sort by

335 publications mentioning hsa-mir-7-3 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-7-3. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 582
To emphasise this point, a study investigating miR-7 transient overexpression in ovarian cancer cells reported a change in the expression of hundreds of genes in diverse pathways; however, only ~20% of the regulated genes were predicted to be direct targets, concluding that the majority of the observed changes to gene expression are an indirect consequence of miR-7 expression and effect [74]. [score:12]
miR-7 targets and inhibits IKKε and RELA expression, and IKKε and RELA were found to suppress pri-miR-7 expression. [score:11]
Zhang et al. (2013) found miR-7 overexpression resulted in reduced proliferation and induced G1 phase arrest and apoptosis via targeting yin yang 1 transcription factor (YY1) in CRC [6] and Xu et al. (2014) showed miR-7 targets the protein X-ray repair complementing defective repair in Chinese hamster cells 2 (XRCC2) to inhibit proliferation and induce apoptosis [69]. [score:9]
Li Y. J. Wang C. H. Zhou Y. Liao Z. Y. Zhu S. F. Hu Y. Chen C. Luo J. M. Wen Z. K. Xu L. Tlr9 signaling repressed tumor suppressor mir-7 expression through up-regulation of hur in human lung cancer cells Cancer Cell Int. [score:8]
An earlier study by Pogribny et al. (2010) reported miR-7 expression directly targeted and significantly inhibited multidrug resistance -associated protein 1 (MPR1) which increased sensitivity to cisplatin in cisplatin-resistant breast cancer [95]. [score:8]
HOTAIR indirectly inhibits miR-7 expression via HOXD10 suppression. [score:8]
One of the additional remarkable features of miRNAs such as miR-7, is that they have the potential to target multiple parts of a signaling pathway simultaneously (e. g., EGFR) which can produce a more profound inhibition of signaling compared to targeting a single site of the pathway, with a tyrosine kinase inhibitor, such as erlotinib. [score:8]
Given miR-7 is demonstrated to participate in feedback and “feedforward” loops, as well as regulating several transcription factors, changes in miR-7 expression may result in a “ripple” effect; that is, the indirect regulation of the expression of other genes, and even miRNAs. [score:8]
KLF4, a known target of miR-7 [9, 57], elicits context -dependent oncogenic and tumour suppressive responses [71] and indeed, oncogenesis has been reported as a result of KLF4 suppression by miR-7 [9], as well as the opposite [57]. [score:7]
Expression of miR-7 stems from three loci in humans, MIR7-1, MIR7-2 and MIR7-3. MIR7-1 is located in the last intron of the wi dely expressed heterogeneous nuclear ribonucleoprotein K (hnRNPK) gene on chromosome 9 and is believed to be the most highly expressed source of mature miR-7 [12]. [score:7]
Other in vivo studies have reported miR-7 to inhibit angiogenesis in glioblastoma xenografts [60], suppress tumour progression in gastric cancer [61] and play a role in the de-repression of epigenetically silenced tumour suppressor genes, which result in decreased colony formation and cell cycle progression in breast cancer [62]. [score:7]
In work by Xiong et al. (2011), transient miR-7 overexpression inhibited migration, proliferation and induced apoptosis in A549 cells through targeting the anti-apoptotic molecule B-cell lymphoma 2 (BCL-2) [11]. [score:7]
Those shown in grey positively regulate miR-7 expression while those shown in orange negatively regulate miR-7 expression. [score:7]
Also, the antibacterial enoxacin was observed to increase the processing of certain miRNAs, including miR-7, from the precursor form to the mature form in R KO and HCT-116 CRC cell lines [99] while in another study, the histone deacetylase inhibitor Thichostatin A (TSA) was found to induce miR-7 in MDA-MB-231 breast cancer cells resulting in inhibition of EGFR expression [100]. [score:7]
Also, as observed in the studies conducted in A549 cells mentioned above [9, 10, 11, 43, 70] the experimental approach could be responsible for conflicting observations [41], which include scenarios whereby miR-7 is over- or under- expressed, the degree of miR-7 overexpression within the cell or whether miR-7 overexpression is sustained. [score:7]
We have found miR-7 to inhibit EGFR expression and signaling in A549 cells, consistent with it having a tumour suppressive effect [43]. [score:7]
Similarly, with respect to the mutational profile of the cell, STAT3 (an indirect target of miR-7) can either promote or suppress tumourigenesis depending on biochemical and genetic factors [72, 73]. [score:7]
In contrast, Rai et al. (2011) overexpressed miR-7 episomally and reported no significant growth inhibition in A549 cells, but showed suppressed growth in EGFR-addicted cell lines such as the NSCLC cell lines PC-9, H3255 and H1975. [score:7]
EGFR is a well described target of miR-7, is a prominent regulator of normal cell differentiation, development and proliferation, and is commonly targeted for therapy in cancer [3, 10, 32, 43, 50, 51, 52]. [score:7]
miR-7 in turn targets and inhibits translation of SRSF1 via its 3′UTR, completing a negative feedback loop [34]. [score:7]
Expression profiling data from our own group and others suggests that miR-7 targets ~100–200 mRNAs in cancer cells, many of those targets containing putative miR-7 binding sites, so that there is significant enrichment of miR-7 activity [4, 43]. [score:7]
Whilst miR-7 expression has frequently been reported to be downregulated in several malignancies [6, 7, 10, 33, 41, 43, 45, 54, 58], increased levels have been associated with tumour aggressiveness, most notably in oestrogen receptor positive/lymph node negative (ER+/LNN) breast cancer [63], urothelial carcinoma [64] and in Human papillomavirus (HPV) infected cervical cancer patients [65]. [score:6]
Studies carried out in the epithelial NSCLC cell line A549 have demonstrated varied roles for miR-7. The findings of Chou et al. (2010) are supported by an earlier study which found that inhibiting miR-7 downregulated A549 cell growth [70]. [score:6]
Xie J. Chen M. Zhou J. Mo M. S. Zhu L. H. Liu Y. P. Gui Q. J. Zhang L. Li G. Q. Mir-7 inhibits the invasion and metastasis of gastric cancer cells by suppressing epidermal growth factor receptor expression Oncol. [score:6]
Ma J. Fang B. Zeng F. Pang H. Zhang J. Shi Y. Wu X. Cheng L. Ma C. Xia J. Curcumin inhibits cell growth and invasion through up-regulation of mir-7 in pancreatic cancer cells Toxicol. [score:6]
An example of this is SETDB1, which is involved in maintaining stem cell state, and is downregulated by miR-7 leading to partial reversal of EMT and inhibition of invasion and metastasis in breast cancer stem cells isolated from the MDA-MB-231 cell line. [score:6]
However, miR-7 overexpression was also shown to attenuate EGFR expression in lung adenocarcinoma CLI-5 cells [8], suggesting the existence of an EGFR/miR-7 regulatory loop. [score:6]
Li et al. (2013) similarly found miR-7 expression to be impeded by toll like receptor 9 (TLR9) -induced HuR upregulation in lung cancer cells [36]. [score:6]
Additionally, viral oncogene E6/E7 expression in the HPV -positive HeLa cell line was associated with upregulated miR-7 [66]. [score:6]
In addition, Ning et al. (2014) have reported miR-7 can inhibit metastasis in HCC through perturbation of NF-κB signaling by way of directly targeting and decreasing RELA and subsequently NF-κB activation [5]. [score:6]
This finding is supported by an earlier study which also found miR-7 upregulation as a result of c-Myc expression in lymphoma [27]. [score:6]
Xu K. Chen Z. Qin C. Song X. Mir-7 inhibits colorectal cancer cell proliferation and induces apoptosis by targeting xrcc2 OncoTargets Ther. [score:6]
Downregulated HOTAIR showed an anti-correlative relationship with both HOXD10 and miR-7 in MDA-MB-231 breast cancer cells and miR-7 was inversely correlated with HOTAIR expression in breast cancer patients [33]. [score:6]
The significance of miR-7 in cancer is well-documented having been shown to directly target and inhibit key oncogenic signaling molecules involved in cell cycle, proliferation, invasion and metastasis. [score:6]
CAN-08-2103 18922890 3. Kefas B. Godlewski J. Comeau L. Li Y. Abounader R. Hawkinson M. Lee J. Fine H. Chiocca E. A. Lawler S. Microrna-7 inhibits the epidermal growth factor receptor and the akt pathway and is down-regulated in glioblastoma Cancer Res. [score:5]
Whilst the topic of miR-7 in cancer is the subject of a small number of reports suggesting an oncomiR-phenotype, the vast majority of literature indicates miR-7 is a tumour suppressor with many prominent oncogenic targets. [score:5]
Proteins which bind and stimulate or inhibit expression from a MIR7-3 promoter are currently unknown. [score:5]
Chen Y. J. Chien P. H. Chen W. S. Chien Y. F. Hsu Y. Y. Wang L. Y. Chen J. Y. Lin C. W. Huang T. C. Yu Y. L. Hepatitis b virus-encoded x protein downregulates egfr expression via inducing microrna-7 in hepatocellular carcinoma cells Evid. [score:5]
A summary of molecules involved in miR-7 regulation can be found in Table 1. jcm-04-01668-t001_Table 1 Table 1 Summary of miR-7 regulatory molecules and their effect on miR-7 expression in cancer cell lines. [score:5]
The lack of miR-7 expression in non-neuronal tissues, despite the widespread expression of the miR-7 host gene hnRNPK, is thought to be governed at the processing rather than at the transcriptional level [25]. [score:5]
Lebedeva et al. (2011) showed HuR knockdown to be negatively correlated to the specific and substantial upregulation of miR-7 [35]. [score:5]
In addition, Suto et al. (2015) found low miR-7 expression to be associated with poor prognosis in CRC and showed miR-7 could inhibit proliferation in SW480 cells [48]. [score:5]
Li Q. Zhu F. Chen P. Mir-7 and mir-218 epigenetically control tumor suppressor genes rassf1a and claudin-6 by targeting hoxb3 in breast cancer Biochem. [score:5]
This was found to be due to direct downregulation of KLF4, a transcription factor which mediates diverse cellular processes including proliferation, by miR-7 [9]. [score:5]
Wu D. G. Wang Y. Y. Fan L. G. Luo H. Han B. Sun L. H. Wang X. F. Zhang J. X. Cao L. Wang X. R. Microrna-7 regulates glioblastoma cell invasion via targeting focal adhesion kinase expression Chin. [score:5]
A summary of molecules involved in miR-7 regulation can be found in Table 1. jcm-04-01668-t001_Table 1 Table 1 Summary of miR-7 regulatory molecules and their effect on miR-7 expression in cancer cell lines. [score:5]
A number of studies have demonstrated restored therapeutic sensitivity to targeted treatments as a result of miR-7 expression in vitro. [score:5]
It is suggested that ciRS-7 may act as a buffer of miR-7 activity by competing with miR-7 targets, thereby reducing the availability of miR-7 for low-affinity target mRNAs. [score:5]
Li J. Zheng Y. Sun G. Xiong S. Restoration of mir-7 expression suppresses the growth of lewis lung cancer cells by modulating epidermal growth factor receptor signaling Oncol. [score:5]
This review is focused on miR-7 and its clinical potential in cancer, as a therapeutic molecule in itself or as a target for overexpression. [score:5]
Binding of these proteins to MIR7-1 and MIR7-2 promotor regions is illustrated in Figure 1. The transcription factor Forkhead box P3 (FOXP3) which also positively regulates miR-7 expression in breast cancer [28] has been found to have potential binding regions in the locality of MIR7-1 and MIR7-2 genes [29]. [score:4]
Further, ubiquitin-specific peptidase 18 (Usp18) negatively regulates miR-7 expression. [score:4]
2. microRNA-7 Expression and Regulation. [score:4]
Rai K. Takigawa N. Ito S. Kashihara H. Ichihara E. Yasuda T. Shimizu K. Tanimoto M. Kiura K. Liposomal delivery of microrna-7 -expressing plasmid overcomes epidermal growth factor receptor tyrosine kinase inhibitor-resistance in lung cancer cells Mol. [score:4]
Moreover, miR-7 was also shown to cause cell cycle arrest in G1 phase by directly targeting cyclin E1 (CCNE1) in HCC [47]. [score:4]
Studies suggest miR-7 may have a key role in pancreatic beta cell development and maturation and accordingly is postulated to be a therapeutic target in diabetes [22, 23]. [score:4]
At the transcriptional level, miR-7 expression has been shown to be promoted by epidermal growth factor receptor (EGFR) signaling in lung cancer via Rat sarcoma (Ras)/extracellular signal-regulated kinase (ERK)/v-Myc avian myelocytomatosis viral oncogene homolog (c-Myc) and phosphoinositide 3-kinase (PI3K)/v-Akt murine thymoma viral oncogene homolog (Akt) pathways. [score:4]
Knockdown of Usp18 was found to increase expression of miR-7 host genes and intergenic pri-miR-7-2 and subsequently mature miR-7 [32]. [score:4]
miR-7 has also been shown to inhibit proliferation in vitro and importantly, tumour growth in vivo, with regulation of EGFR commonly being attributed to this effect [4, 48, 49]. [score:4]
An in vitro study by Suto et al. (2015) showed miR-7 overexpression increased sensitivity to cetuximab in HCT-116 and SW480 cetuximab-resistant CRC cells harbouring a Kirsten rat sarcoma viral oncogene homolog (KRAS) mutation. [score:4]
Results from microarray and qPCR analyses in gefitinib resistant A549 cells compared to the parental A549 cell line found miR-7 to be downregulated which suggests possible involvement in the development of gefitinib resistance, however further study is required to identify whether miR-7 has the potential to improve gefitinib sensitivity [97]. [score:4]
Whilst the exact mechanism of miR-7 stimulation via the PI3K/Akt pathway is yet to be identified, the transcription factor c-Myc was found to directly bind and stimulate expression from the MIR7-1 promoter [8]. [score:4]
Other transcription factors have similarly been involved in promoting miR-7 expression via directly interacting with the promoter regions of miR-7 genes including homeobox D10 (HOXD10) via the MIR7-1 promoter region in breast cancer [2] and Hepatocyte Nuclear Factor 4 alpha (HNF4α) via the MIR7-2 promoter in hepatocellular carcinoma (HCC). [score:4]
Alternatively, several publications have highlighted the potential for small molecules to affect and regulate miR-7 expression, opening up further therapeutic possibilities. [score:4]
Tu C. Y. Chen C. H. Hsia T. C. Hsu M. H. Wei Y. L. Yu M. C. Chen W. S. Hsu K. W. Yeh M. H. Liu L. C. Trichostatin a suppresses egfr expression through induction of microrna-7 in an hdac-independent manner in lapatinib -treated cells BioMed Res. [score:4]
One example of this is curcumin, which has been shown to upregulate a number of miRNAs, including miR-7, in pancreatic cancer [98]. [score:4]
miR-7 expression is further negatively regulated by the oncogenic long non-coding RNA, Hox transcriptase antisense RNA (HOTAIR). [score:4]
The regulation of mature miR-7 expression occurs at the transcriptional level as well as at various stages throughout the miRNA maturation process, and there are many examples. [score:4]
The regulatory capacity of miR-7 is complex, given the numerous targets reported across many cell types. [score:4]
However, miR-7 was ineffective in the CRC cell line HT-29 which expresses a v‑Raf murine sarcoma viral oncogene homolog B (BRAF) mutation. [score:4]
Shi Y. Luo X. Li P. Tan J. Wang X. Xiang T. Ren G. Mir-7-5p suppresses cell proliferation and induces apoptosis of breast cancer cells mainly by targeting reggamma Cancer Lett. [score:4]
Chen H. Shalom-Feuerstein R. Riley J. Zhang S. D. Tucci P. Agostini M. Aberdam D. Knight R. A. Genchi G. Nicotera P. Mir-7 and mir-214 are specifically expressed during neuroblastoma differentiation, cortical development and embryonic stem cells differentiation, and control neurite outgrowth in vitro Biochem. [score:4]
miR-7 also targets key regulators of migration, invasion and epithelial-mesenchymal transition (EMT). [score:4]
For example, Proteasome Activator Subunit 3 (PA28γ) which promotes cell cycle progression has been shown to be directly targeted by miR-7 in the hamster ovarian cell line CHO, non-small cell lung cancer (NSCLC) and breast cancer via its 3′-UTR [44, 45, 46]. [score:4]
Xiong S. Zheng Y. Jiang P. Liu R. Liu X. Chu Y. Microrna-7 inhibits the growth of human non-small cell lung cancer a549 cells through targeting bcl-2 Int. [score:4]
Xiong S. Zheng Y. Jiang P. Liu R. Liu X. Qian J. Gu J. Chang L. Ge D. Chu Y. Pa28gamma emerges as a novel functional target of tumour suppressor microrna-7 in non-small-cell lung cancer Br. [score:4]
Additionally, miR-7 affects the activity of multiple oncogenic molecules in the EGFR signaling cascade such as Akt and ERK1/2 [4, 53], V-Raf-1 murine leukemia viral oncogene homolog (RAF1) [4, 10, 43, 53], P21 protein (Cdc42/Rac)-activated kinase 1 (PAK1) [2, 51], activated CDC42 kinase 1 (ACK1) [51], phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta (PIK3CD), mammalian target of rapamycin (mTOR), phosphoprotein 70 ribosomal protein S6 kinase (p70S6K) [54] and PI3K [53] across several cancer types, demonstrating broad regulatory control over this signaling network. [score:4]
One of miR-7’s key clinical applications may relate to its capacity to sensitise tumours that are resistant to other targeted therapies (e. g., erlotinib). [score:3]
To strengthen this argument, naturally immortalised skin cells HaCaT also exhibited enhanced proliferation upon stable miR-7 overexpression. [score:3]
This was reportedly due to miR-7 targeting of not only EGFR but also RAF-1 which plays an key role in mutant KRAS signaling, but not in BRAF mutants [48]. [score:3]
In summary, clearly the role of miR-7 in lung cancer is more complex than initially envisaged, and may be particularly cell type specific and possibly dependent on the method of influencing miR-7 expression experimentally. [score:3]
In contrast to these examples, many reports suggest a tumour suppressive role for miR-7 in CRC. [score:3]
miR-7 expression is further promoted by hepatitis B virus X protein (HBx) in hepatitis B virus -associated HCC. [score:3]
Meza-sosa et al. (2014) showed that miR-7 induced proliferation and migration in A549 cells stably overexpressing miR-7, suggesting miR-7 may act as an oncomiR in an epithelial context. [score:3]
In addition, transfection with anti-miR-7 was shown to suppress cell growth in DLD-1 and COLO201 [67]. [score:3]
As the overwhelming majority of reports suggest miR-7 acts as a tumour suppressor, there is increasing focus on replacement therapy. [score:3]
In addition, several studies have demonstrated the clinical potential of miR-7 as a biomarker in diagnosis and prognosis of disease. [score:3]
Duex J. E. Comeau L. Sorkin A. Purow B. Kefas B. Usp18 regulates epidermal growth factor (egf) receptor expression and cancer cell survival via microrna-7 J. Biol. [score:3]
Bravo-Egana V. Rosero S. Molano R. D. Pileggi A. Ricordi C. Dominguez-Bendala J. Pastori R. L. Quantitative differential expression analysis reveals mir-7 as major islet microrna Biochem. [score:3]
The pattern of ciRS-7 expression in the mouse brain closely aligns with that of miR-7, especially in the hippocampus and neocortex [39] and in the developing brain of mouse embryos [40]. [score:3]
In colorectal cancer (CRC), miR-7 was found to be upregulated in advanced cancers and in selected cell lines (SW480, DLD-1, and COLO201) compared to normal mucosa. [score:3]
Zhang X. Hu S. Zhang X. Wang L. Zhang X. Yan B. Zhao J. Yang A. Zhang R. Microrna-7 arrests cell cycle in g1 phase by directly targeting ccne1 in human hepatocellular carcinoma cells Biochem. [score:3]
Saydam O. Senol O. Wurdinger T. Mizrak A. Ozdener G. B. Stemmer-Rachamimov A. O. Yi M. Stephens R. M. Krichevsky A. M. Saydam N. Mirna-7 attenuation in schwannoma tumors stimulates growth by upregulating three oncogenic signaling pathways Cancer Res. [score:3]
Although miR-7 is expressed wi dely at low levels, it is enriched in various regions of the brain, particularly the pituitary [18] (noting the location of MIR7-3 in the intron of pituitary-specific PGSF1), hypothalamus [19] and pancreatic islets [20, 21]. [score:3]
In an earlier study, Wang et al. (2013) was able to inhibit glioma xenograft growth and metastasis using a plasmid based miR-7 vector systemically delivered by encapsulation in a cationic liposome formulation [59]. [score:3]
