214 might be regulated by PcG-proteins during skeletal muscle cell differentiation. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
Other miRNAs from this paper: hsa-mir-206, hsa-mir-449a, hsa-mir-433
Liu and coworkers demonstrated that increased expression of miR-199b-5p sensitized ovarian cancer cells to cisplatin -induced cytotoxicity. [score:3]
It seems, therefore, that the epigenetic silencing of miR-199b-5p is significantly associated with acquired chemoresistance in ovarian cancer cells through the activation of JAG1-Notch1 [61]. [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 4
In addition, miRNAs in cluster 4 (miR-199a, miR-199b, miR-200a, and miR-214) are significantly down-regulated in kidney tumors. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
E, Correlation of number of reads with cycle threshold (Ct) values obtained by real time quantitative PCR analysis of expression of 4 different microRNAs (miR-199a, miR-199b, miR-143 and miR-145). [score:3]
Four different miRNAs were tested (miR-199a, miR-199b, miR-143, miR-145), for two NF, three DCM and three HCM samples. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 4
Several studies focused on the tumor type -dependent function of miR-199-3p in tumors and cell lines have found that its downregulation enhances proliferation, invasiveness, and adhesion [45] and it is a predictor of worse prognosis in patients with osteosarcoma [46]. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
The miR-199* was also recently shown to control chondrogenesis in mice, via direct targeting to Smad1 [31]. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
2 −2.03(52) hsa-miR-134 14q32.2 −2.03(12, 29) hsa-miR-346 10q23.2 −2.01(12, 13) hsa-miR-324-5p 17p13.1 −2.00(12, 50) UPREGULATED hsa-miR-199b-3p 9q33.3 4.56(12) hsa-miR-199a-3p 19p13.2/1q24.1 4.49 hsa-miR-199a-5p 19p13.2/1q24.1 4.14(28) hsa-miR-21 17q22 3.70(12– 14, 29, 31) hsa-miR-214 1q24.2 3.59 hsa-miR-19a 13q31.3 3.11(12– 14) hsa-miR-92a-1* 13q31.3/Xq26.2 3.06 hsa-miR-214* 1q24.2 2.93 hsa-miR-34a 1p36.23 2.78(13, 30, 53) hsa-miR-18b Xq26.2 2.74 hsa-miR-422a 15q22.2 2.72(14) hsa-miR-34a* 1p36. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), a tobacco carcinogen, down-regulate miR-34, miR-101, miR-126, and miR-199 (Kalscheuer et al., 2008). [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 3
miR199-5b blocks HES-1 translation, driving neuronal differentiation. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
The three most abundantly expressed miRNAs in both groups were hsa-let-7f-5p, hsa-miR-199a-3p, and hsa-miR-199b-3p, accounting for 73.28%, 6.91%, and 6.91% of the miRNome, respectively. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
In this study, we found differentially deregulated microRNAs (mir21; mir199-a; mir155) among patients with HCV related hepatocellular carcinoma. [score:2]
Combining mirNAs with each other resulted in 100% sensitivity and specificity except combined miR199-a and miR 155 have 88.90% specificity. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 3
Of the 27 hairpins (30% of those tested) for which the observed change in the relative expression of the hairpin arms was exclusively associated with infection, three of them (miR-199b, miR-361, miR-582) showed a change in the identity of the dominant miRNA arm upon infection with at least one bacterium (Fig. 3B, S7 Fig. and S7 Table). [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
Several miRNAs have been identified which target MET oncogene, including miR-34a, miR-199, miR-206, and miR-1 that could be challenged in therapies for silencing MET. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
The most likely candidate miRNAs targeting the CFTR 3’UTR which overlapped in at least three prediction programs resulted miR-101, miR-144, miR-199-3p, miR-345, miR-376b, miR-377, miR-380, miR-494, miR-509-3p, miR-600 and miR-645. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Several deregulated miRNAs in HCC such as miR-195 [7], miR-101 [8], miR-122 [9], miR-221 [10], miR-224 [11] miR-223 [12], miR-21 [13] and miR-199 [14] have been shown to regulate cell growth, apoptosis, migration and invasion. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
These stringent criteria were met by 7 miRNAs that were specifically up-regulated in NK cells compared to NKT and T cells (miR-340-3p, miR-210, miR-199a-3p, miR-483-3p, miR-130a-3p, miR-199b-5p, and miR-362-5p) (Fig. 1e). [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
For instance, miR-125b-5p, miR-199b, and miR-378-3p showed elevated expression in nematode infection-elicited alternative macrophage activation [19]. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
ZNF91 belongs to a C [2]H [2] zinc finger (ZNF) gene family that is greatly expanded in the primate lineage and known to contain exceptionally abundant target sites for several miRNA families, including miR-23, miR-181 and miR-199 [28]. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2
Another speculation is that this variant may influence the recognition and targeting of miR-199 in the 3′UTR of CELSR2. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Other microRNAs regulating or regulated by TGFB1 were found to be changed in IPF lungs include miR-30, miR-199, miR-29, miR-26, miR-155, miR-326, and others (105). [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2
In conclusion, these results suggest that the loss of miR-199-3p expression in ovarian cancer is due to promoter hypermethylation which is enhanced by DNMT3A. [score:3]
[1 to 20 of 1 sentences]