Shi et al. (2015) reported that miR-7 suppresses cell proliferation and induces G0/G1 phase arrest and apoptosis in breast cancer in part, via its interaction with PA28γ [46]. [score:3]
Whilst ciRS-7 is able to considerably attenuate miR-7 activity and thereby reduce repression of miR-7 targets [39], the biological function of ciRS-7 is yet to be defined. [score:3]
Kalinowski F. C. Brown R. A. Ganda C. Giles K. M. Epis M. R. Horsham J. Leedman P. J. Microrna-7: A tumor suppressor mirna with therapeutic potential Int. [score:3]
Veerla S. Lindgren D. Kvist A. Frigyesi A. Staaf J. Persson H. Liedberg F. Chebil G. Gudjonsson S. Borg A. Mirna expression in urothelial carcinomas: Important roles of mir-10a, mir-222, mir-125b, mir-7 and mir-452 for tumor stage and metastasis, and frequent homozygous losses of mir-31 Int. [score:3]
Correa-Medina M. Bravo-Egana V. Rosero S. Ricordi C. Edlund H. Diez J. Pastori R. L. Microrna mir-7 is preferentially expressed in endocrine cells of the developing and adult human pancreas Gene Expr. [score:3]
2012.11.086 23206698 8. Chou Y. T. Lin H. H. Lien Y. C. Wang Y. H. Hong C. F. Kao Y. R. Lin S. C. Chang Y. C. Lin S. Y. Chen S. J. Egfr promotes lung tumorigenesis by activating mir-7 through a ras/erk/myc pathway that targets the ets2 transcriptional repressor erf Cancer Res. [score:3]
3.1. miR-7 is a Tumour Suppressor. [score:3]
Key molecular targets of miR-7 in various tumourigenic processes and pathways have been systematically and extensively reviewed recently by Kalinowski et al. (2014) and by Gu et al. (2015) [41, 42]. [score:3]
In a study developed by Babae et al. (2014), a miR-7 mimic was systemically delivered using clinically viable, biodegradable, targeted polyamide nanoparticles. [score:3]
Zhang et al. (2013) reported miR-7 to be downregulated in CRC tumours and in six out of seven CRC cell lines when compared to normal colon tissue (these cell lines included SW480 and DLD-1) [6]. [score:3]
However, there is also evidence to the contrary with a number conflicting reports suggesting both a tumour suppressive and oncogenic role for miR-7, particularly in lung cancers [8, 9, 10, 11]. [score:3]
In contrast, in another cancer phenotype, Okuda et al. (2013) have suggested that low levels of miR-7 and inversely high KLF4 expression may be useful as prognostic biomarkers for predicting brain metastasis of breast cancer [57]. [score:3]
In a study identifying miRNA biomarkers involved in the progression of hormone-sensitive prostate cancer to castrate-resistant prostate cancer (CRPC), Santos et al. (2014) identified miR-7 levels in peripheral whole blood as a useful prognostic biomarker for CRPC development. [score:2]
Okuda H. Xing F. Pandey P. R. Sharma S. Watabe M. Pai S. K. Mo Y. Y. Iiizumi-Gairani M. Hirota S. Liu Y. Mir-7 suppresses brain metastasis of breast cancer stem-like cells by modulating klf4 Cancer Res. [score:2]
Liu Z. Jiang Z. Huang J. Huang S. Li Y. Yu S. Yu S. Liu X. Mir-7 inhibits glioblastoma growth by simultaneously interfering with the pi3k/atk and raf/mek/erk pathways Int. [score:2]
Santos J. I. Teixeira A. L. Dias F. Mauricio J. Lobo F. Morais A. Medeiros R. Influence of peripheral whole-blood microrna-7 and microrna-221 high expression levels on the acquisition of castration-resistant prostate cancer: Evidences from in vitro and in vivo studies Tumour Biol. [score:2]
Figure 1Transcriptional regulation of miR-7 by proteins confirmed to bind to MIR7 promoter regions. [score:2]
microRNA-7 (miR-7) is considered to be a tumour suppressor miRNA in a number of malignancies such as breast [2], brain [3], head and neck [4], liver [5], colon [6] and melanoma [7]. [score:2]
Post-transcriptional regulation of miR-7 is promoted by serine/arginine-rich splicing factor 1 (SRSF1, also known as SF2/ASF) in a splicing-independent fashion. [score:2]
The complete role of miR-7 in the brain is yet to be fully elucidated, however recent studies suggest it has roles in brain and neuronal cell development [24]. [score:2]
2012.526 23208495 7. Giles K. M. Brown R. A. Epis M. R. Kalinowski F. C. Leedman P. J. Mirna-7-5p inhibits melanoma cell migration and invasion Biochem. [score:2]
Zhao X. -D. Lu Y. -Y. Guo H. Xie H. -H. He L. -J. Shen G. -F. Zhou J. -F. Li T. Hu S. -J. Zhou L. Microrna-7/nf-κb signaling regulatory feedback circuit regulates gastric carcinogenesis J. Cell Biol. [score:2]
Hence, the role/s of miR-7 may be adversely affected by the cells mutational background. [score:2]
miR-7 was also reported to be increased in the stool of CRC patients, giving rise to the notion of a screening method for CRC [68]. [score:1]
Similarly, in an earlier study, Wang et al. (2013) showed that miR-7 transfected into glioma cells reduced the active phosphorylated form of STAT3 [59]. [score:1]
They are subsequently cleaved by Drosha to generate hairpin precursor miRNAs termed pre-miR-7-1, pre-miR-7-2 and pre-miR-7-3. Following Drosha cleavage, the resulting precursor miRNAs which are ~110 nt in length are transported to the cytoplasm where the terminal loop is removed by Dicer, creating a short duplex mature miRNA consisting of a miR-7-5p and miR-7-3p strand. [score:1]
Each miR-7 gene gives rise to three unique primary miRNA transcripts termed pri-miR-7-1, pri-miR-7-2 and pri-miR-7-3. Primary miRNA transcripts are commonly >1000 nt in length and contain stem-loop structures [1]. [score:1]
Kitano et al. (2012) found miR-7 to be a useful biomarker for the prediction of benign thyroid tumours from malignant thyroid cancer, specifically in those cases where diagnosis is difficult to ascertain from fine-needle aspiration biopsies. [score:1]
A recent study in gastric cancer found miR-7 to be involved in a negative feeback loop with IKKε and v-Rel avian reticuloendotheliosis viral oncogene homolog A (RELA). [score:1]
Webster R. J. Giles K. M. Price K. J. Zhang P. M. Mattick J. S. Leedman P. J. Regulation of epidermal growth factor receptor signaling in human cancer cells by microrna-7 J. Biol. [score:1]
Rai et al. (2011) suggest that the level of EGFR-addiction will play an important role in the effect of miR-7 [10]. [score:1]
3.2. miR-7: The Oncogene?. [score:1]
3. The Role of microRNA-7 in Cancer. [score:1]
The transduction of signals between HBx and miR-7 activation is postulated to involve nuclear I kappa B kinase alpha (IKKα) and I kappa B kinase (IKK)/NF-κB signaling pathways, however, this relationship is yet to be elucidated [30]. [score:1]
gov/gene/?term=hsa-miR-7 (accessed on 11 June 2015) 14. [score:1]
5. Potential for microRNA-7 in Cancer Therapy. [score:1]
A circular RNA (circRNA) sponge for miR-7 termed “ciRS-7” (also referred to as CDR1NAT, CDR1-AS and CDR1as) has been recently identified [38, 39]. [score:1]
Additionally, miR-7 was found to increase sensitivity of NSCLC to paclitaxel (PTX) by promoting PTX -induced apoptosis [96]. [score:1]
Choudhury N. R. de Lima Alves F. de Andres-Aguayo L. Graf T. Caceres J. F. Rappsilber J. Michlewski G. Tissue-specific control of brain-enriched mir-7 biogenesis Genes Dev. [score:1]
In many cancer types, high or low levels of miR-7 have been associated with poor or more promising prognoses and may be harnessed for biomarker profiling. [score:1]
Therefore, miR-671 could possibly be considered a positive regulator of miR-7 either by release of ciRS-7 bound miR-7 or by reducing the number of available ciRS-7 molecules for miR-7 sequestration [12]. [score:1]
All three miR-7 loci give rise to the same mature miR-7 sequence which is evolutionarily conserved. [score:1]
In a study conducted by Wang et al. (2015), miR-7 was identified as one of three miRNAs (along with miR-93 and miR-409-3p) from an array of 723 human miRNAs, which were found to be powerful predictors of CRC. [score:1]
Conversely, the RNA binding protein, Human antigen R (HuR), negatively affects miR-7 maturation. [score:1]
5.1. miR-7 Replacement Therapy Alone and in Combination with Current Therapeutic Agents. [score:1]
ciRS-7 is suggested to act as a competing endogenous RNA or miRNA “sponge” in neuronal tissues and contains >70 seed-matched miR-7 binding sites. [score:1]
It has been suggested that miR-7 may enhance the effect of current therapeutic drugs. [score:1]
Furthermore, Musashi homolog 2 (MSI2) was found to bind to the terminal loop of the pri-miR-7 transcript in an HuR -dependent manner in non-neural cells resulting in failure of the pri-miR-7-1 transcript to mature [25]. [score:1]
Chou et al. (2010) reported miR-7 to be induced via EGFR/Ras/ERK/Myc signaling and subsequently promote cell proliferation and tumour formation. [score:1]
Higher miR-7 levels in peripheral whole-blood in combination with high-Gleason score tumours was correlated with significantly earlier progression to castrate resistance and further trended toward lower overall survival of patients [94]. [score:1]
One strategy is systemic administration and delivery of miR-7. Two methods have been used to successfully deliver miR-7 in vivo to treat cancer. [score:1]
To date, the majority of studies have concentrated on miR-7-5p which is commonly referred to simply as “miR-7”. [score:1]
SRSF1 promotes maturation of many miRNAs including miR-7 via enhancing Drosha cleavage of the primary transcript. [score:1]
Hansen T. B. Kjems J. Damgaard C. K. Circular rna and mir-7 in cancer Cancer Res. [score:1]
It is speculated that upon ciRS-7 degradation, sequestered miR-7 is released. [score:1]
Quaking homologs, KH domain RNA binding 5 and 6 (QKI-5 and QKI-6), have also been implicated in the failure of miR-7-1 to be processed into mature miR-7 and exported to the cytoplasm in glioblastoma. [score:1]
Conflicting reports have also emerged regarding the role of miR-7 in lung cancer. [score:1]
In summary, the accumulating in vitro and in vivo preclinical data continues to build a strong case for the use of miR-7 replacement therapy in specific cancers, especially HCC and head and neck cancer. [score:1]
MIR7-2 is found in an intergenic region of chromosome 15, and MIR7-3 is located intronically within the pituitary gland specific factor 1 (PGSF1) gene on chromosome 19 [13]. [score:1]
Thus, further evaluation of miR-7 expression in carefully selected clinical cohorts will be required to refine the potential application as a biomarker. [score:1]
Potential for Small Molecule Activation of microRNA-7. 6. Conclusions. [score:1]
Genetic Influence on the Role of miR-7. 4. microRNA-7 Has Biomarker Potential. [score:1]
QKI binding sites were found in pri-miR-7-1 and pri-miR-7-2 but not pri-miR-7-3. QKI-5 and QKI-6 are speculated to increase association of miR-7-1 with Drosha [37]. [score:1]
Results from our laboratory showed miR-7 was able to increase the sensitivity of erlotinib-resistant head and neck cancer cells to erlotinib [4]. [score:1]
[1 to 20 of 159 sentences]
2
[+] score: 468
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2
In the current study, we found that miR-7 can inhibit FAK protein expression, while the expression of FAK is positively associated with the expressions of ERK and MAPK, indicating that miR-7 inhibits ERK/MAPK signaling pathway by targeting FAK. [score:13]
NSCLC cells in the logarithmic growth phase were assigned into 7 groups: blank group (non -transfected group); miR-7 mimics group (transfected with miR-7 mimics); miR-7 mimics control group (transfected with miR-7 mimic negative control [NC] sequence); miR-7 inhibitors group (transfected with miR-7 inhibitors); miR-7 inhibitors control group (transfected with miR-7 inhibitor NC sequence); FAK siRNA group (transfected with FAK siRNA plasmid); miR-7 inhibitors + FAK siRNA group (co -transfected with miR-7 inhibitors and FAK siRNA plasmid). [score:13]
A precious study revealed that miR-7 is identified to directly down-regulate FAK expression, and miR-7 inhibits EMT and metastasis of cancer cells through targeting FAK [30]. [score:11]
MiR-7 is a putative tumor suppressor in various solid tumors, and is reported to be down-regulated in NSCLC, which may suppress tumorigenesis by targeting a number of important proto-oncogenes and by inhibiting EGFR/AKT pathway activation [22, 23]. [score:11]
Further, Hao et al [21], Kong et al [30] and Wu et al [31] also indicated that, via targeting FAK expression, miR-7 is capable of inhibiting metastasis and invasion in cervical cancer, inhibiting epithelial-to-mesenchymal transition (EMT) and metastasis of breast cancer cells, and regulating glioblastoma cell invasion. [score:10]
Compared with adjacent normal tissues, miR-7 expression was down-regulated, but the mRNA and protein expressions of FAK, ERK and MAPK were up-regulated. [score:10]
These results suggested that the down-regulated expression of miR-7 may be implicated in the development and progression of NSCLC by up -regulating the expression of FAK mediated ERK/MAPK signaling pathway. [score:10]
In conclusion, miR-7 was lower expressed in NSCLC tissues and NSCLC cell lines and associated with LNM and TNM stages of NSCLC patients, indicating that the down-regulated expression of miR-7 may be implicated in the development and progression of NSCLC. [score:9]
Important findings in our study also showed that significantly increased miR-7 and decreased FAK mRNA expressions, decreased protein expressions of FAK, ERK and MAPK, and inhibited cell proliferation, migration and invasion were found in miR-7 mimic group; while opposite regarding miR-7 inhibitor group. [score:9]
We found that the miR-7 was lower expressed in the NSCLC tissues and NSCLC cell lines, but the expression levels of FAK, ERK and MAPK was up-regulated. [score:8]
Partially consist with the role of miR-7 in down -regulating FAK and inhibiting the ERK/MAPK signaling pathway, miR-7 overexpression is associated with suppressed proliferation, cell migration and tumorigenicity, and induced cell apoptosis in NSCLC cells [29]. [score:8]
Combining these significant results in the study, we support the hypothesis that miR-7 may inhibit the ERK/MAPK signaling pathway by down -regulating the targeted FAK, which can inhibit cell proliferation, migration and invasion in NSCLC cells. [score:8]
For the potential molecular mechanisms, the miR-7 can inhibit the activation of ERK/MAPK signaling pathway by down -regulating FAK expression, thereby suppressing the proliferation, migration and invasion of NSCLC cells. [score:8]
FAK, focal adhesion kinase; ERK, extracellular regulated protein kinases; MAPK, mitogen-activated protein kinase; miR-7, microRNA-7 (A. protein expressions of FAK, ERK and MAPK in A549 cells; B. Western-Blotting results in A549 cells; C. protein expressions of FAK, ERK and MAPK in H1299 cells; D. Western-Blotting results in H1299 cells); *, miR-7 mimics group compared with the mimics control group, P < 0.05; #, miR-7 inhibitor group compared with the inhibitors control group, P < 0.05. [score:8]
In addition, miR-7 inhibitors group had visibly decreased miR-7 expression and increased FAK mRNA expression, as compared to the miR-7 inhibitors control group, (both P < 0.05) (Figure 3). [score:8]
org) was used for miR-7 target prediction, and to verify whether FAK is a direct target gene of miR-7. Full-length 3′-untranslatedregion (3′-UTR) of the FAK gene was amplified, cloned and sequenced. [score:8]
The miR-7 can inhibit the activation of ERK/MAPK signaling pathway by down -regulating FAK expression, thereby suppressing the proliferation, migration and invasion of NSCLC cells. [score:8]
In H1299 cells, invasive cell numbers in miR-7mimics group were (168.27 ± 15.71), blank group (316.56 ± 19.41), mimics control group (309.64 ± 20.67), inhibitors control group (305.85 ± 19.72), miR-7 inhibitor group (437.70 ± 22.33), FAK siRNA group (158.43 ± 19.79) and miR-7 inhibitor + FAK siRNA group (301.17 ± 22.54). [score:7]
Figure 1 A. miR-7 expression and relative mRNA expressions of FAK, ERK and MAPK in metastatic NSCLC tissues, non-metastatic NSCLC tissues and the adjacent normal tissues; B. protein expressions of FAK, ERK and MAPK in metastatic NSCLC tissues, non-metastatic NSCLC tissues and the adjacent normal tissues. [score:7]
FAK, focal adhesion kinase 1; PTK2, protein tyrosine kinase 2; NC, negative control; miR-7, microRNA-7 Western-Blotting results showed, in A549 and H1299 cell lines, no distinct difference in protein expressions of FAK and ERK/MAPK among mimic NC group, inhibitor NC group, blank group or miR-7 inhibitor + FAK siRNA group (all P > 0.05). [score:7]
As shown in Figure 8, invasive cell numbers of A549 cells in miR-7 mimics group were (89.08 ± 12.56), blank group (223.51 ± 11.89), miR-7 inhibitor group (364.83 ± 12.24), mimics control group (225.53 ± 14.08), inhibitors control group (227.02 ± 13.92), FAK siRNA group (81.16 ± 9.64) and miR-7 inhibitor + FAK siRNA group (218.41 ± 18.65). [score:7]
As shown in Figure 7, migration distance of A549 cells in miR-7 mimics group was (435.22 ± 23.83) μm, blank group (625.45 ± 14.41) μm, miR-7 inhibitor group (765.15 ± 19.49) μm, mimics control group (624.70 ± 18.22) μm, inhibitors control group (626.32 ± 13.12) μm, FAK siRNA group (427.49 ± 17.75) μm and miR-7 inhibitor + FAK siRNA group (632.37 ± 23.38) μm. [score:7]
FAK, focal adhesion kinase; miR-7, microRNA-7. A. and FAK mRNA B. in A549 and H1299 cells in blank group, miR-7 mimic control group, miR-7 mimic group, inhibitor control group, miR-7 inhibitor group, FAK siRNA group and miR-7 inhibitor + FAK siRNA group detected by qRT-PCR; *, compared with the mimics control group, P < 0.05; #, compared with inhibitors control group, P < 0.05. [score:7]
NSCLC cells were assigned into miR-7 inhibitors, miR-7 mimics, blank, miR-7 mimics control, miR-7 inhibitors control, FAK siRNA and miR-7 inhibitors + FAK siRNA groups. [score:7]
Figure 5(A. protein expressions of FAK, ERK and MAPK in A549 cells; B. Western-Blotting results in A549 cells; C. protein expressions of FAK, ERK and MAPK in H1299 cells; D. Western-Blotting results in H1299 cells); *, miR-7 mimics group compared with the mimics control group, P < 0.05; #, miR-7 inhibitor group compared with the inhibitors control group, P < 0.05. [score:7]
The results of qRT-PCR showed that in A549 and H1299 cell lines, no distinct difference was found in the expressions of miR-7 and FAK mRNA among mimics control group, inhibitors control group, miR-7 inhibitor + FAK siRNA group and blank group (all P > 0.05). [score:7]
Figure 3 A. and FAK mRNA B. in A549 and H1299 cells in blank group, miR-7 mimic control group, miR-7 mimic group, inhibitor control group, miR-7 inhibitor group, FAK siRNA group and miR-7 inhibitor + FAK siRNA group detected by qRT-PCR; *, compared with the mimics control group, P < 0.05; #, compared with inhibitors control group, P < 0.05. [score:7]
And also, the miR-7 can inhibit NSCLC cells migration and invasion, and elevated miR-7 expression may enhance the inhibiting ability, which may decrease migration and invasion ability of NSCLC cells. [score:7]
In H1299 cells, migration distance in miR-7 mimics group was (488.26 ± 22.65) μm, blank group (683.74 ± 19.52) μm, miR-7 inhibitor group (789.41 ± 8.90) μm, mimics control group (675.83 ± 22.78) μm, inhibitors control group (662.76 ± 19.30) μm, FAK siRNA group (476.52 ± 26.63) μm and miR-7 inhibitor + FAK siRNA group (677.72 ± 27.56) μm. [score:7]
Based on previous findings, miR-7 targets paired box 6 (Pax6), and can promote NSCLC cell proliferation and invasion via activating the ERK/MAPK signaling pathways by negatively regulating Pax6 protein expression [19]. [score:6]
Furthermore, Luo and his colleagues have revealed that the ERK/MAPK signaling pathways were down-regulated in the miR-7 -overexpressed NSCLC A549 cells [19]. [score:6]
In the present study, we aimed to explore the potential roles of miR-7 in NSCLC cells and in FAK mediated ERK/MAPK signaling pathway through a series of experiments to inhibit the expression of ERK/MAPK in the regulation of the FAK pathway. [score:6]
results also showed that FAK is a direct target gene of miR-7. Further, miR-7, FAK, ERK and MAPK expressions were associated with LNM and TNM stages in NSCLC patients. [score:6]
The miR-7 expression and relative mRNA and protein expressions of FAK, ERK and MAPK in NSCLC tissues and the adjacent normal tissues;. [score:5]
While the growth rate of miR-7 inhibitors group was faster than that of the miR-7 inhibitors control group (P < 0.05). [score:5]
Cell proliferation, migration and invasion were inhibited in the miR-7 mimics and FAK siRNA groups, while opposite regarding miR-7 inhibitors group. [score:5]
The growth rate of miR-7 mimics group and FAK siRNA group had no significant difference (P > 0.05); no significant differences on the growth rate were observed among blank group, mimics control group, inhibitors control group and miR-7 inhibitor + FAK siRNA group (all P > 0.05). [score:5]
After 24 h cell transfection, the total RNA was extracted for qRT-PCR to detect relative expressions of miR-7 in the transfected cells; and after 72 h cell transfection, the total protein was extracted and the protein expressions of FAK, MAPK and ERK were detected by Western-Blotting (Table 2). [score:5]
These results showed that there was no significant difference in migration distance of A549 cells between blank group and mimics control group, inhibitors control group and miR-7 inhibitor + FAK siRNA group (all P > 0.05). [score:5]
The expressions of miR-7. Targeting relationship between miR-7 and FAK. [score:5]
The binding sites of miR-7 and target genes were subjected to site-specific mutagenesis, and pRL-TK vector expressing Renilla luciferase (TaKaRa) was used as internal reference to adjust differences in cell numbers and transfection efficiency. [score:5]
Quantitative real-time polymerase chain reaction (qRT-PCR) and Western-Blotting were used to verify the expressions of miR-7 and the mRNA and protein expressions of FAK and ERK/MAPK signal pathway-related proteins. [score:5]
The miR-7 and its target gene FAK may be novel targets for the diagnosis and treatment of NSCLC. [score:5]
All the miR-7 mimics, miR-7 mimic NC sequence, miR-7 inhibitors, miR-7 inhibitor NC sequence and FAK siRNA were purchased from Shanghai GenePharma Co. [score:5]
Correlations of clinicopathologica features of NSCLC patients with the expression of miR-7 and the mRNA and protein expressions of FAK and ERK/MAPK signaling pathway-related proteins. [score:5]
There was no visible difference in invasive cell numbers between blank group and mimics control group, inhibitors control group and miR-7 inhibitor + FAK siRNA group (all P > 0.05). [score:5]
In order to confirm that FAK is a direct target gene of miR-7, luciferase reporter vector recombinant plasmid pFAK-Wt and pFAK-Mut were constructed based on FAK mRNA 3′-UTR. [score:4]
org predicted that FAK/PTK2 is the target gene for miR-7 A. confirmed that FAK/PTK2 is the target gene of miR-7 in A549 cells and H1299 cells B. Note: *, compared with the miR-7 mimics NC group, P < 0.05. [score:4]
We suspected that the migration and invasion ability may be associated with the negative regulation of miR-7 ERK/MAPK signaling pathway by targeting FAK. [score:4]
Studies have shown that miR-7 was highly expressed in various tissues and organs, and involved in the development of tissues and organs and implicated in the cell proliferation, migration and invasion of various tumors, such as lung cancer, breast cancer, hepatocellular carcinoma and node cancer [10– 13]. [score:4]
Compared to the blank group, the miR-7 mimic group was associated with significantly decreased protein expressions of FAK, ERK and MAPK under the overexpression of miR-7 (all P < 0.05). [score:4]
However, miR-7 inhibitor group showed significantly increased protein expressions of FAK, ERK and MAPK as compared to the blank group (all P < 0.05) (Figure 5). [score:4]
Compared with the mimics control group, significantly increased miR-7 expression and decreased FAK mRNA expression were found in the miR-7 mimics group (both P < 0.05). [score:4]
Extensive roles of miR-7 in regulating cancer cell initiation, proliferation, migration, invasion, survival and death by targeting a number of oncogenic signaling pathways have been reported [27, 28]. [score:4]
In the miR-7 mimics group, invasive cell numbers were reduced due to diminished cell invasion ability, and cells were wi dely spaced; contrarily, close cell distribution and larger invasive cell numbers were found in the miR-7 inhibitors group. [score:3]
Compared to the mimics control group, cell invasion ability was significantly decreased in the miR-7 mimics group, while cell invasion ability was significantly enhanced in the miR-7 inhibitor group, compared with inhibitors control group (both P < 0.05). [score:3]
Compared to the mimics control group, miR-7 mimic group showed significantly reduced cell migration ability (P < 0.05), while cell migration ability was enhanced significantly in the miR-7 inhibitor group as compared to the inhibitors control group (P < 0.05). [score:3]
We found that expressions of miR-7, FAK, ERK and MAPK are associated with LNM and TNM stages in NSCLC patients, posing a potential role of miR-7 and its downstream pathway as non-invasive biomarkers for assessing NSCLC clinical outcome. [score:3]
Thus, FAK is the potential target gene of miR-7. Figure 4 MicroRNA. [score:3]
A. comparison of the invasive cell numbers of A549 cells in each group; B. results of A549 cells under light microscope; C. comparison of invasive cell numbers of H1299 cells among each group; D. results of H1299 cells under light microscope; *, miR-7 mimics group compared with the mimics control group, P < 0.05; #, miR-7 inhibitor group compared with the inhibitors control group, P < 0.05. [score:3]
No significant differences in protein expressions of FAK, ERK and MAPK were observed between miR-7 mimics group and FAK siRNA group (all P > 0.05). [score:3]
NSCLC cell lines with the lowest expression of miR-7 were used for further study. [score:3]
It has been reported that downexpression of miR-7 in NSCLC may be implicated in promoting cancer cell progress, and consequently results in NSCLC growth [19, 24], which were in line with our study results. [score:3]
Low expression level of miR-7 was significantly correlated with LNM in patients with cervical cancer [26]. [score:3]
Thus, FAK is the potential target gene of miR-7. Figure 4 MicroRNA. [score:3]
As shown in Figure 1, the expression of miR-7 in adjacent normal tissues was higher that in NSCLC tissues (P < 0.05). [score:3]
The qRT-PCR results showed that the expressions of miR-7 in A549, H1299 and H1355 cell lines were lower than that in MRC5 cell line (all P < 0.05). [score:3]
org) showed that miR-7 is able to target FAK (Figure 4A). [score:3]
However, the expressions of miR-7, FAK, ERK and MAPK were associated with LNM and TNM stage of NSCLC patients (all P < 0.05). [score:3]
MiR-7 is implicated in the development and progression of tumors, and can inhibit the occurrence of many tumors and metastasis. [score:3]
As a result, miR-7 was lowly expressed in NSCLC tissues and cell line. [score:3]
No significant differences on the expressions of miR-7 and FAK mRNA were found between FAK siRNA group and miR-7 mimics group (all P < 0.05). [score:3]
Figure 8 A. comparison of the invasive cell numbers of A549 cells in each group; B. results of A549 cells under light microscope; C. comparison of invasive cell numbers of H1299 cells among each group; D. results of H1299 cells under light microscope; *, miR-7 mimics group compared with the mimics control group, P < 0.05; #, miR-7 inhibitor group compared with the inhibitors control group, P < 0.05. [score:3]
As shown in Figure 2, miR-7 was lowly expressed in A549 and H1299 cells, and thus A549 and H1299 cell lines were used for the following studies. [score:3]
miR-7 has been reported to suppress the key numbers of cancer cell signaling pathway, including EGFR/Ras/Raf/MEK/ERK1/2, EGFR/PI3K/Akt/mTOR, IGF1R/IRS, Integrin/FAK, Rac1/Pak1 and Ack1 -mediated signaling transduction, which may implicated in tumorigenesis, progression and metastasis [18]. [score:3]
As further extended by a recent study, miR-7 presents biological functions in NSCLC acting as a useful mediator in suppressing growth and inducting apoptosis in NSCLC cells [32]. [score:3]
Furthermore, miR-7 partially targets FAK and acted a key player in the integrin beta (1)-FAK signaling axis, which has been demonstrated in the control of the proliferation of micrometastatic cancer cells disseminated in the lungs [20, 21]. [score:3]
As shown in Table 1, the expressions of miR-7, FAK, ERK and MAPK showed no associations with gender, age, tumor location, tumor size or histological type in NSCLC patients (all P > 0.05). [score:3]
Clinicopathological factors of NSCLC patients and expressions of miR-7 and its downstream proteins. [score:3]
To better understand the potential molecular mechanism of miR-7 on the development of NSCLC, we conducted in vitro study based on the A549 and H1299 NSCLC cell lines. [score:2]
Compared with the blank and mimics control groups, miR-7 significantly increased but FAK, ERK and MAPK expressions decreased in miR-7 mimics and FAK siRNA groups. [score:2]
Figure 2The miR-7 expression in A549, H1299, H1355 and MRC5 cell lines; *, compared with the MRC5 cell line, P < 0.05. [score:2]
MiR-7 and FAK mRNA expressions in A549 and H1299 cell lines after transfection. [score:2]
In the present study, we aimed to investigate the potential roles of miR-7 and its target gene FAK mediated by ERK/MAPK signaling pathway in the regulation of cell proliferation, migration and invasion in NSCLC cells. [score:2]
In addition, miR-7 is a tissue-specific miR to be directly involved in NSCLC [25]. [score:2]
MiR-7 expression in A549, H1299, H1355 and MRC5 cell lines. [score:2]
FAK, focal adhesion kinase; miR-7, microRNA-7. Biological prediction website (www. [score:1]
No significant difference was observed between FAK siRNA group and miR-7 mimics group (P > 0.05). [score:1]
MiR-7 mimics and miR-7 mimic NC were respectively co -transfected with luciferase reporter vector into NSCLC cells. [score:1]
MiR-7, microRNA-7; MTT, methyl thiazolyl tetrazolium. [score:1]
Figure 7 A. comparison of scratch width of A549 cells among each group; B. wound scratch assay results of A549 cells under light microscope; C. comparison of scratch width of H1299 cells among each group; D. wound scratch assay results of H1299 cells under light microscope; *, miR-7 mimics group compared with the mimics control group, P < 0.05; #, miR-7 inhibitor group compared with the inhibitors control group, P < 0.05. [score:1]
A. comparison of scratch width of A549 cells among each group; B. wound scratch assay results of A549 cells under light microscope; C. comparison of scratch width of H1299 cells among each group; D. wound scratch assay results of H1299 cells under light microscope; *, miR-7 mimics group compared with the mimics control group, P < 0.05; #, miR-7 inhibitor group compared with the inhibitors control group, P < 0.05. [score:1]
Therefore, we hypothesized that miR-7 may affect cell proliferation, migration and invasion of NSCLC cells through ERK/MAPK signaling pathways. [score:1]
Effects of miR-7 on the proliferation of A549 cells and H1299 cells. [score:1]
No visible difference in invasive cell numbers was found between FAK siRNA group and miR-7 mimics group (P > 0.05). [score:1]
The effect of miR-7 on the cell proliferation of A549 and H1299 cells detected by MTT method;. [score:1]
Effect of miR-7 on the invasion of A549 cells and H1299 cells. [score:1]
Effect of miR-7 on the migration of A549 cells and H1299 cells. [score:1]
To investigate the effects of microRNA-7 (miR-7) on the proliferation, migration and invasion of non-small cell lung cancer NSCLC) cells by targeting FAK through ERK/MAPK signaling pathway. [score:1]
MicroRNA-7 (miR-7), located on human chromosome 9q21, is an important member of the miRNA family and its mature body is composed of 23 nucleotides [9]. [score:1]
[1 to 20 of 100 sentences]
3
[+] score: 388
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2
Conversely, while the target genes of the Notch pathway, E(spl)m3 and E(spl)m4 [48] as well as E(spl)mγ, Bob, E(spl)m5, and E(spl)mδ [60], have been identified as direct targets of miR-7 in the normal wing disc via analysis of 3′UTR sensors, there was no evidence that HLHm3, HLHm4, HLHm5, Bob, and HLHmγ are biological relevant targets of miR-7 in the Dl overexpression context. [score:10]
We hypothesized that mir-7 overexpression would be mimicked by endogenous downregulation of the functional relevant target gene(s) in the context of Dl overexpression. [score:10]
Thus, specific down-regulation of endogenous ihog, a predicted target of miR-7, facilitates overgrowth by Dl overexpression similar to those that develop when mir-7 is overexpressed in this context (Figure 1, Figure 2, and Figure S4H). [score:10]
The advanced MF is seen in ey>Dl eye discs with downregulation of Hh signalling via overexpression of mir-7 or direct downregulation via RNAi transgenes (Figures S3 and S4). [score:10]
In conclusion, we have identified cooperation between the microRNA miR-7 and Notch in the D. melanogaster eye and identified and validated ihog as a direct target of the miR-7 in this context and have identified boi as a target of Notch -mediated activity at the DV eye organizer, although it remains whether this regulation is direct or indirect. [score:9]
Indeed, of the 39 predicted miR-7 target genes tested by direct RNAi, only downregulating ihog with several RNAi transgenes (UAS-ihog-IR) fully mimicked the effect of miR-7 overexpression in the transformation of Dl -induced mild overgrowth into severe overgrowth and even tumour-like growth. [score:9]
However, since miR-7 only very subtly reduces the expression of endogenous hairy and a GFP-3′UTR hairy sensor [48], we focused our interest on the gene, interference hedgehog (ihog), that when downregulated in Dl -overexpressing cells provoked robust overgrowth (Figure 2, Figure S4E–F,H, and Table S1). [score:8]
Nevertheless, the qRT-PCR comparisons between the different genotypes showed a trend in boi and ihog expression response to Dl overexpression that explains the cooperation between the miR-7 and Dl signalling, since there is the concomitant downregulation of the two functionally redundant Hh receptor genes, ihog and boi. [score:8]
The downregulation of smo (80% flies exhibited eye tumour-like growth, n >200), ci (100%, n>200), or hh (30%–100%, n>200) in conjunction with Dl overexpression provoked a tumour phenotype similar to that of RNAi of ihog but stronger than the overexpression of mir-7 (compare Figure 1 and Figure 2 with Figure 4B–D; see also Table S2). [score:8]
Identification of Candidate Tumour Suppressor Targets of miR-7 by in Vivo RNAi Screening in the Delta Overexpression Mo del. [score:7]
Figure S6Overexpression of DsRed::mir-7 by en-Gal4 in the wing disc also caused reproducible in vivo downregulation of eGFP in a tub-eGFP::ihog-3′UTR (A) but not in a tub-eGFP::boi-3′UTR sensor (B). [score:6]
However, downregulation of Notch signalling alone might not explain the synergism between mir-7 and Dl overexpression in eye overgrowth as we did not detect reduction of the organizing signalling by Dl-Notch in these discs (Figure S3). [score:6]
Note that the smo [3]/smo [3]tub-Gal4 UAS-Dl clones cause nonautonomously advancement of the MF denoted by up-regulated Ci levels, similar to the effect seen in eye discs co -expressing Dl with the mir-7. (A′) and (B′) show single channel confocal images. [score:6]
We used RNA interference (RNAi) UAS -driven transgenes (UAS-IR) to downregulate candidate and previously validated miR-7 target genes in vivo. [score:6]
Although not previously characterized as a target gene of miR-7, the downregulation of ihog by RNAi concomitant with the gain of Dl function consistently produced enlarged eye discs (Figure S4E–F) similar to that in eye discs co -expressing Dl and mir-7 (Figure S3I–J), resulting in adults with overgrown and folded eyes (ey>Dl>ihog-IR: 80% of severe overgrown eyes, n = 200; Figure 2B and Table S1). [score:6]
In addition to the direct regulation of the ihog mRNA 3′UTR by miR-7 in vitro, there was specific in vivo repression of the tub-luc::ihog-3′UTR construct but not the ihog 3′UTR construct that carried the mutations in the seed sequence (Figure 2FG) and of an ihog 3′UTR eGFP sensor (tub-eGFP::ihog-3′UTR) but not a similar boi 3′UTR eGFP sensor (tub-eGFP::boi-3′UTR) (Figure S6AB) in the posterior compartment cells of third instar wing discs overexpressing mir-7 driven by engrailed (en) -Gal4. [score:6]
brother of ihog Is Negatively Regulated by Notch Signalling during Eye GrowthAlthough boi mRNA expression was not affected in the ihog-IR lines and Boi does not appear to be a target of miR-7, there is a well-documented functional overlap in the roles of Ihog and Boi. [score:6]
The weak downregulation of Ci by mild RNAi expression using ptc-Gal4 mimicked the L3–L4 fusion defect of ptc>mir7 (Figure 6C–D). [score:6]
In human cancer cells, miR-7 has been postulated to have an oncogene [89], [90] or a tumour suppressor functions [91]– [96] that may reflect the participation of the microRNA in distinct pathways, due to the regulation of discrete target genes in different cell types, such as Fos [97] in mouse, and Pak1 [91], IRS-2 [92], EGFR [92], [93], Raf-1 [93], α -synuclein [98], CD98 [99], IGFR1 [94], bcl-2 [100], PI3K/AKT [101], [102], and YY1 [103] in humans. [score:6]
However, although it remains to be shown whether similar interactions are active during cell proliferation and growth, the moderate enhancement of Dl that is induced when Tom is downregulated by RNAi suggests that miR-7 -mediated repression of Tom may contribute to the oncogenic effects of miR-7 in the context of Dl gain of function, along with other targets such as ihog. [score:6]
Importantly, both boi and ihog mRNA levels were downregulated in eye discs that co-expressed Dl with the microRNA mir-7 (ey>Dl>mir-7; Figure 3J). [score:6]
In addition, by identifying and validating functionally relevant targets of miR-7 in tumourigenesis, we also exposed a hitherto unsuspected tumour suppressor role for the Hh signalling pathway in the context of the oncogenic Notch pathway. [score:5]
Indeed, expressing GS(2)518ND2 along the AP compartment boundary in the wing imaginal disc using patched (ptc) -Gal4 caused similar L3-–L4 fusion as that reported following mir-7 overexpression in this domain (ptc>GS(2)518; Figure 1G). [score:5]
Validation of Interference Hedgehog as a Direct Target of miR-7 in Vitro and in VivoSince the ihog gene encodes a receptor of Hh in the embryo, including the imaginal eye disc [30], we assessed whether it is directly regulated by miR-7 in luciferase reporter -based cellular assays in vitro and in vivo (Figure 2). [score:5]
Although boi mRNA expression was not affected in the ihog-IR lines and Boi does not appear to be a target of miR-7, there is a well-documented functional overlap in the roles of Ihog and Boi. [score:5]
We tested candidate target genes predicted by several algorithms ([52]; see ) and that contain the conserved Drosophila miR-7 binding sites, which normally reduces the number of false positive target predictions. [score:5]
Table S1Identification of candidate tumour-suppressor gene(s) of Drosophila in silico predicted miR-7 target genes in the gain of Dl context. [score:5]
Although it has been postulated that the microRNA mir-7 silences Notch signalling, the overexpression of mir-7 with Dl causes eye disc overgrowth associated with enhanced Dl-Notch signalling as detected by the misexpression of DV organizer-specific markers (F and H). [score:5]
Thus, the Ci low protein levels in ptc>mir-7 wing discs could reflect the direct repression of ci by the microRNA or the dampening of Hh signalling response by the miR-7 -mediated downregulation of ihog or both. [score:5]
We also did not obtain evidence that miR-7 provoked overgrowth by targeting the ETS transcription factor in the EGFR pathway AOP/Yan (Table S1), a functionally validated target of the microRNA miR-7 during retinal differentiation [47]. [score:5]
As expected, co -expressing Dl with the RNAi against ihog or ci with ey-Gal4 provoked overgrowth similar, but stronger than the misexpression of the mir-7. Anterior is to the left in all images, and dorsal is up. [score:5]
Note that when Ci full length is expressed in the context of Dl and mir-7 overexpression, although many eyes are substantially reduced in size they still exhibit abnormal patterned growth (see Figure 4L) and other exhibited enhanced tumorigenesis. [score:5]
Thus, expression differences between the control and Dl and/or mir-7 overexpressing eye-antennal disc complexes may be significant underestimations of the actual differences in the relevant eye disc part in each genotype. [score:5]
To identify the former, we considered that a bona fide miR-7 target gene would not produce any effect when downregulated in the context of normal Notch signalling. [score:5]
More consistently with indirect regulation of Ci by miR-7, we observed no change in Ci protein levels in wing discs ectopically expressing the mir-7 away from the normal Hh secreting cells (the P compartment cells marked by the absence of Ci (green) in Figure 6G). [score:5]
In addition, luciferase activity was unaffected by mir-7 overexpression in a control tub-luc::boi-3′UTR construct, indicative that the functional similar boi was not a target of miR-7 (Figure 2E). [score:5]
Confocal images of eye discs of control wild type (ey>, A, C, E, and G) and eye discs overexpressing Dl and mir-7 by ey-Gal4 (ey>Dl>GS(2)518: B, D, F, H–J) and carrying the indicated enhancer trap lines to monitor DV patterning: expression of D marker mirror-lacZ (mirr-Z), ventral marker fringe-lacZ (fng-Z), DV organizer-specific marker Serrate-lacZ (Ser-Z), and eyegone-lacZ (Eq-Z). [score:5]
Since human RAS regulates tumourigenesis in the lung by overexpressing miR-7 in an ERK -dependent manner [90], it is possible that RAS represses CDO and BOC via this microRNA. [score:4]
We identified the ihog gene as a functionally relevant, direct target of miR-7 in Notch -mediated tumourigenesis in vivo. [score:4]
Validation of Interference Hedgehog as a Direct Target of miR-7 in Vitro and in Vivo. [score:4]
Conversely, the direct overexpression of mir-7 together with Dl (hereafter, ey>Dl>mir-7), using a mir-7 transgene that does not contain any bl sequences (UAS-mir-7), provoked overgrown larval eye discs ey>Dl>mir-7 (Figure 1H; compare with sibling wild type eye discs, Figure 1I) associated with significant increased cell proliferation (Figure 1J and Figure S4C–D,H), resulting in adult overgrown and folded eyes similar to that in the GS(2)518ND2 flies (70% of adult ey>Dl>mir-7 animals displayed eye benign tumour-like growth, n = 200; Figure 1K and Figure S2A–C). [score:4]
Hence, the downregulation of ihog/boi levels by Dl/miR-7 (see Figure 3J) might reduce the interactions of Hh with Ptc. [score:4]
Indeed, we observed a clear downregulation of Ci protein levels in cells in ptc>mir-7 (Figure 6A–B″), which are precisely the cells receiving endogenous Hh signals and that upon normal Hh reception stabilize Ci protein levels and prevent the conversion of Ci-155 into truncated Ci repressor. [score:4]
These results raised the possibility that like ihog, ci is also a direct target of miR-7. Indeed, c i mRNA does contain a presumptive miR-7 binding site in the ci 3′UTR, although this site is not conserved across Drosophila species. [score:4]
Finally, we demonstrated that endogenous ihog mRNA was inhibited by miR-7 in vivo as heat shock induction of mature mir-7 overexpression (hsp70-Gal4 UAS-mir-7) provoked a 55% reduction in ihog mRNA transcripts in larvae when assayed by qRT-PCR (Figure 2H and Figure S2D). [score:4]
Therefore, either Ci is not a target of miR-7 or this regulation is context dependent. [score:4]
Further, we provide evidence that the microRNA mir-7 and Notch pathway cooperatively dampen Hh signal transduction via down-regulation of its receptors ihog and boi, respectively. [score:4]
The co -expression of UAS-mir-7 with UAS-Dl causes eye disc overgrowth and a front of retinal differentiation highly disorganized (H, compare with control sibling eye disc in I). [score:3]
In Drosophila, multiple, cell-specific, targets for miR-7 have been previously validated via luciferase or in vivo eGFP-reporter sensors or less extensively via functional studies [47], [49], [73], [104]– [107]. [score:3]
Previously, misexpression of mir-7 driven by ptc-Gal4 (ptc>mir-7) produces wing margin notches, and a reduction of the space between vein L3 and L4 ([48]; see [72]). [score:3]
Depleting ihog by RNAi driven by ptc-Gal4 did not produce a defect as mir-7 overexpression (Figure 6E). [score:3]
Larvae carrying both the chromosomes with the transgenes ey-Gal4 UAS-Dl (2nd) and UAS-DsRed::mir-7 (3rd) were selected under a fluorescence binocular (MZFLIII, Leica) for expression of DsRed in the eye under the control of Gal4. [score:3]
In the wing disc, the miR-7 microRNA is thought to silence target genes of the Notch pathway [47], [48]. [score:3]
Nevertheless, other miR-7 target genes may contribute to the cooperation with Dl-Notch pathway along with ihog, such as hairy and Tom. [score:3]
MicroRNA miR-7 Cooperates with Delta to Trigger Severe Overgrowth in Drosophila EyeTo identify endogenous genetic determinants that may limit Notch -driven tumourigenesis in vivo, we carried out an unbiased (genome-wide) gain-of -expression screen for loci that converted Dl -induced mild eye overgrowth into severe overgrowths (benign tumour-like growth: eye tissue is overgrown and folded) or metastatic tumours (provoke secondary eye growths throughout the body). [score:3]
We asked whether our identification of ihog as a key target of miR-7 during Dl -mediated tumorigenesis in the eye might reflect endogenous roles of the microRNA in other tissues. [score:3]
There is a single conserved miR-7 binding site in the 3′UTR of ihog (Figure 2D) and in Drosophila Schneider (S2) cells overexpressing mir-7, there was 45% less activity of a luciferase reporter containing the full-length ihog 3′ UTR downstream of the firefly luciferase coding region driven by the α-tubulin promoter (tub-luc::ihog-3′UTR Figure 2E and Figure S5C). [score:3]
The undifferentiated outgrowths are seen also in flies co -expressing Dl with the UAS-mir-7 transgene (B and C). [score:3]
Figure S4Overgrowth and abnormal neuronal differentiation progression in eye discs co -expressing Dl and the microRNA mir-7 or the ihog-IR or ci-IR transgenes. [score:3]
There was no increase in eye size when UAS-mir-7 alone was overexpressed by ey-Gal4 (ey>mir-7; Figure 1L). [score:3]
A set of EP elements in the vicinity of GS(2)518ND2 has been previously described to cause mir-7 overexpression, and to induce proximal fusion of longitudinal (L) veins 3 and 4, as well as distal wing notching or bristle tufting [45]– [47]. [score:3]
boi and ihog RNA was isolated from whole eye-antennal disc complexes; thus, the mRNA levels are the sum of all regions of the discs, including the antenna, which is not affected by ey>Dl or ey>mir-7. Hence expression differences with control may be significant underestimations of the actual differences of each gene in the eye disc parts in the different genotypes. [score:3]
Moreover, we confirmed that endogenous ihog is directly silenced by miR-7 and that this silencing involves direct binding of the microRNA to sequences in the 3′UTR of ihog both in vivo and in vitro. [score:3]
Loss of Hedgehog Signalling in miR-7 Overexpression in the Wing. [score:3]
A previously validated target of miR-7, hairy [48] was capable of converting Dl -induced mild overgrowth into tumour-like growth (Table S1). [score:3]
Therefore, we sought to identify miR-7 target gene(s) that might be relevant to the cooperation with Dl-Notch signalling in eye overgrowth and tumourigenesis. [score:3]
A boi transgene (UAS-boi) [56] fully suppressed the overgrowth induced by the combination of mir-7/Dl (Figure 3K, 100% penetrance, n = 100). [score:3]
As such, we systematically assayed a set of 39 D. melanogaster genes predicted to be miR-7 targets in silico (Table S1, [49]). [score:2]
While miR-7 can directly silence hairy in the wing, this effect has been shown to be very modest [48], and thus, we consider that while hairy may contribute to such effects, it is unlikely to be instrumental in this tumour mo del. [score:2]
1001554.g002 Figure 2Tumourigenesis promoted by miR-7 via direct repression of interference hedgehog (ihog). [score:2]
Overall, these data provide convincing evidence that miR-7 is capable of directly repressing ihog, both in vitro and in vivo. [score:2]
The assay would not, however, distinguish between a bona fide miR-7 target gene and those genes that are required normally for restricting tissue growth. [score:2]
Given the conservation of the Notch and Hh pathways, and the recurrent alteration of microRNAs in human cancers, we speculate that the genetic configuration of miR-7, Notch, and Hh is likely to participate in the development of certain human tumours. [score:2]
Thus, the relevance of co-regulation of ihog and ci by miR-7 in Hh receiving cells deserves further analysis given that the human counterparts of these genes (CDO, BOC, and Gli3) also contain binding sites for human miR-7. 10.1371/journal. [score:2]
Tumourigenesis promoted by miR-7 via direct repression of interference hedgehog (ihog). [score:2]
To construct the tub-luc::ihog [mut]3′UTR reporter, three nucleotides of the predicted binding site for miR-7 in the ihog 3′UTR were mutated (AGTCTTCCA to AGTC AT GC T) using the QuickChange Site-Directed Mutagenesis kit (Agilent Technologies Inc. [score:2]
Since the ihog gene encodes a receptor of Hh in the embryo, including the imaginal eye disc [30], we assessed whether it is directly regulated by miR-7 in luciferase reporter -based cellular assays in vitro and in vivo (Figure 2). [score:2]
Thus, the relevance of co-regulation of ihog and ci by miR-7 in Hh receiving cells deserves further analysis given that the human counterparts of these genes (CDO, BOC, and Gli3) also contain binding sites for human miR-7. 10.1371/journal. [score:2]
By contrast, when the ihog 3′UTR construct carried point mutations in the miR-7 binding site (tub-luc::ihog(mut)-3′UTR), luciferase activity was the same as in control cells (Figure 2E). [score:2]
To assess the levels of ihog or boi mRNA when the mir-7 or RNAi lines were activated by Gal4, we performed qRT-PCR experiments using RNA isolated from wandering third instar larvae of the hsp70-Gal4 genotype crossed with transgenic lines (UAS-mir-7, UAS-ihog-IR, or UAS-boi-IR) directly or following heat shock (an hour at 37°C followed by 6 h at 25°C). [score:2]
Here, we describe the identification of the conserved microRNA (miRNA) miR-7 as a gene that enhances Notch pathway -induced eye overgrowth in D. melanogaster. [score:1]
Increasing Hedgehog Signal Prevents Tumourigenesis by Delta and miR-7. Hedgehog Signal Transduction Also Attenuates Delta Signalling and Overgrowth in the Wing. [score:1]
To analyse mature mir-7 expression, we used mir-7-specific primers from the TaqMan MicroRNA Assays (Applied Biosystems), together with the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) and TaqMan Universal PCR Master Mix (Applied Biosystems). [score:1]
Thus, the synergism between miR-7 and the Dl-Notch pathway activity in eye overgrowth would appear to be largely due to the silencing of ihog. [score:1]
Given the conservation of miR-7, as well as of the Notch and Hedgehog pathways, the conclusions we have drawn from these studies on Drosophila may be applicable to some human cancers. [score:1]
C. Klambt (Munster University, Munster, Germany), and the other Drosophila stocks used here were: UAS-mir-7 and UAS-DsRed::mir-7 [47], UAS-boi [56], UAS-ci [57], and UAS-ci-75 [58], [59]. [score:1]
Plots of fluorescence intensity profiles of the anterior-posterior compartments from the WT (A) and ptc>DsRed::mir-7 (B′) discs are shown in (A′) and (B″), respectively. [score:1]
Plots of fluorescence intensity profiles from the wild-type and ptc>mir-7 discs are shown in Figure 6A′ and B″. [score:1]
We therefore investigated whether increasing Hh signal via a UAS-hh transgene to counterbalance ihog/boi deficit could rescue the overgrowth by Dl/ mir-7. Indeed, we detected significant reduction in eye size in flies ey>Dl>mir-7>hh (Figure 4K; 100% rescue, n>100; see Figure S9 for scheme of genetic test for rescuing experiment) and also in flies that expressed Ci full length (ey>Dl>mir-7>ci; Figure 4L). [score:1]
Confocal images of mitotic marker PH3 (blue in A–E; pink in F and green in G), neuronal marker Elav (green, A–F and red in G), and Wg (red, A–D and pink in F) staining of third instar eye-antennal imaginal discs of wild-type ey-Gal4 (ey>, A–A′), ey-Gal4 UAS-Dl (ey>Dl, B–B′), ey-Gal4 UAS-Dl/+; UAS-mir-7/+ (ey>Dl>mir-7, C–D′), ey-Gal4UAS-Dl/+; UAS-ihog-IR/+ (ey>Dl>ihog-IR, E–F), and ey-Gal4 UAS-Dl/+; UAS-ci-IR/+ (ey>Dl>ci-IR, G). [score:1]
In this experiment, we used the Beadex (Bx) -Gal4 driver, with the Bx domain labelled by DsRed because of the UAS-DsRed::mir-7 transgene (Figure 6G). [score:1]
We interpret these findings as Ci full length can be converted into the repressor form owing to the reduced Hh signalling caused by Dl and miR-7 depletion of ihog and boi. [score:1]
Indeed, the 3′UTR of both CDO and BOC like Drosophila ihog contains predicted binding sites for miR-7 (www. [score:1]
Figure S5Quantification of ihog and boi mRNAs and mature mir-7 levels. [score:1]
The mir-7 levels were normalized to U14 snRNA. [score:1]
Female virgin w; ey-Gal4 UAS-Dl/Cy0-GFP were crossed to males w; +/+; UAS-DsRed::mir-7 and their F1 progeny larvae (w; ey-Gal4, UAS-Dl/+; UAS-DsRed::mir-7/+) were selected by DsRed labelling in the pair of eye-antennal discs. [score:1]
By studying how Delta-Notch signalling drives tumorigenesis, we identified the conserved microRNA miR-7 as a co-operative element in tumorigenesis mediated by Delta. [score:1]
1001554.g001 Figure 1The Conserved MicroRNA miR-7 co-operates with Notch in D. melanogaster oncogenesis. [score:1]
Like the mir-7 and ihog-IR lines (Figure 1L and Figure 2C), none of the above RNAi lines were capable of inducing overgrowth by themselves. [score:1]
The Conserved MicroRNA miR-7 co-operates with Notch in D. melanogaster oncogenesis. [score:1]
All tissue samples were stored in RNAlaterTissueProtect Tubes (Qiagen) until used and mature mir-7, ihog, or boi mRNA levels were assessed by qRT-PCR. [score:1]
Figure S2The conserved MicroRNA miR-7 and Dl-Notch pathway cooperatively induce eye overgrowth. [score:1]
The GS(2)518ND2 line carried an insertion 3.1 kb upstream of the mir-7 miRNA gene (Figure 1F), which is transcribed from an internal promoter within a 3′ intron of the bancal/ heterogeneous nuclear ribonucleoprotein K (bl/hnRNP-K) gene [45]. [score:1]
MicroRNA miR-7 Cooperates with Delta to Trigger Severe Overgrowth in Drosophila Eye. [score:1]
In this sense, we describe here a conserved microRNA that cooperates with Notch -induced overproliferation and tumour-like overgrowth in the D. melanogaster eye, miR-7. Alterations in microRNAs have been implicated in the initiation or progression of human cancers (e. g., [80]– [84]), although such roles of microRNAs have rarely been demonstrated in vivo (e. g., [85]– [88]). [score:1]
miR-7 silencing of Hh signalling explains the L3–L4 fusion defects in the wing. [score:1]
Surprisingly, we could not overcome overgrowth by mir-7/Dl using this transgene (unpublished data). [score:1]
[1 to 20 of 107 sentences]
4
[+] score: 368
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b
Thus, our work showed for the first time that TTF-1-promoter-operating miR-7 expression might be an ideal strategy for targeted expression of miR-7 in lung cancer, which provides preliminary experimental basis for targeted expression of distinct miRNAs in lung cancer and was helpful for the development of gene therapy against clinical lung cancer. [score:12]
15, 49, 50 To reach a comprehensive knowledge on the molecular mechanism of the effect of TTF-1-operating miR-7 expression on the growth and metastasis of lung cancer cells, we used a global gene expression chip technique combined with biological information analysis to screen the potential target of miR-7. Unexpectedly, we found that TTF-1-operating miR-7 expression could significantly reduce the expression level of NDUFA4 in lung cancer cells in vitro and in vivo. [score:11]
Luckily, we found that this plasmid could effectively express miR-7 in human lung cancer cells with a higher expression level of TTF-1 in vitro, but not other human cancer cells with a lower expression level of TTF-1, including colon cancer, hepatocellular carcinoma, and gastric cancer, indicating that the TTF-1 promoter could effectively orchestrate targeted expression of miR-7 in lung cancer cells. [score:11]
To further elucidate the potential molecular mechanism through which TTF-1-promoter-operating miR-7 expression affected the growth of lung cancer cells, we used miRBase and TargetScan software to compare the downregulated genes in the p-T-miR-7 injection group and found 11 putative miR-7 target genes, including NXT2, C5orf22, PIGH, NDUFA4, TMEM97, CHAMP1, CNN3, LRRC8B, SAYSD1, TRMT13, and TPGS2 (Figure 4D), which also were closely related to tumor cell growth according to previous literatures. [score:10]
Of note, we found that overexpression of NDUFA4, a novel target molecule of miR-7, could abrogate the effect of TTF-1-promoter-operating miR-7 expression on the growth of lung cancer cells, accompanied with altered expression of phosphorylation of Akt and Erk. [score:9]
However, when we further analyzed the expression level of miR-7, it was found that, compared with their corresponding control, miR-7 level increased significantly in heart, spleen, lung, intestine, and lymph nodes, respectively (Figure S3), indicating that intrinsic transcriptional factors in these organs and tissues might bind to TTF-1 promoter and manipulate the expression of miR-7. It is the first time the potential value of the TTF-1 promoter operating distinct miRNAs expression in targeted gene therapy against lung cancer has been explored. [score:8]
In conclusion, for the first time, our study demonstrated that TTF-1-promoter-operating miR-7 expression could significantly inhibit the growth of human lung cancer in vitro and in vivo, closely related to downregulation of NDUFA4 and altered transduction of related signaling pathways including Akt and Erk. [score:8]
However, when we further analyzed the expression level of miR-7, it was found that, compared with their corresponding control, miR-7 level increased significantly in heart, spleen, lung, intestine, and lymph nodes, respectively (Figure S3), indicating that intrinsic transcriptional factors in these organs and tissues might bind to TTF-1 promoter and manipulate the expression of miR-7. To investigate whether the TTF-1 promoter might be an ideal candidate for operating miR-7 expression in lung cancer, as shown in Figure 1A, we first amplified and inserted the sequence of both TTF-1 promoter and miR-7 into pGL3.0 basic vector and successfully constructed an eukaryotic expression vector, which could express miR-7 operated by TTF-1 promoter (termed as p-T-miR-7) (Figure S1). [score:8]
Then, to further explore whether downregulation of NDUFA4 contributed to the suppressive effect of TTF-1-promoter-operating miR-7 expression on human lung cancer cells, we transiently co -transfected p-T-miR-7 and p-NDUFA4 into lung cancer cell line 95D cells and observed the possible change on cell growth and metastasis. [score:8]
Notably, we further revealed that the downregulation of NDUFA4, a novel target of miR-7, contributed to the effects of miR-7 expression operated by TTF-1 promoter on the growth and metastasis of human lung cancer cells, accompanied by altered transduction of related signaling pathway including the Akt and Erk pathway. [score:8]
Collectively, our data indicated that TTF-1-promoter-operating miR-7 expression could affect the growth of tumor cells, which might be closely due to the downregulation expression of NDUFA4. [score:8]
[17] Moreover, the reduced expression of miR-7 was associated with the sites mutation of its promoter region in lung cancer tissues, indicating that miR-7, an important tumor suppressor, could be used as candidate for targeted gene therapy against lung cancer. [score:8]
These data indicated that TTF-1-promoter-operating miR-7 expression might be an ideal strategy in lung cancer, which provided preliminary experimental basis for targeted expression of distinct miRNA in lung cancer and was helpful for the development of gene therapy against clinical lung cancer. [score:8]
Combining these data demonstrated that miR-7 could be effectively targeted expression by the TTF-1 promoter and suppressed the growth of human lung cells in vitro. [score:7]
Therefore, successive research work on both the potential effect of TTF-1-promoter-operating miR-7 expression on other types of cancers and regulatory factors including transcript factors in the activation of TTF-1 promoter, which did not been investigated in present study, is valuable for the verification of usage of the TTF-1 promoter in targeted gene expression in lung cancer and can ultimately benefit the development of a therapeutic strategy in clinical lung cancer. [score:7]
Unexpectedly, real-time PCR assay showed that only NDUFA4, one target among all predicted target genes of miR-7, was significantly downregulated more than five times both in tumor tissue in the p-T-miR-7 injection group (Figure 4E; p < 0.05) and in p-T-miR-7 -transfected tumor cells, respectively (Figure 4F; p < 0.05). [score:7]
Overexpression of NDUFA4 Abrogated the Suppressive Effect of TTF-1-Promoter-Operating miR-7 Expression. [score:7]
17, 30 In order to explore the underlying mechanism of TTF-1-promoter-operating miR-7 expression on the growth of lung cancer cells, we analyzed the global gene expression profile in tumor tissue between the p-T-miR-7 and the p-Cont injection group using gene expression microarray assay. [score:6]
Moreover, the metastatic index of lung also decreased significantly (Figure 2J; p < 0.05), indicating TTF-1-promoter-operating miR-7 expression also could significantly inhibit the metastasis of lung cancer cells in vivo, which was consistent with our previous report. [score:5]
Importantly, we further found that TTF-1-promoter-operating miR-7 expression could significantly not only inhibit the growth and metastasis of human lung cancer cells in vivo, but also induce the apoptosis of cancer cells in vivo. [score:5]
Importantly, overexpression of NDUFA4 could abrogate the effect of TTF-1-operating miR-7 expression on the growth and metastasis of lung cancer cells, accompanied by altered transduction of the Akt and Erk pathway, which was critical for the growth and metastatic potential of lung cancer cells. [score:5]
TTF-1-Promoter-Operating miR-7 Expression Suppressed the Growth of Human Lung Cells In Vitro. [score:5]
Importantly, we found that TTF-1-promoter-operating miR-7 expression could effectively inhibit the growth of lung cancer cells in vitro and in vivo. [score:5]
It is well known that miR-7, as an intrinsic tumor suppressor, has been found to be an important regulator in the development of various cancers including lung cancer. [score:5]
All of the above data demonstrated that TTF-1 promoter could effectively operate miR-7 expression in tumor mass, which subsequently inhibited tumorigenicity of lung cancer in vivo. [score:5]
Importantly, we analyzed the expression level of miR-7 in tumor tissue and found that the expression level of miR-7 in the p-T-miR-7 injection group was significantly higher than that in the p-Cont injection group (Figure 2G; p < 0.05). [score:5]
TTF-1-Promoter-Operating miR-7 Expression Reduced the Expression of NDUFA4. [score:5]
These data demonstrated that NUDFA4, a novel target of miR-7, contributed to the effects of TTF-1-operating miR-7 expression in lung cancer cells. [score:5]
For example, Xiong et al. [15] found that overexpression of miR-7 suppressed NSCLC cells proliferation and migration in vitro, and reduced tumorigenicity in vivo. [score:5]
[17] Thus, to further verify the effect of TTF-1-promoter-operating miR-7 expression on the growth of lung cancer cells, we analyzed the expression of phosphorylation of Akt and Erk in tumor tissue derived from the p-T-miR-7 injection group or the p-Cont injection group, respectively. [score:5]
Importantly, remote hypodermic injection, but not local injection, of plasmid p-T-miR-7 could significantly inhibit the growth and metastasis of human lung cancer cells in vivo, accompanied by altered expression of growth- and metastasis -associated molecules such as CDK and MMP family members. [score:5]
12, 13, 14 For lung cancer, accumulating evidence suggested that miR-7 was an important regulator in the development of lung cancer through controlling the growth and invasion, as well as apoptosis, of lung cancer cells and emerged as a novel potential therapeutic target. [score:5]
At the same time, Li et al. [16] showed that restoration of miR-7 expression suppressed the tumorigenicity of lung cancer cells in vivo. [score:5]
Finally, to confirm the effect of TTF-1-promoter-operating miR-7 expression on the growth and metastasis of tumor cells in vivo, we further detected the expression of cell-growth-related molecules including CDK2, CDK3, CDK4, and CDK6, as well as metastasis-related molecules including CXCR4, E-Cadherin, MMP2, MMP3, and MMP9, in tumor mass, respectively. [score:5]
Next, to observe the target efficiency, we further transfected the plasmid p-T-miR-7 into six different human cancer cell lines, including lung cancer cell line 95D cells, A549 cells, NCI-H292 cells, gastric cancer cell line SGC901 cells, hepatitic cancer cell line HepG2 cells, and colon cancer cell line SW620 cells, and then detected the expression level of miR-7 operated by TTF-1 promoter. [score:5]
1, 12, 13 Moreover, our previous research works also showed that overexpression of miR-7 could inhibit the growth of human lung cancer cells. [score:5]
To investigate whether the TTF-1 promoter might be an ideal candidate for operating miR-7 expression in lung cancer, as shown in Figure 1A, we first amplified and inserted the sequence of both TTF-1 promoter and miR-7 into pGL3.0 basic vector and successfully constructed an eukaryotic expression vector, which could express miR-7 operated by TTF-1 promoter (termed as p-T-miR-7) (Figure S1). [score:5]
TTF-1-Promoter-Operating miR-7 Expression Inhibited Tumorigenicity In Vivo. [score:5]
24, 25, 26 Accumulating literatures have documented that miR-7, as a promising tumor suppressor, could regulate the biological behavior of human lung cancer cells. [score:4]
Real-time PCR assay showed that the expression level of the miR-7 in p-T-miR-7 transfection group was unmistakably higher than that in the control group (Figure 1B; p < 0.05), indicating TTF-1 promoter could effectively operate the expression of miR-7 in lung cancer cells. [score:4]
[18] Interestingly, some research works showed that in situ local injection of miR-7 overexpression plasmids could regulate the growth and metastatic potential of human lung cancer cells in vivo via the Akt pathway. [score:4]
And our recent work reported that the site mutation of miR-7 promoter region contributed to its altered expression in clinical lung cancer tissue. [score:4]
24, 25, 26Accumulating literatures have documented that miR-7, as a promising tumor suppressor, could regulate the biological behavior of human lung cancer cells. [score:4]
Therefore, combining these research works may highlight the fact that miR-7 is a critical regulator and might be an ideal target for gene therapy against clinical lung cancer, which would be helpful for the outcome of clinical treatment. [score:4]
Data showed that there were not any changes on the expression level of both Akt and Erk in between the p-T-miR-7 injection group and the p-Cont injection group. [score:3]
In order to test the efficiency of TTF-1-promoter-operating miR-7 expression, we then transiently transfected plasmid p-T-miR-7 into human lung cancer cell line 95D cells. [score:3]
Finally, we also analyzed the expression of phosphor-Akt and phosphor-Erk in the p-T-miR-7 and p-NDUFA4 co-transfection groups. [score:3]
43, 44 In the present study, we further extended previous findings to report that expression of miR-7, operated by TTF-1 promoter, could reduce the growth and metastasis of human lung cancer cells in vitro. [score:3]
Thereby, further studies on the dynamic distribution of the plasmid and the possible change on other organs are important for the evaluation of safety of the plasmid in vivo, which is critical for the potential application of gene therapy based on targeted miR-7 expression in lung cancer. [score:3]
However, the expression level of phosphor-Akt and phosphor-Erk were decreased significantly in the p-T-miR-7 injection group (Figures 3A and 3B; p < 0.05). [score:3]
We first observed that TTF-1 promoter could effectively operate miR-7 expression in lung cancer cells. [score:3]
27, 28, 29 Our previous work also showed that miR-7 could inhibit the proliferation and metastasis of lung cancer cells though the Akt pathway. [score:3]
13, 39, 40, 41 For example, Xiong et al. [42] documented that miR-7 could inhibit the growth of human lung cancer cells in vivo. [score:3]
To confirm these data, we further detected the expression of miR-7 in tumor mass by in situ hybridization and obtained a similar result (Figure 2H). [score:3]
TTF-1-Promoter-Operating miR-7 Expression Altered the Transduction of the Akt/Erk Pathway. [score:3]
Therefore, in this present study, we first constructed an eukaryotic vector of promoter of TTF-1-gene-operating expression of miR-7 (termed as p-T-miR-7) and observed its effects on the growth and migration of human lung cancer cells in vitro. [score:3]
Next, we further monitored the impact of TTF-1-promoter-operating miR-7 expression on lung cancer cells in vivo. [score:3]
Data showed that the expression of all of these molecules in the p-T-miR-7 injection group decreased unmistakably (Figure 2l; p < 0.05). [score:3]
The altered gene expression profiles in p-T-miR-7 were shown in a heatmap (Figures 4A and 4B). [score:3]
Interestingly, we found that the expression level of miR-7 was higher in lung cancer cells, including 95D cells, A549 cells, and NCI-H292 cells, than in other types of tumor cells (Figure 1C; p < 0.05), indicating higher intrinsic activity of TTF-1 promoter in lung cancer cells. [score:3]
To further explore the potential therapeutic effect of TTF-1-promoter-operating miR-7 expression on tumorigenicity in vivo, a xenograft mo del of human lung cancer in nude mice was adopted. [score:3]
Combining these results demonstrated that TTF-1-promoter-operating miR-7 expression affected the growth and metastasis of human lung cancer cells through NDUFA4. [score:3]
Finally, we observed that there were not any significantly change in various important organs or tissues, indicating the safety value of strategy of TTF-1-promoter-operating expression of miR-7 in vivo. [score:3]
Consistently, our previous work also showed that overexpression of miR-7 could reduce the growth and metastasis of human lung cancer cells in vivo and in vitro. [score:3]
These results suggested that TTF-1-promoter-operating miR-7 expression attenuated the growth of human lung cells in vitro and in vivo by altering the transduction of the Akt/Erk pathway, which was consistent with our previous findings. [score:3]
The plasmid p-T-miR-7 or p-Cont (100 mg) was given locally by direct injection into the left flank of nude mice five times every 3 days. [score:2]
As shown in Figure 1F, the relative expression of these CDK family members also decreased significantly in the p-T-miR-7 -transfected group compared with those in the control group (p < 0.05). [score:2]
Accumulating evidence showed that the molecular mechanism through which miR-7 regulated the growth and metastasis of lung cancer cells was complex, and various genes including PA28 gamma, KLF4, BCL-2, and so on also were reportedly involved in the biological function of miR-7 in lung cancer. [score:2]
To confirm these findings, we also transiently transfected p-T-miR-7 or p-Cont into lung cancer cell line 95D cells in vitro, respectively, and found the expression level of both phosphor-Akt and phosphor-Erk were decreased significantly in the p-T-miR-7 -transfected group compared with those in the p-Cont -transfected group (Figures 3C and 3D; p < 0.05). [score:2]
An increasing body of literatures documented that miR-7 could regulate the growth of lung cancer cells though various signal pathways such as the Akt and Erk pathway. [score:2]
Moreover, we further evaluated the potential effect of the TTF-1-promoter-operating miR-7 expression on the growth and metastasis of human lung cancer cells in vivo. [score:1]
[54] Different from these research works, we analyzed the distribution of plasmid p-T-miR-7 after remote hypodermic injection and found that the plasmid was dominantly enriched in lung tissue and tumor mass in vivo. [score:1]
As shown in Figures 6A and 6B, the proliferation of 95D cells decreased significantly in the p-T-miR-7 transfection group, which was consistent with our above data. [score:1]
20, 21, 22 Therefore, in the present study, we attempted to design and construct an eukaryotic vector encoding miR-7, which was manipulated by the TTF-1 promoter. [score:1]
miR-7 TTF-1 95D cells lung cancer growth NDUFA4 Lung cancer is one of the most common causes of cancer death. [score:1]
After blocking with normal goat serum (1:100), sections were next incubated or microwave heating and then incubated with hybridization cocktail containing miR-7 probe (1:1,000 dilution; EXIQON; no. [score:1]
Notably, we found that the proliferation of cells in the p-T-miR-7 and p-NDUFA4 co-transfection group elevated unmistakably (p < 0.05). [score:1]
Finally, we preliminarily estimated the distribution of plasmid p-T-miR-7 in vivo. [score:1]
7 days later, the plasmid of p-T-miR-7 or p-Cont was remotely given by subcutaneous injection into the left flank of nude mice five times every 3 days (Figures 2A and 2B). [score:1]
As shown in Figure 1D, the proliferation of human lung cancer cell line 95D cells decreased significantly in the p-T-miR-7 -transfected group (p < 0.05). [score:1]
Further analysis showed that miR-7 could bind to the 3′ UTR region of NDUFA4 mRNA (Figure 4G). [score:1]
It was noticed that none of these biochemistry indicators changed significantly (Figure 7C; p > 0.05), indicating that there were not any changes on biological function of important organs and tissues in the p-T-miR-7 injection group. [score:1]
17, 18 Therefore, we further investigated whether expression of miR-7 operated by TTF-1 promoter could affect the growth of human lung cancer cells in vitro. [score:1]
95D cells were seeded in 96-well plates at 1 × 10 [4]/well with triplicate and transiently transfected with p-T-miR-7 plasmid (2 μg), p-NDUFA4 plasmid (10 μg), or p-Cont plasmid (2 μg/10 μg). [score:1]
MicroRNA-7 (miR-7), a unique member of miRNAs, played an important role in the progression of various tumors including lung cancer. [score:1]
As shown in Figure S2, the copies of the p-T-miR-7 plasmid was higher in lung tissue and tumor tissue (p < 0.05), but not in the other organs and tissues, indicating the plasmid was mainly distributed in the lung tissue and tumor tissue in vivo. [score:1]
As shown in Figure 7A, there were no significant changes in the morphology of six important organs and tissues, including heart, liver, spleen, kidney, brain, and lymph nodes, between the p-T-miR-7 injection group and the control group (p > 0.05). [score:1]
95D cells were transiently transfected with p-T-miR-7 plasmid (2 μg), p-NDUFA4 plasmid (10 μg), or p-Cont plasmid (2 μg/10 μg), as described above. [score:1]
As shown in Figure 2H, H&E staining showed that there were large areas of necrosis in tumor tissue in the p-T-miR-7 injection group. [score:1]
Human lung cancer 95D cells were transiently transfected with p-T-miR-7 plasmid (2 μg), p-NDUFA4 plasmid (10 μg), or p-Cont plasmid (2 μg/10 μg) or scramble control as described above. [score:1]
[1 to 20 of 90 sentences]
5
[+] score: 296
As FAK is frequently up-regulated in breast cancer and promotes cell migration and invasion, and as miR-7 can directly regulate the expression of FAK, we next ascertained whether reduction of FAK expression might provide an explanation for the reduction of cell migration and invasion observed following forced expression of miR-7. We therefore forced the expression of miR-7 in MDA-MB-435s and MDA-MB-231 cells together with a construct containing the FAK coding sequence but lacking the 3′UTR of the FAK-encoding mRNA; and as such, this construct yielded a FAK mRNA that is resistant to miR-7. The restoration of FAK expression was confirmed through immunoblot analysis (Fig. 4C). [score:16]
FAK is a Direct Target of miR-7. miR-7 decreases FAK expression by directly targeting its 3′-UTR. [score:9]
These results indicate that miR-7 expression is inversely correlated with FAK expression and activation in breast cancer cell lines and that miR-7 directly regulates FAK expression. [score:9]
To identify downstream targets of miR-7, we performed bioinformatics analysis by use of three algorithms that predict the mRNA targets of a particular miRNA – PicTar [16], TargetScan [17], and miRanda [18]. [score:7]
In that report, miR-7 levels in glioma tissues are inverse correlated with FAK expression when combined with work herein in breast cancer, it appears that miR-7 is a conserved miRNA that inhibits the same target gene and plays similar functions in several tumor types. [score:7]
We subsequently utilized HBL-100 cells, which possess high relative expression of miR-7 to further determine the functional effects of inhibition of miR-7. Transfection of miR-7 inhibitor increased cell proliferation in HBL-100 cells (Fig. 5A). [score:7]
miR-7 Decreases Tumor Growth and Suppresses Metastasis in vivo To determine whether miR-7 regulates tumor growth and metastasis in vivo, we utilized xenograft mo dels by injection of MDA-MB-435s cells, with forced expression of miR-7, orthotopically in the mammary fat pad of nude mice. [score:6]
While we were preparing the manuscript, it was reported that miR-7 regulated cancer cell invasion by targeting FAK expression in glioblastoma [52]. [score:6]
The T47D cell line is a moderately invasive cell line but has a relatively low miR-7 and high FAK expression, suggestive of alternate pathways to regulate miR-7 and FAK expression in this cell line. [score:6]
Furthermore, forced expression of miR-7 increased expression of E-CADHERIN in both cell lines whereas the control transfected cells remained E-CADHERIN negative (Fig. 3B). [score:5]
miR-7 expressing cells produced circumscribed colonies, whereas a large number of control transfected cells spread from the main bulk of the colony (Fig. 5D), suggesting that miR-7 inhibited invasive cellular behavior. [score:5]
To assess the relationship between the endogenous levels of FAK and miR-7, we next determined miR-7 expression and FAK protein expression in a variety of breast cancer cell lines. [score:5]
The relative expression of FAK, FIBRONECTIN and VIMENTIN between miR-7 expressing tumors and control tumors were also analyzed by quantifying DAB staining intensity (Fig. S2E). [score:5]
We also analyzed the expression of miR-7 versus the expression of VIMENTIN mRNA in this cohort. [score:5]
To determine if the molecular changes typical of a reduced EMT occurred in miR-7 expressing cells, we examined the expression of mesenchymal markers, such as FIBRONECTIN, VIMENTIN, N-CADHERIN, SNAIL and the epithelial marker E-CADHERIN in MDA-MB-435s and MDA-MB-231 cells. [score:5]
analysis showed that expression of both FIBRONECTIN, VIMENTIN and SNAIL were decreased in MDA-MB-435s and MDA-MB-231 cells with forced expression of miR-7 (Fig. 3B). [score:5]
Transwell assays indicated that restoration of FAK expression significantly abrogated miR-7 reduced cell migration and invasiveness (Fig. 4B), indicative that FAK is both a direct and functional target for miR-7. 10.1371/journal. [score:5]
Furthermore, after transfection of miR-7 inhibitor in HBL-100 cell, the expression of FAK and the levels of phospho-FAK (Tyr [397]) were dramatically increased (Fig. 2E and Fig. S2C). [score:5]
Transwell assays indicated that restoration of FAK expression significantly abrogated miR-7 reduced cell migration and invasiveness (Fig. 4B), indicative that FAK is both a direct and functional target for miR-7. 10.1371/journal. [score:5]
In addition, immunoblot analyses indicated that forced expression of miR-7 significantly reduced endogenous FAK protein expression in both MDA-MB-435s and MDA-MB-231 cells (Fig. 2E, Fig. S2A and S2B). [score:5]
The protein level of N-CADHERIN was also decreased in MDA-MB-435s cells with forced expression of miR-7. N-CADHERIN protein expression was not detectable by immunoblot analysis in MDA-MB-231 cells (Fig. 3B). [score:5]
The tumor xenografts derived from cells with forced expression of miR-7 exhibited lower expression of FAK, FIBRONECTIN and VIMENTIN than control tumors (Fig. 6C). [score:5]
To determine whether the expression of E-CADHERIN correlated to miR-7 levels in breast cancer, we quantified miR-7 as well as E-CADHERIN mRNA expression in a cohort of breast cancer samples. [score:5]
miR-7 is Down-regulated in Cancer Versus Normal Breast and Inversely Correlated with Metastasis. [score:4]
To determine whether miR-7 regulates tumor growth and metastasis in vivo, we utilized xenograft mo dels by injection of MDA-MB-435s cells, with forced expression of miR-7, orthotopically in the mammary fat pad of nude mice. [score:4]
Furthermore, miR-7 was reported to be down-regulated in glioblastoma and advanced TSCC [11], [14]. [score:4]
Figure S1 miR-7 target genes that predicted by all theree algorithms. [score:3]
To determine whether miR-7 is associated with breast cancer metastasis, we further examined the miR-7 expression levels in 42 archived primary breast tumors. [score:3]
The molecular mechanisms responsible for the increased FAK expression in breast cancer remain largely unknown but miR-7 may represent one mechanism. [score:3]
miR-7 has also been reported to target PAK1 in breast cancer cells [13]. [score:3]
Restoration of FAK attenuates miR-7 mediated cell migration and invasion inhibition. [score:3]
Control primary tumors displayed evidence of local invasion (Fig. 6B); however, tumors with forced expression of miR-7 were well encapsulated and non-invasive (Fig. 6B). [score:3]
miR-7 was also observed to reduce the expression of several oncogenes including PAK1 (p21 activated kinase 1) [13] and IGF-1R (insulin-like growth factor 1 receptor) in breast cancer and tongue squamous cell carcinoma (TSCC) cell lines respectively [14]. [score:3]
used were as follows: FAK ORF (GCGCGGCTAGCATGGCAGCTGCTTACCTTGACCCCA, ATAGCGGCCGCTCAGTGTGGTCTCGTCTGCCCAAGC); miR-7 ectopic expression (AGGATCCTACAGGAACACAGGACCAGA, CCGAATTCTGATAAACACGTCCATTACA), FAK 3′UTR cloning (ATCTCGAGGCCTCCCCTAGGAGCACGTCTT, GCGCGGCCGCTTTACTGGTAACACCTTTTTAAT), E-CADHERIN, VIMENTIN and GAPDH quantitative PCR: E-CADHERIN (CTGAGAACGAGGCTAACGTC, TGTCCACCATCATCATTCAATA); VIMENTIN (AGACAGGCTTTAGCGAGTTATT, GGGCTCCTAGCGGTTTAG); GAPDH (TGCACCACCAACTGCTTAGC, GGCATGGACTGTGGTCATGAG). [score:3]
Cells with forced expression of miR-7 produced no metastatic lesions in contrast to control cells that formed lesions in the lungs in 2 of 6 mice with tumors orthotopically implanted (Fig. 6B). [score:3]
This data suggested a strong association between miR-7 expression and markers of epithelial differentiation. [score:3]
Analysis of miR-7 as well as E-CADHERIN and VIMENTIN mRNA levels in breast cancer tissues reveals that miR-7 expression is an indicator of epithelial differentiation in breast cancer. [score:3]
Therefore, there is a need to further delineate the expression and function of miR-7 in breast cancer systematically. [score:3]
The expression level of mature miR-7 is normalized to U6 small nuclear RNA. [score:3]
After 30 days, MDA-MB-435s cells with forced expression of miR-7 generated fewer lung metastases than did control (Fig. 7A and B). [score:3]
qPCR analysis revealed that patients who experienced metastasic relapse exhibited a markedly lower miR-7 expression than in those without (p<0.001, Fig. 1B). [score:3]
miR-7 inhibits breast cancer cell tumorigenesis in vitro. [score:3]
miR-7 inhibits breast cancer cell metastasis to mice lungs. [score:3]
miR-7 inhibits breast cancer cell growth, local invasion in vivo. [score:3]
miR-7 Inhibits Breast Cancer Cell Growth in vitro. [score:3]
These results suggest that miR-7 may play an important role in breast cancer progression and that decreased expression of miR-7 is associated with breast cancer metastasis. [score:3]
Strikingly, a significant number of miR-7 expressing carcinoma cells exhibited staining for human E-CADHERIN (Fig. 6C). [score:3]
These results indicated that miR-7 inhibits breast cancer cells monolayer proliferation and anchorage independent growth in vitro. [score:3]
0041523.g001 Figure 1 (A) The expression level of mature miR-7 in breast cancer (n = 42) or normal breast tissues (n = 27) was determined using quantitative PCR. [score:3]
In an effort to determine whether FAK is regulated by miR-7 through direct binding to its 3′UTR, a series of 3′UTR fragments including the full-length wild type 3′UTR, binding site 1 mutant and binding site 2 mutant (Fig. 2B) were constructed and inserted into the psiCHECK2 luciferase reporter plasmid. [score:3]
Not only did cells with forced expression of miR-7 generate smaller primary tumors, but miR-7 also strikingly impaired in their capacity to seed lung metastasis. [score:3]
Interestingly, Martens et al. (2008) found that miR-7 and other three miRNAs were significantly associated with aggressiveness of estrogen receptor positive (ER [+]) primary breast tumors of patients with lymph node -negative (LNN) disease [15], suggesting that miR-7 may be an oncomiR. [score:3]
We noticed that forced expression of miR-7 promoted striking change in the morphology of MDA-MB-435s and MDA-MB-231 cells, whereby the spindle-, fibroblast-like morphology switched to the cobblestone-like appearance of epithelial cells (Fig. 3A). [score:3]
Levels of phosphorylated FAK (Tyr [397]), which is a critical event in integrin mediated FAK signaling [21] was also decreased by forced expression of miR-7 (Fig. 2E, S2A and S2B). [score:3]
miR-7 expression is decreased in breast cancer and is associated with tumor metastasis. [score:3]
From the cohort of 42 primary breast cancer, we observed a significant positive correlation between E-CADHERIN mRNA and miR-7 miRNA expression (Fig. 3D). [score:3]
In an attempt to understand the role of miR-7 during breast cancer progression, we first determined the expression of miR-7 in 27 fresh specimens of normal breast tissues and 42 cases of breast cancer using quantitative reverse-transcription PCR. [score:3]
Recently, miR-7 has been found to reduce EGFR (epidermal growth factor receptor) expression in glioblastoma, breast and prostate cancer cells [11], [12]. [score:3]
miR-7 Decreases Tumor Growth and Suppresses Metastasis in vivo. [score:3]
We observed a significant inverse correlation between miR-7 miRNA and VIMENTIN mRNA expression in patient tumors (Fig. 3E). [score:3]
Thus, we injected MDA-MB-435s cells with forced expression of miR-7 into the venous circulation of mice. [score:3]
miR-7 Inhibits Breast Cancer Cell Growth in vitro To determine the function of miR-7 in the progression of breast cancer, we sought to determine whether miR-7 may also affect the proliferation of breast cancer cells. [score:3]
miR-7 may therefore co-ordinately regulate breast cancer cells EMT. [score:2]
Forced expression of miR-7 decreased primary tumor growth by 1.5-fold and correspondingly decreased cell proliferation as determined by immunohistochemical analysis of nuclear incorporation of BrdU (Fig. 6A and D) and increased cell apoptosis as determined by TUNEL assay (Fig. 6 D). [score:2]
We observed that miR-7 expression was significantly decreased in breast cancer tissue compared with normal breast tissue (p<0.001, Fig. 1A). [score:2]
Given that the expression of miR-7 was inversely correlated with metastasis of breast cancer, we considered whether miR-7 might possess an important role in breast cancer cell migration and invasion. [score:2]
miR-7 Impairs Breast Cancer Cell Migration and Invasion in vitro Given that the expression of miR-7 was inversely correlated with metastasis of breast cancer, we considered whether miR-7 might possess an important role in breast cancer cell migration and invasion. [score:2]
Primers used were as follows: FAK ORF (GCGCGGCTAGCATGGCAGCTGCTTACCTTGACCCCA, ATAGCGGCCGCTCAGTGTGGTCTCGTCTGCCCAAGC); miR-7 ectopic expression (AGGATCCTACAGGAACACAGGACCAGA, CCGAATTCTGATAAACACGTCCATTACA), FAK 3′UTR cloning (ATCTCGAGGCCTCCCCTAGGAGCACGTCTT, GCGCGGCCGCTTTACTGGTAACACCTTTTTAAT), E-CADHERIN, VIMENTIN and GAPDH quantitative PCR: E-CADHERIN (CTGAGAACGAGGCTAACGTC, TGTCCACCATCATCATTCAATA); VIMENTIN (AGACAGGCTTTAGCGAGTTATT, GGGCTCCTAGCGGTTTAG); GAPDH (TGCACCACCAACTGCTTAGC, GGCATGGACTGTGGTCATGAG). [score:2]
miR-7 Determines Epithelial Phenotype of Breast Cancer Cells. [score:1]
miR-7 Impairs Breast Cancer Cell Migration and Invasion in vitro. [score:1]
miR-7 promotes an epithelial phenotype in breast cancer cells. [score:1]
Conversely, silencing of miR-7 in HBL-100 cells increased colony formation in soft agar (Fig. 5C). [score:1]
This suggested that miR-7 interacts with the FAK mRNA 3′UTR through binding with the site 1 position because the activity of the luciferase reporter that carries a binding site 1 mutant FAK 3′UTR with substitution of four nucleotides within the miR-7 binding site was not reduced by miR-7 (Fig. 2C). [score:1]
We also determined the effect of miR-7 on metastasis was also attributable to effects on later steps of the invasion-metastasis cascade, independent of miR-7 influence on cellular invasion. [score:1]
Our data reveals that miR-7 inhibits EMT which promotes the conversion of highly invasive breast cancer cells with mesenchymal characteristic to the cells with epithelial properties. [score:1]
In the present study, we located two potential binding sites (site 1 and site 2) of miR-7 in the FAK 3′UTR with RNAhybrid (Fig. 2A). [score:1]
In contrast, miR-7 levels were relatively high in HBL-100, MDA-MB-468, MDA-MB-453 and MCF-7 cells and much lower in MDA-MB-435s, MDA-MB-231 and BT-549 cells (Fig. 2D). [score:1]
The wild type and mutant vectors were co -transfected with mature miR-7 and control miRNA in MDA-MB-435s cells. [score:1]
Using RNAhybrid [20], we located two potential binding sites for miR-7 at the 3′UTR of FAK mRNA. [score:1]
To determine the function of miR-7 in the progression of breast cancer, we sought to determine whether miR-7 may also affect the proliferation of breast cancer cells. [score:1]
The human miR-7 gene was PCR-amplified from normal genomic DNA and cloned into the pBabe-puro retroviral vector. [score:1]
0041523.g007 Figure 7 (A) H&E stained sections of lungs isolated from mice that received tail vein injection of miR-7 or control infected MDA-MB-435s cells (scale bar: 100 µm). [score:1]
The altered cell morphology produced by forced expression of miR-7 was also quantified by measuring dendricity/inverse shape factor (Fig. S2D). [score:1]
Cells were grown to approximately 60% confluence in 24-well plates and cotransfected with psiCHECK2-FAK-3′-UTR (wild type or mutant) or psiCHECK2 empty vector plus miR-7 mimics or control mimics using Lipofectamine 2000 (Invitrogen). [score:1]
0041523.g002 Figure 2 (A) The potential binding sequences for miR-7 within the FAK 3′-UTR of human (H. s), chimpanzee (P. t), mouse (M. m), guinea pig (C. p), rabbit (O. c), rat (R. n), and dog (C. f). [score:1]
Quantification of human HPRT mRNA also demonstrated that miR-7 decreased the number of metastatic cancer cells in the mouse lungs (Fig. 7C). [score:1]
The sequences of two predicted miR-7 binding sites within the FAK 3′-UTR, including wild-type full-length UTR or mutant (highlighted and underlined) binding site are shown. [score:1]
miR-7 significantly decreased the luciferase activity of wild type and binding site 2 mutant FAK 3′UTR (more than 50%) but not binding site 1 mutant FAK 3′UTR. [score:1]
0041523.g003 Figure 3 (A) Morphology of MDA-MB-435s and MDA-MB-231 cells transiently transfected with mature miR-7 or the control miRNA. [score:1]
[1 to 20 of 89 sentences]
6
[+] score: 279
Overlay of the miR-7 predicted target genes with down-regulated genes with a functional annotation in neovascularization led to selection of OGT as putative novel target of miR-7. OGT is an enzyme that is involved in the hexosamine biosynthetic pathway which adds an O-GlcNAc moiety to the free hydroxyl group of select serine and threonine residues on a diverse population of nuclear and cytosolic proteins [35, 36]. [score:8]
Both siRNA against OGT and Alloxan did not inhibit EC migration or EC tube formation in vitro, suggesting that OGT is a good marker gene of miR-7, but not the prime miR-7 target through which EC cell migration and tube formation are inhibited (Supplementary Fig. S3 and S4). [score:7]
The majority, 1317, of the miR-7 modulated genes were down-regulated while 1183 were upregulated. [score:7]
These data suggest that inhibition of angiogenesis is the prime mechanism for the N2A tumor growth suppression upon intratumoral delivery of miR-7. The lack of efficacy on tumor cell proliferation in vivo is corroborated by the observation that miR-7 did not inhibit cell viability of N2A cells in vitro (Supplementary Fig. S5). [score:7]
Furthermore, not only tumor vessel density was reduced, expression of the nuclear proliferation marker Ki-67 and expression of the newly identified miR-7 target gene OGT were also affected by miR-7 treatment in vivo. [score:7]
Differentially expressed genes that are regulated by miR-7 and are a predicted target genes of miR-7 are plotted. [score:6]
Similar to EC, downregulation of OGT in U-87 MG cells by RNAi interference did not inhibit cell viability (Supplementary Fig. S9), indicating that also in tumor cells OGT is a good marker for miR-7 delivery but not for miR-7 efficacy. [score:6]
First, the set of regulated genes was overlaid with the 1051 predicted miR-7 targets, based on the TargetScan prediction tool in IPA. [score:6]
It is noted that other miR-7 targets, such as EGFR and PI3K were not down-regulated in miR-7 treated EC based on the RNA-seq analysis (Supplementary Table S7), suggesting that the anti-proliferative activity of miR-7 occurs through other pathways in EC than in tumor cells. [score:6]
In total 282 predicted miR-7 targets were up- or downregulated within the set of 2500 genes (Fig. 2b). [score:6]
Here we show for the first time that OGT is a target of miR-7, suggesting that the anti-angiogenic effect of miR-7 in EC can, at least partly, be mediated by downregulation of OGT. [score:6]
Anti-angiogenic activity of miR-7 mimic in vivo– systemic tumor neovasculature targetingClinical application of miRNA -based therapeutics is dependent on systemic administration and intracellular delivery of the miRNA (mimic) to the target site. [score:5]
Investigation of gene expression levels of known miR-7 target shows that EGFR and PI3K and most of the other known miR-7 targets are not affected in HUVEC after miR-7 transfection (Supplementary Fig S10). [score:5]
Eight out of 11 genes that are associated to novel anti-angiogenic drugs are down regulated Genes highly involved in tumor angiogenesis Expression ratio after miR-7 treatment versus control (log2(ratio)) Example of drug in clinical trial VEGF-B 1.443 Aflibercept (Regeneron) VEGF-C −0.778 VGX-100 (Circadian) Angiopoeitin-2 −0.805 PF-04856884 (Pfizer) PDGF-D 0.899 CR-002 (CuraGen) Jagged-1 −0.739 RO4929097 (Roche) ADAM-10 −0.870 INCB3619 (InCyte) FGF-2 −1.732 Gal-F2 (Galaxy/Roche) CXCR4 1.169 BMS-936564 (Bristoll Myers Squibb) S1PR1 −1.108 Fingolimod (Novartis) S1PR3 −1.035 Fingolimod (Novartis) NRP1 −0.801 MNRP1685A (Genentech) antibodyIPA was also used to identify biological processes that are regulated by miR-7 (Supplementary Table S3). [score:5]
Differential expression analysis showed that 2500 genes were significantly up- or downregulated after transfection of HUVEC with miR-7 mimic (p-value < 0.05, compared to miR-Scr, Fig. 2a). [score:5]
However, inhibition of OGT in EC does not inhibit EC tube formation or migration, which indicates that OGT is a suitable biomarker for miR-7 activity, but does not explain the anti-angiogenic activity of miR-7 in EC. [score:5]
The dual targeting of the cRGD-coated nanoparticles to both endothelial as well as cancer cells provides potential for high therapeutic efficacy of miR-7. Together with the well-known role of miR-7 as regulator of invasion and migration in cancer, the novel anti-angiogenic property of miR-7 and its regulation of diverse genes involved in angiogenesis strengthen its potential value as therapeutic agent for the treatment of cancer Human Umbilical Vein Endothelial Cells (HUVEC) (Lonza) were cultured in EBM-2 medium (Lonza) supplemented with bullet kit (EGM-2, Lonza) containing several growth factors and 10% Fetal Calf Serum (FCS) (Sigma). [score:5]
Eight out of 11 genes that are associated to novel anti-angiogenic drugs are down regulated Genes highly involved in tumor angiogenesis Expression ratio after miR-7 treatment versus control (log2(ratio)) Example of drug in clinical trial VEGF-B 1.443 Aflibercept (Regeneron) VEGF-C −0.778 VGX-100 (Circadian) Angiopoeitin-2 −0.805 PF-04856884 (Pfizer) PDGF-D 0.899 CR-002 (CuraGen) Jagged-1 −0.739 RO4929097 (Roche) ADAM-10 −0.870 INCB3619 (InCyte) FGF-2 −1.732 Gal-F2 (Galaxy/Roche) CXCR4 1.169 BMS-936564 (Bristoll Myers Squibb) S1PR1 −1.108 Fingolimod (Novartis) S1PR3 −1.035 Fingolimod (Novartis) NRP1 −0.801 MNRP1685A (Genentech) antibody IPA was also used to identify biological processes that are regulated by miR-7 (Supplementary Table S3). [score:5]
The results demonstrate that targeted systemic delivery of miR-7 inhibited tumor angiogenesis and growth. [score:5]
miR-7 mediated differential expression of genes that are currently clinically explored as anti-angiogenic drug targets. [score:5]
After transfection of HUVEC with miR-7 mimic cell proliferation was inhibited in a concentration dependent manner, up to 50% inhibition compared to a negative control miRNA with a scrambled sequence (miR-Scr). [score:4]
Indirect evidence for systemic delivery of miR-7 to the tumor tissue was provided by the observation that mice treated with the miR-7 mimic -loaded, integrin -targeted nanoparticles had smaller, pale and less vascularized tumors than control mice. [score:4]
Not only did miR-7 inhibit growth factor induced angiogenesis in vitro but miR-7 also impaired developmental angiogenesis in chicken embryo CAM with potency comparable to sunitinib. [score:4]
MiR-7 not only inhibited EC proliferation by 50%, but also inhibited migration of EC by nearly 70%. [score:4]
Downregulation of OGT by miR-7 is not EC specific, but was also confirmed in U-87 MG cells in vitro (Supplementary Fig. S8). [score:4]
In earlier studies, miR-7 was not picked up as miRNA involved in angiogenesis in an EC specific differential expression screen (13), which may suggest that miR-7 has no physiological role in EC to regulate angiogenesis. [score:4]
The observed downregulation of OGT in miR-7 transfected HUVEC was confirmed by RT-PCR and Western Blot analysis over a concentration range of 15-100 nM (Fig. 2c and d). [score:4]
Overlay of strongly down-regulated angiogenesis -associated genes (log2 ratio (miR-7 vs. [score:4]
Figure 4(a) miR-7 inhibits tumor growth after local delivery. [score:3]
miR-Scr), p-value <0.05) with predicted miR-7 targets (Supplementary Table S4) pointed to O-linked β-N-acetylglucosamine transferase (OGT) as potentially important mediator of miR-7 action. [score:3]
Together, these studies demonstrate strong anti-angiogenic activity of miR-7 upon overexpression in EC. [score:3]
U-87 MG tumor bearing mice were treated with miR-7 mimic using a cyclic Arginine-Glycine-Aspartic acid (cRGD) peptide coupled biodegradable polyamide nanoparticles, targeting integrins αvβ3 and αvβ5. [score:3]
The observed inhibition of tumor growth can thus be ascribed to a combination of an anti-angiogenic effect of miR-7 delivered to tumor -associated EC and an anti-proliferative effect of miR-7 delivered to tumor cells. [score:3]
The log2(ratio) was calculated as described in Material and Methods and reflects the differential expression of genes in HUVEC treated with miR-7 and gene expression in HUVEC treated with miR-Scr. [score:3]
The U-87 MG xenograft tumor mo del was selected because it is highly vascularized and responds well to anti-angiogenic therapy such as bevacizumab or sunitinib [40, 41], making it a suitable mo del to study the anti-angiogenic property of miR-7. Naturally, this mo del does not reflect the nature of glioblastomas in the clinic and recently it was shown that angiogenesis inhibition in glioblastoma patients may induce glioblastoma migration and invasion [42, 43]. [score:3]
To explain the anti-angiogenic properties of miR-7, gene expression analysis was performed using RNA-seq. [score:3]
Indeed, miR-7 inhibited wound closure while miR-Scr transfected cells did not (Fig. 1h). [score:3]
This is indicative of a strong anti-angiogenic activity of miR-7. This was supported by the observation that treatment of CAM with a clinically approved multikinase anti-angiogenic drug, sunitinib, showed a similar inhibitory effect on vascularization. [score:3]
Athymic Nude-Foxn1 [nu] mice bearing U-87 MG tumors were injected intravenously with αvβ3/αvβ5 targeted miR-7 nanoparticles (3 mg/kg miRNA). [score:3]
Indeed, miR-7 inhibits proliferation of not only HUVEC, but also of U-87 MG cells in vitro. [score:3]
Anti-angiogenic activity of miR-7 mimic in vivo– systemic tumor neovasculature targeting. [score:3]
This suggests that inhibition of miR-7 mediated tumor growth is caused by a combined effect on both tumor cells and tumor EC. [score:3]
miR-7 modifies endothelial gene expression. [score:3]
To confirm effective delivery of miR-7 into the tumor tissue we performed IHC staining of OGT, one of the target genes of miR-7 (Fig. 5g). [score:3]
Inhibitory effect of miR-7 on tumor growth by local delivery. [score:3]
In a functional screen with a lentiviral miRNA library miR-7 was identified as inhibitor of EC proliferation. [score:3]
Figure 2(a) miR-7 changes the expression of 2500 HUVEC genes after transfection. [score:3]
Our observation that miR-7 inhibits proliferation of U-87 MG cells confirms the anti-tumorigenic effect of miR-7 in tumor cells. [score:3]
Delivery of miR-7 using this novel formulation demonstrated inhibition of tumor growth in a human glioblastoma xenograft mo del. [score:3]
Inhibitory effect of miR-7 on tumor growth by systemic delivery. [score:3]
Figure 1Anti-angiogenic property of miR-7 in vitro(a) miR-7 inhibits HUVEC cell viability. [score:3]
The decrease in luciferase activity in the presence of miR-7 indicates a direct interaction between miR-7 and the 3′UTR of OGT (Fig. 2e). [score:2]
This study has identified miR-7 as a prominent regulator of angiogenesis. [score:2]
The mechanism through which miR-7 regulates distinct pathways in EC and tumor cells will be subject of future research. [score:2]
To proof that OGT is a direct target gene of miR-7, we measured luciferase activity in Hela cells transfected with a plasmid containing the 3′UTR sequence of OGT. [score:2]
Eight out of 11 genes that are associated to novel anti-angiogenic drugs are down regulated Mature miR-7 is conserved between chicken, human, and mouse (Fig. 3a). [score:2]
In more complex in vitro angiogenesis assays, miR-7 inhibited the ability of HUVEC to form two-dimensional tubules on matrigel and three-dimensional sprouts in collagen. [score:2]
Tumors of the miR-7 treatment group were pale and less vascularized compared to those in control groups (Fig. 5a) and systemic delivery of miR-7 mimic inhibited tumor growth by 42% after two weeks of treatment (Fig. 5b). [score:2]
miR-7 treated mice showed significant tumor growth inhibition compared to vehicle treated mice. [score:2]
Caspase-3 cleavage in HUVEC treated with miR-7 suggests that part of the anti-proliferative activity results in cell apoptosis (Supplementary Fig. S2b). [score:1]
Tumor treatment with intratumoral injection of miRNA delivered by electroporation showed that the miR-7 mimic decreased angiogenesis and reduced tumor growth. [score:1]
Therefore, this approach was selected for systemic delivery of miR-7. Hereto, a novel biodegradable neovasculature targeted nanoparticles formulation was developed and used to investigate the anti-tumor activity of miR-7 following intravenous administration in human glioblastoma U-87 MG bearing mice. [score:1]
Systemic delivery of miR-7 nanoparticles in tumor bearing mice was a randomized, blinded study which was performed in an AALAC certified vivarium (Biomedical Research Institute, Rockville, MD, USA). [score:1]
Gene modulation by miR-7 mimic – HUVEC culture. [score:1]
Stem-Loop RT-PCR showed that the pre-miRNA-7 hairpin is processed into mature miR-7 (hsa-miR-7-5p, Supplementary Table S2). [score:1]
The anti-proliferative effect of miR-7 was comparable to that of a positive control, i. e. siRNA against Polo-like kinase 1 (Plk1), a cell proliferation kinase. [score:1]
Cells were transfected with increasing concentrations of miR-7, miR-scr or siPLK-1. siPLK-1 and miR-scr were used as positive and negative control. [score:1]
Stem-loop RT-PCR was used to determine the relative tumor amounts of miR-7 in the different treatment groups. [score:1]
The anti-angiogenic property of miR-7 was also observed microscopically with a statistically significant reduction of immunohistochemical staining of CD31 in tumor tissue from the miR-7 treated mice (Fig. 5c and d). [score:1]
The sequence of the hsa-miR-7-3 lentivirus was confirmed by Sanger sequencing. [score:1]
Hela cells seeded in 24-well plated, were co -transfected with 10 nM miR-7 or miR-Scr and 100ng/well 3′UTR psiCHECK [TM]-2 construct using Lipofectamine 2000 (Invitrogen) according to manufacturers protocol. [score:1]
This was confirmed by in vitro studies that demonstrated reduced proliferation of U-87 MG cells upon transfection with miR-7 mimic (Supplementary Fig. S7). [score:1]
Moreover, tumor tissue from the miR-7 treated mice contained considerable amounts of necrotic lesions, which is an indication of hypoxia from reduced angiogenesis. [score:1]
We developed a novel αvβ3/αvβ5-integrin targeted nanoparticles for systemic delivery of miR-7 mimic to tumor EC and tumor cells and evaluated it in a human glioblastoma xenograft tumor mo del. [score:1]
Glioblastoma xenograft tumor in vivo mo del: systemic deliverySystemic delivery of miR-7 nanoparticles in tumor bearing mice was a randomized, blinded study which was performed in an AALAC certified vivarium (Biomedical Research Institute, Rockville, MD, USA). [score:1]
Chick CAMs were treated locally within a nitrocellulose ring with 300 picomol miR-7 or miR-Scr using Lipofectamine 2000 or with 200 picomol sunitinib. [score:1]
Mutagenesis of the 3′UTR sequence of the predicted binding site of miR-7 (Fig. 2f) restored luciferase activity, thereby confirming the specificity of the interaction between miR-7 and the OGT 3′UTR (Fig. 2e). [score:1]
Anti-angiogenic activity of miR-7 mimic in vitro. [score:1]
The effect of miR-7 on tumor cell proliferation was determined by Ki-67 staining (in brown). [score:1]
AJ mice bearing tumors with Neuro2A cells were treated locally with 10 μg miR-7 or 10 μg miR-Scr or PBS by intratumoral injection and electroporation. [score:1]
The biochemical process underlying tumor growth inhibition by miR-7 mimics was investigated using immunohistochemical (IHC) detection of CD31, an endothelial cell marker for microvessel density (Fig. 4c). [score:1]
Figure 3(a) Seed sequence of miR-7. Illustration of conserved seed sequence of miR-7 among different species. [score:1]
Anti-angiogenic property of miR-7 in vitro. [score:1]
Among the 6 selected miRNAs, hsa-miR-7-3 demonstrated the strongest anti-proliferative effect. [score:1]
HUVEC, seeded in a 6-well plate (8×10 [4] cells/well), were transfected at different concentrations of miR-7 using X-tremeGENE (see above). [score:1]
Systemic delivery of miR-7 mimic not only reduced tumor angiogenesis but also reduced tumor proliferation as demonstrated by the statistically significant reduction in Ki-67 staining of miR-7 treated tumor tissue (Fig. 5e and f). [score:1]
HUVEC were transfected with 50 nM miR-7 or miR-scr. [score:1]
Subsequently, the rings were loaded with 300 picomol miR-Scr or miR-7 mimics complexed with Lipofectamine 2000 in 20 mM Hepes buffered glucose (pH 7,4). [score:1]
Apart from the here described newly discovered anti-angiogenic effect, human miR-7 was first described by Lim et al. in 2003 [28] and later this miRNA was found to be associated with anti-tumorigenic effects in glioma, hepatocellular carcinoma cells, and head and neck cancer cells [29- 34]. [score:1]
In this work, the U-87MG mo del was used to explore the feasibility of miR-7 as anti-angiogenic agent and other therapeutically relevant tumor mo dels will be explored in the near future. [score:1]
The most potent miRNA, miR-7, was validated for anti-angiogenic activity in vitro. [score:1]
miR-7 treated mice showed a statistically significant reduction in OGT levels (Fig. 5h). [score:1]
Anti-angiogenic activity of miR-7 mimic in vivo– local tumor administration. [score:1]
A reduction in vascular density in the regions between large blood vessels was visible in CAM treated with miR-7 mimic while vascular density was not reduced in untreated or miR-Scr treated CAM (Fig. 3b). [score:1]
Relative expression was calculated as the ratio of reads mapping to a gene in the miR-7 transfected sample and the reads mapping to a gene in the miR-Scr transfected sample. [score:1]
Figure 5(a) miR-7 treated animals show pale and less vascularized tumors. [score:1]
Delivery of miR-7 by electroporation into the tumor tissue was determined by stem loop RT-PCR. [score:1]
HUVEC were transfected with increasing concentrations of miR-7 or miR-Scr. [score:1]
We therefore selected miR-7 for further validation as an anti-angiogenic miRNA candidate. [score:1]
Anti-proliferative effect of systemically delivered miR-7 was determined by Ki-67 staining, indicated as brown spots. [score:1]
HUVEC were transfected with increasing concentration of miR-7 or miR-Scr. [score:1]
HUVEC were transfected with either miR-7 or miR-Scr and the transcriptome was quantified by RNA-Seq. [score:1]
To elucidate the mechanism of action by which miR-7 exerts the anti-angiogenic effects, transcriptional analysis of miR-7 mimic transfected HUVEC was performed. [score:1]
HUVEC were transfected with 50 nM miR-7 or miR-scr and seeded on matrigel at 48hrs after transfection. [score:1]
[1 to 20 of 104 sentences]
7
[+] score: 270
To identify the putative miR-7, miR-34a, and miR-504 targets in the Shank3 interactome, we first pooled all the putative targets for each miRNA from six different prediction tools (TargetScan [http://targetscan. [score:9]
We found that miR-7, miR-34a, and miR-504, three miRNAs with altered expression profiles in multiple neuropsychiatric disorders, directly regulate SHANK3 expression. [score:7]
To understand whether Shank3 expression was required for the spine changes observed after miR-7 or miR-504 inhibition, we co -transfected a previously validated siRNA targeting mouse Shank3 [12]. [score:7]
Expression of miR-7 decreased the luciferase activity of the wild-type SHANK3 3′UTR construct in HEK293T cells, indicating that miR-7 inhibited its expression (Fig.   1b). [score:7]
miR-7, miR-34a, and miR-504 directly regulate the expression of SHANK3Using the TargetScan prediction tool (Release 6.2, http://www. [score:7]
As miR-7, miR-34a, and miR-504 are expressed in mouse hippocampal neurons [39– 41], we decided to test the effect of inhibition of endogenous miRNAs on SHANK3 expression and dendritic spines. [score:7]
Together, these results suggest that miR-7, miR-34a, and miR-504 directly bind to the SHANK3 3′UTR and downregulate its expression. [score:7]
Transfection of locked-nucleic acid (LNA) inhibitors against each of the miRNAs increased the luciferase activity of wild-type, but not the respective binding site-mutant, SHANK3 3′UTR constructs, suggesting that endogenous miR-7, miR-34a, and miR-504 could regulate SHANK3 expression (Fig.   3f and g). [score:6]
Furthermore, the expression of rat Shank3 3′UTR, where the second miR-7 binding site of human 3′UTR is not conserved, was still reduced by miR-7 in the luciferase assay (Fig.   1b), indicating that the first site in the SHANK3 3′UTR is the only functional target site for miR-7. Expression of miR-34a or miR-504 also decreased the luciferase activity of the wild-type SHANK3 3′UTR construct in HEK293T cells (Fig.   1c and d). [score:6]
This circular RNA can indirectly increase the expression of other miR-7 targets by sequestering miR-7, and was thus named as a circular RNA sponge for miR-7 (ciRS-7) [42]. [score:6]
Together, our results provide new insight into the miRNA -mediated regulation of SHANK3 expression, and its potential implications for multiple neuropsychiatric disorders with altered expression profiles of miR-7, miR-34a, and miR-504. [score:6]
Indeed, in HEK293T cells, ciRS-7 expression partially blocked the inhibitory effect of miR-7 on the luciferase activity of the wild-type, but not the miR-7 binding-mutant SHANK3 3′UTR construct (Fig.   3j). [score:5]
g LNA -inhibitor against miR-7, miR-34a, and miR-504 did not affect the expression of the mutant SHANK3 3′UTR in cultured neurons. [score:5]
These results suggest that miR-7, miR-34a, and miR-504 could also potentially regulate the expression of some Shank3-interacting proteins, especially those involved in actin regulation. [score:5]
Nevertheless, after normalization with EGFP, the expression of Shank3 with 3′UTR, but not that without 3′UTR, was significantly decreased by miR-7. e Co-transfection of the Shank3 construct without the 3′UTR, but not that with the 3′UTR, rescued the decreased dendritic spine density by miR-7 or miR-504 overexpression (n = 20–30). [score:5]
miR-7, miR-34a, and miR-504 directly regulate the expression of SHANK3. [score:5]
f LNA -inhibitor against miR-7, miR-34a, or miR-504 increased the expression of co -transfected SHANK3 3′UTR in cultured mouse hippocampal neurons. [score:5]
When we picked those targets suggested by more than two prediction tools, 79, 67, and 46 genes in the Shank3 interactome were revealed as putative targets for miR-7, miR-34a, and miR-504, respectively (Fig.   2a). [score:5]
Moreover, opposite to the miRNA overexpression, miR-7 or miR-504 inhibition increased spine density in cultured mouse hippocampal neurons (Fig.   3h). [score:5]
Moreover, overexpression or inhibition of miR-7 and miR-504 affected the dendritic spines of the cultured hippocampal neurons in a Shank3 -dependent manner. [score:5]
Taken together, these results suggest that miR-7, miR-34a, and miR-504 could regulate SHANK3 expression in cultured mouse hippocampal neurons, and that miR-7 and miR-504 could regulate dendritic spines in a Shank3 -dependent manner. [score:5]
d Representative western blot images show that overexpression of miR-7 or miR-504 decreased the expression of the rat Shank3 construct with the 3′UTR, but not of that without the 3′UTR, in HEK293T cells. [score:5]
a Summary of the process identifying putative miR-7, miR-34a, and miR-504 targets in the Shank3 interactome (top), and the GO analysis of the putative targets (bottom). [score:5]
In this study, we examine this possibility for the SHANK3 gene and report post-transcriptional regulation of SHANK3 expression by three miRNAs, miR-7, miR-34a, and miR-504, which were previously shown to be altered in some neuropsychiatric disorders that could also be caused by SHANK3 dosage changes. [score:4]
In this study, we showed post-transcriptional regulation of SHANK3 expression in neurons by three miRNAs, miR-7, miR-34a, and miR-504. [score:4]
d Mutation of the miR-7 binding site blocked its repressive effect on the expression of the human PFN2 3′UTR. [score:4]
We first pooled the putative human target genes for each of the three miRNAs from six prediction tools (total 8,246 targets for miR-7, 4,635 for miR-34a, and 3,392 for miR-504), and then compared these lists with 338 Shank3 interactome genes [12]. [score:4]
Together, these results suggest that miR-7, miR-34a, and miR-504 could commonly regulate the expression of at least six major Shank3 isoforms (a, a[E10-12S V], c, d, e, and f) (Additional file 1: Figure S3) [8, 49]. [score:4]
Importantly, these dendritic spine changes were dependent on Shank3, suggesting that Shank3 functions as a core protein among the actin-related miR-7 and miR-504 targets in regulating dendritic spines. [score:4]
We further mutated the putative miRNA binding sites in the 3′UTRs of PFN2 and SPTBN2, the two genes most downregulated by miR-7 and miR-504, respectively, and found that the mutations abolished the effect of the miRNAs in the luciferase assays (Fig.   2d and e). [score:4]
Here we show post-transcriptional regulation of SHANK3 expression by three microRNAs (miRNAs), miR-7, miR-34a, and miR-504. [score:4]
miR-7, miR-34a, and miR-504 potentially regulate other targets in the Shank3 interactome. [score:4]
Altered expression profiles of miR-7, miR-34a, and miR-504 in multiple neuropsychiatric disorders. [score:3]
c Overexpression of miR-7 or miR-504 decreased the density of dendritic spines in cultured mouse hippocampal neurons (n = 16–30). [score:3]
However, only the Shank3 construct without the 3′UTR could rescue the decreased spine density in response to miR-7 or miR-504 overexpression (Fig.   3e). [score:3]
The expression of Shank3 construct with 3′UTR, but not that without 3′UTR, was significantly decreased by miR-7 and miR-504 in mouse cultured neurons. [score:3]
We transfected enhanced green fluorescent protein (EGFP) -expressing plasmid with control miRNA, miR-7, or miR-504 into cultured mouse hippocampal neurons, and immunostained the neurons with GFP antibody to visualize dendritic protrusions. [score:3]
TargetScan predicted that the SHANK2 3′UTR contained conserved miR-7, but not miR-34a or miR-504, binding sites. [score:3]
g miR-7, miR-34a, and miR-504 synergistically decreased the expression of the SHANK3 3′UTR. [score:3]
Recently, Zhang et al. claimed that the miR-7/ SHANK3 axis could be involved in schizophrenia pathogenesis, showing an inverse correlation between the expression levels of miR-7 and SHANK3 [35]. [score:3]
i Co-transfection of Shank3 siRNA blocked the increase of dendritic spines in response to miR-7 or miR-504 inhibition (n = 16–20). [score:3]
Indeed, in HEK293T cells, miR-7 and miR-504 reduced the expression of Shank3 proteins from the construct with the 3′UTR, but did not affect the construct without the 3′UTR (Fig.   3d). [score:3]
Statistical analyses are in 1: Table S3The validated target sites for miR-7, miR-34a, and miR-504 were highly conserved across different species (Fig.   1e). [score:3]
i miR-7 did not affect the expression of the human SHANK2 3′UTR that contains two putative miR-7 binding sites. [score:3]
h LNA -inhibitor against miR-7 or miR-504 increased dendritic spines in cultured neurons (n = 18–20). [score:3]
The expression of miR-7, miR-34a and miR-504 were reported to be altered in the postmortem brains, fibroblasts, or blood samples of patients with schizophrenia, depression, or bipolar disorder (Additional file 1: Table S2) [29– 34]. [score:3]
a miR-7, miR-34a, or miR-504 overexpression decreased the luciferase activity of wild-type SHANK3 3′UTR in cultured mouse hippocampal neurons. [score:3]
When expressed at a fixed total amount, miR-7, miR-34a, and miR-504 in combination decreased the luciferase activity of SHANK3 3′UTR more efficiently than each miRNA alone, suggesting their synergistic effect (Fig.   1g). [score:3]
Neither miR-7 nor ciRS-7 changed the expression of miR-7 binding-mutant SHANK3 3′UTR. [score:3]
Notably, we observed decreased expression of EGFP when miR-7 was cotransfected. [score:3]
Statistical analyses are in 1: Table S3 The validated target sites for miR-7, miR-34a, and miR-504 were highly conserved across different species (Fig.   1e). [score:3]
We found that both miR-7 and miR-504 overexpression decreased dendritic spine density, but neither of the miRNAs affected filopodia (Fig.   3c). [score:3]
As ciRS-7 and miR-7 were detected in neuronal tissues including the hippocampus [42, 43], we examined the effect of ciRS-7 overexpression on dendritic spines. [score:3]
j ciRS-7 partially blocked the repressive effect of miR-7 on the expression of wild-type SHANK3 3′UTR in HEK293T cells. [score:3]
miR-7 and miR-504 regulate dendritic spines of cultured hippocampal neurons. [score:2]
However, miR-7 did not change the expression of SHANK2 3′UTR in luciferase assays (Fig.   1i), which might be, at least partly, due to the difference in the secondary structures of SHANK3 and SHANK2 3′UTRs (Additional file 1: Figure S1). [score:2]
Fig. 2Regulation of Shank3-interacting actin-related proteins by miR-7, miR-34a, and miR-504. [score:2]
Therefore, we searched for proteins in the Shank3 interactome that might also be regulated by miR-7, miR-34a, or miR-504. [score:2]
These lists (8,246 targets for miR-7, 4,635 for miR-34a, and 3,392 for miR-504) were compared with the 388 proteins in the Shank3 interactome. [score:2]
c miR-7, miR-34a, and miR-504 decreased the expression of the 3′UTRs of some Shank3-interacting proteins in luciferase assays. [score:2]
However, neither the direct binding of miR-7 to the SHANK3 3′UTR nor its functional effect on neuronal synapses have been reported. [score:2]
Between the two putative miR-7 binding sites in the SHANK3 3′UTR (523–530 and 1, 080–1, 086), mutation of the first (523–530) abolished the effect of miR-7 on luciferase activity (Fig.   1b). [score:2]
We found that cultured hippocampal neurons transfected with ciRS-7 showed increased spine density compared to the neurons transfected with control plasmid (ciRS-7-ir) (Fig.   3k), which was the same phenotype as that observed in response to a miR-7 LNA inhibitor (Fig.   3h). [score:2]
We found that Shank3 siRNA alone resulted in lower spine density compared to that observed with control siRNA, and that it also blocked the increase in spine density in response to miR-7 or miR-504 inhibition (Fig.   3i). [score:2]
h miR-7, miR-34a, and miR-504 did not affect the mRNA levels of the SHANK3 3′UTR. [score:1]
f The sequence alignments across species for the miR-7 and miR-34a binding sites in the PFN2 and SPTBN2 3′UTRs, respectively. [score:1]
b miR-7, miR-34a, and miR-504 did not affect the luciferase activity of the mutant SHANK3 3′UTR constructs in cultured neurons. [score:1]
Consistent with the results from HEK293T cells (Fig.   1), miR-7, miR-34a, and miR-504 decreased the luciferase activity of the wild-type, but not the respective binding site-mutant, SHANK3 3′UTR constructs (Fig.   3a and b). [score:1]
The luciferase activity of the rat Shank3 3′UTR (rWT), containing only the first binding site, was still reduced by miR-7. RL, Renilla luciferase; FL, firefly luciferase. [score:1]
We transfected cultured hippocampal neurons with control miRNA, miR-7, or miR-504 in combination with the two Shank3 constructs. [score:1]
b miR-7 decreased the luciferase activity of the wild-type (hWT), but not the first binding site-mutant (hM), SHANK3 3′UTR. [score:1]
To test the effect of a circular RNA sponge for miR-7, 200 ng of ciRS-7-ir or ciRS-7 plasmids (kindly gifted from Dr. [score:1]
Consistently, the expression of Shank3 construct with 3′UTR, but not that without 3′UTR, was decreased by miR-7 and miR-504 in cultured neurons measured by immunostaining (Additional file 1: Figure S2). [score:1]
Jorgen Kjems) were co -transfected with 30 ng of psiCHECK-2 SHANK3 3′UTR and 6 pmol of miR-7 duplex. [score:1]
Recently, an endogenous circular RNA that has more than 70 binding sites for miR-7 was identified [42, 43]. [score:1]
Finally, we chose three miRNAs, miR-7, miR-34a, and miR-504 because of their strong 8-mer type binding sites [20] in the SHANK3 3′UTR. [score:1]
Consistently, both gain- and loss-of-function experiments showed that miR-7 and miR-504 control actin-rich dendritic spines. [score:1]
[1 to 20 of 77 sentences]
8
[+] score: 239
Intriguingly, miR-7 expression was significantly decreased by these secretagogues (Supplementary Fig. 4), suggesting an unrecognized molecule or pathway that suppressed the expression of miR-7. This inhibitory effect on miR-7 expression, however, is beneficial for insulin secretion because miR-7 overexpression was found to reduce insulin secretion. [score:13]
Cdr1as upregulates miR-7 target genes expressionFurthermore, we examined whether Cdr1as and/or miR-7 are capable of modulating the expression of endogenous Myrip and Pax6. [score:10]
This observation confirmed that the inhibitory role of Cdr1as in miR-7 is associated with the binding of the target, not the degradation of miR-7 6. Since miR-7 interacts with Cdr1as, we examined whether endogenous miR-7 expression level is affected by forskolin, PMA and glucose treatment under the same condition as used in the stimulation of Cdr1as expression. [score:9]
As shown in the working mo del (Fig. 7), we found that Cdr1as or miR-7 expression was upregulated or downregulated respectively by forskolin and PMA, indicating that Cdr1as/miR-7 is involved in the cAMP and PKC signal pathway. [score:9]
This observation confirmed that the inhibitory role of Cdr1as in miR-7 is associated with the binding of the target, not the degradation of miR-7 6. Since miR-7 interacts with Cdr1as, we examined whether endogenous miR-7 expression level is affected by forskolin, PMA and glucose treatment under the same condition as used in the stimulation of Cdr1as expression. [score:9]
Cdr1as upregulates miR-7 target genes expression. [score:8]
Overexpression of exogenous Cdr1as or stimulation of forskolin or PMA can significantly increase the expression level of Cdr1as in islet cells, which in turn inhibits miR-7’s function in insulin biosynthesis and secretion. [score:7]
These findings clearly showed that Pax-6 levels, as a major target of miR-7, is likely to be upregulated by Cdr1as in islet cells. [score:6]
Although many miR-7 target genes were predicted by miRNA software, only a dozen of them have been experimentally demonstrated to be direct targets in insulin pathway of adult islet β cells. [score:6]
MiR-7 (miR-7a is dominantly expressed in islets) expression plasmid, miRVec-miR-7 and its control plasmid (harboring a scrambled sequence, named as “Ctrl1”) were kindly provided by Dr. [score:5]
miR-7 expression level in islet cells, suggesting most if not all of miR-7 will be inhibited by Cdr1as. [score:5]
Myrip and Pax6 are miR-7 targetsTo explore possible molecular interactions of Cdr1as/miR-7 in islet β cells, we analyzed potential miR-7 targets with two wi dely-used bioinformatics tools, PicTar (http://pictar. [score:5]
Similar results were also observed in freshly isolated mouse islets, (Fig. 3b) i. e., ~30% decrease of insulin secretion in miR-7 overexpression group and ~40% increase in Cdr1as overexpression group (Fig. 3b). [score:5]
Since miR-7 is abundantly expressed in islet cells, we assumed that Cdr1as is also expressed in islet cells and other neuroendocrine tissues. [score:5]
In fact, miR-7 expression was reduced in either glucose or forskolin, whereas Cdr1as expression showed positive response to both secretagogues. [score:5]
Decreased insulin content by miR-7 expression or increased insulin protein by Cdr1as expression was confirmed in MIN6 cells and islet cells (Fig. 4c,d). [score:5]
In order to demonstrate that Myrip is a novel direct target of miR-7, we established two dual-luciferase reporter constructs that contain either a wildtype or a mutated 3′-UTR of Myrip. [score:4]
How to cite this article: Xu, H. et al. The circular RNA Cdr1as, via miR-7 and its targets, regulates insulin transcription and secretion in islet cells. [score:4]
Thereby it was ascertained that miR-7 had an inhibitory effect on Myrip and Pax6 through direct binding of their 3′-UTR. [score:4]
In mouse islets cells, however, overexpression of ciRS-7 reached ~90% increase of insulin content compared to the control, while the miR-7 expression resulted in ~20% decrease of insulin content (Fig. 4b). [score:4]
These results demonstrate that miR-7 could regulate the expression of Myrip and Pax6. [score:4]
For the sake of strong effects on miR-7 function, Cdr1as could be an important regulator to prevent miR-7 from interacting with target transcripts in islet cells. [score:4]
We first confirmed that the Cdr1as expression has direct inhibition on miR-7 activity in islet cells by measuring luciferase reporter activities with constructs either containing miR-7 binding site or the entire ciRS-7 sequence (Supplementary Fig. 1). [score:4]
Also, Pax6 (paired box 6) is a transcriptional factor regulating insulin biosynthesis and secretion 33 34, and a target of miR-7 reported previously 29. [score:4]
To explore possible molecular interactions of Cdr1as/miR-7 in islet β cells, we analyzed potential miR-7 targets with two wi dely-used bioinformatics tools, PicTar (http://pictar. [score:3]
Also, the identification of miR-7 target genes related to insulin signaling pathway in islet β cells may reveal the molecular network responsible for the insulin secretion and homeostasis. [score:3]
Expression levels of Cdr1as and miR-7 are normalized to Gapdh mRNA levels. [score:3]
As expected, miR-7 overexpression reduced ~20% insulin secretion in MIN6 cells. [score:3]
Furthermore, we examined whether Cdr1as and/or miR-7 are capable of modulating the expression of endogenous Myrip and Pax6. [score:3]
Using the insulin ELISA assay, we found that ~25% reduction of insulin content in miR-7 overexpressed MIN6 cells compared to a ~70% increase of insulin content in Cdr1as overexpressed MIN6 cells (Fig. 4a). [score:3]
Each of the construct DNAs was co -transfected with miR-7 expression vector or control vector into 293T cells. [score:3]
Since insulin content was increased by the Cdr1as treatment, we examined whether overexpression of Cdr1as and/or miR-7 affects endogenous insulin1 and insulin2 mRNA levels. [score:3]
Concomitantly, the expression pattern of miR-7 was largely similar to that of Cdr1as, but its transcriptional level in islet or pituitary gland was much higher than Cdr1as (Fig. 1a). [score:3]
In addition, the interaction of Cdr1as with miR-7 could be targeted by another miRNA, miR-671, which triggers endonucleolytic cleavage of Cdr1as 25. [score:3]
Altogether, our results indicate that the effect of Cdr1as on insulin content is through insulin biosynthesis, in which potential target genes of miR-7 may actually play an important role. [score:3]
Myrip and Pax6 are miR-7 targets. [score:3]
As we mentioned earlier, transgenic mice overexpressing miR-7 in β cells developed diabetes due to impaired insulin secretion and β cell dedifferentiation. [score:3]
Apparently, the inactivation of miR-7 in mouse islets showed broad effects on insulin pathway due to alterations of hundreds of potential targets. [score:3]
Overexpression of Cdr1as in islet cells was predicted to result in alterations of insulin secretion because of the function of miR-7 as we discussed above. [score:3]
As determined by qRT-PCR, ~30% and ~20% reduction of insulin 1 and insulin 2 gene respectively were observed in the miR-7 overexpressed MIN6 cells (Fig. 5a). [score:3]
Western blots confirmed that miR-7 reduced Myrip and Pax6 protein levels, while Cdr1as dramatically increased their expression in MIN6 cells (Fig. 6c). [score:3]
Therefore, additional miR-7 targets involving insulin granule metabolism as well as insulin homeostasis should be identified. [score:3]
To identify new targets of miR-7 in insulin secretion pathway, we screened hundreds of candidate genes that were predicted by multiple bioinformatic tools and extensively analyzed the candidate’s function in islet cells. [score:3]
In particular, physiological and biological functions of two major target genes (e. g., Myrip and Pax6) of miR-7 have been well studied in islet cells. [score:3]
Similarly, the endogenous Cdr1as expression level was not altered by exogenous transfection of the miRVec-miR-7 (Supplementary Fig. 3b). [score:3]
This finding is in agreement with the inhibitory role of miR-7 on Pax-6 by ours and others 29. [score:3]
Four plasmids, including Cdr1as expression plasmid, pCDNA3-ciRS-7 and its scrambled sequence plasmid (which inserted a Cdr1as sequence only but no invert repeat flanking introns, resulting in no circular Cdr1as production; named as “Ctrl2”), psiCheck-miR-7 and psiCheck-CiRS-7, were kindly given by Dr. [score:3]
While the forced expression of miR-7 in mouse islet cells showed even more decrease of Myrip mRNA (~50%) and Pax6 mRNA (~60%) compared to their controls (Fig. 6b). [score:2]
Whether these responses are derived from associated promoter elements like CREB binding sites or from indirect elements of the Cdr1as/miR-7 network remains to be studied. [score:2]
MiR-7 expression also responded in a similar way to these secretagogues. [score:2]
Forced expression of miR-7 in MIN6 cells was found to result in ~40% decrease of Myrip mRNA and 50% reduction of Pax6 mRNA compared to the control plasmids -treated cells (Fig. 6b). [score:2]
Furthermore, after miR-7 or Cdr1as plasmid DNA was transfected into MIN6 cells and pancreatic islet cells for 48 h, miR-7 or Cdr1as expression was found to be increased ~70 folds or ~180 folds respectively, compared to the control (Supplementary Fig. 2). [score:2]
However, luciferase activities in the mutant Myrip or the mutant Pax6 did not show significant alterations because the mutations within the seed sequence of Myrip or Pax6 abrogated the binding site of miR-7 (Fig. 6a). [score:2]
In particular, Cdr1as, which is derived from an antisense transcript of the CDR1 protein-coding gene at chromosome Xq27.1, contains 71 binding sites or 26 clusters corresponding to miR-7 sites. [score:1]
Cdr1as and miR-7 plasmid DNAs were separately transfected into MIN6 cells and also dissociated mouse islet cells in culture plates (see details in). [score:1]
Furthermore, an interesting observation is that inactivation of miR-7 in obese mice might be sufficient to rescue β cell failure and glycemia 24. [score:1]
Working mo del of Cdr1as/miR-7 -associated network in β cells. [score:1]
Among multiple hits of miR-7, two interesting genes were prioritized because of their role in insulin biosynthesis and exocytosis. [score:1]
We observed that 40% reduction in the wildtype Myrip transfected cells and 50% reduction in Pax6 transfected cells when co -transfected with miR-7, but not co -transfected with control (Fig. 6a). [score:1]
Interestingly, this interaction between Myrip and MyosinVa was activated by cAMP pathway 39, which is inversely correlated with miR-7 by forskolin treatment observed in this study. [score:1]
293T cells were co -transfected with Myrip or Pax6 3′-UTR luciferase reporter plasmid DNA and miRVec-miR-7 or its control plasmid DNAs at 1:10 ratio and were then harvested after 48 h in culture. [score:1]
Importantly, genetic inactivation of miR-7 in β cells was found to result in increased insulin secretion but not affecting proliferation and apoptosis, indicating that miR-7 is dispensable for the maintenance of endocrine β cell mass 24. [score:1]
Islets cells were transfected with plasmid Ctrl2 or pcDNA3-ciRS-7, together with or without miRVec-miR-7 and psiCheck reporter plasmids. [score:1]
After measuring 3′-UTR luciferase reporter activity of the selected candidate gene, we further confirmed that Myrip expression level was decreased by miR-7 but increased by Cdr1as in the islet cells (Fig. 7). [score:1]
In fact, the increased insulin secretion was shown in both acute phase and second phase in the miR-7 deletion mouse 24. [score:1]
However, the endogenous miR-7 expression level, as measured by qRT-PCR, was found to be unaffected by exogenous transfection of the pCDNA3-CiRS-7 (Supplementary Fig. 3a). [score:1]
These results showed that Cdr1as, as a specific repressor of miR-7, is indeed implicated in the insulin pathway. [score:1]
[1 to 20 of 67 sentences]
9
[+] score: 202
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, hsa-mir-574
To determine whether up-regulation of HuR contributed to TLR9 signaling induced repression of miR-7, we downregulated HuR expression using RNAi and then detected the expression of miR-7 in human lung cancer cells. [score:11]
Importantly, we found that the expression level of miR-7 in HuR RNAi transfected group treated with CpG ODNs was significantly higher than that in control group (Figure  3B, p < 0.05), indicating that downregulation of HuR could reverse the expression of miR-7 in human lung cancer cells. [score:8]
To explore the possible role of HuR on miR-7 expression, eukaryotic expression vector encoding HuR was transiently transfected into 95D cells and then the expression of miR-7 was detected by. [score:7]
In additions, we also found that overexpression of miR-7 could significantly reduce the expression of HuR in CpG ODNs treated human lung cancer cells (Additional file 1: Figure S1), through inhibiting the transduction of PI3K/Akt pathway [16]. [score:7]
In present study, we further demonstrated that TLR9 signaling could enhance the expression of HuR through Akt pathway, which ultimately reduce the expression of miR-7, suggesting that PI3K/Akt pathway was important for the expression of HuR in cancer cells. [score:7]
Recently, miR-7 was reported played an important role in regulating the biology of various tumor cells through repressing the expression of different target molecules. [score:6]
Importantly, in contrast to previous findings, we characterized that up-regulation of HuR was contributed to TLR9 signaling enhanced growth and metastatic potential of human lung cancer through altering the expression of miR-7. Our findings indicated that HuR could act as regulator in regulating TLR9 signaling associated biological effect in human lung cancer cells through a positive feedback loop, which might be helpful for the understanding of the potential role of HuR in tumor biology. [score:6]
Figure 3 Down-regulation of HuR reversed the expression of miR-7 in CpG ODNs treated human lung cancer cells. [score:6]
In previous study, we reported down-regulation of intrinsic miR-7 was critical for TLR9 signaling enhanced progression of human lung cancer cells through altering the expression of PIK3R3 [16]. [score:6]
Down-regulation of HuR elevated the expression of miR-7 in CpG ODNs treated human lung cancer cells. [score:6]
Notably, down-regulation of HuR using RNA interference restored miR-7 expression in CpG ODNs treated lung cancer cells, accompanied by enhanced growth and metastatic potential. [score:6]
Up-regulated HuR could bind to the loop sites of pri-miR-7 and reduce the expression of miR-7 [20], thereby synergizing the transduction of PI3K/Akt pathway as a positive feedback loop, which ultimately resulted in enhanced growth and metastatic potential of human lung cancer cells. [score:6]
As shown in Figure  1C, the expression of miR-7 decreased during the stimulation of CpG ODNs, accompanied by elevated expression of HuR (p < 0.05), which was consistent with our previous data [16]. [score:5]
Moreover, overexpression of HuR could reduce the expression of miR-7 in lung cancer cells. [score:5]
To validate these finding, we further observed the effect of HuR overexpression on the expression of miR-7 in other lung cancer cells. [score:5]
Click here for file Overexpression of miR-7 reduced HuR expression in human lung cancer cells treated with CpG ODNs. [score:5]
Overexpression of miR-7 reduced HuR expression in human lung cancer cells treated with CpG ODNs. [score:5]
Overexpression of HuR reduced the expression of miR-7 in human lung cancer cells. [score:5]
Our previous study showed that CpG ODNs could also reduce miR-7 expression in other lung cancer cells such as BE1, NCI-H727 and SPCA/I [16], which also expressed TLR9 molecule (data not shown). [score:5]
As a tumor suppressor, the expression of miR-7 was commonly repressed in tumor cells. [score:5]
These data demonstrated that HuR could regulate the expression of miR7 in human lung cancer cells. [score:4]
Consistently, Choudhury et al. found that HuR could bind to the conserved terminal loop of pri-miR-7 and regulate the expression of miR-7 in nonneural cells in brain tissue [21]. [score:4]
Our most recent study also showed that downregulation of intrinsic miR-7 was important for TLR9 signaling enhanced growth and metastatic potential of human lung cancer cells [16]. [score:4]
Combining these data suggested that the underlying mechanism regulating expression of distinct miRNAs such as miR-7 in different cells was distinct and complex, which related to different transcriptional and post-transcriptional mechanisms. [score:4]
Our current work further reported that HuR could regulate the expression of miR-7 in human lung cancer cells. [score:4]
Reddy et al. reported that homeodomain transcription factor (HoxD10) could regulate the expression of miR-7 through binding to the promoter site of miR-7 in breast cancer cells [27]. [score:4]
Interestingly, one research work further showed that HuR could regulate the expression of miR-7 in nonneural cells in brain [20]. [score:4]
Our previous data showed that TLR9 signaling could enhance the growth and metastatic potential of human lung cancer cells through altering miR-7 expression [7, 16]. [score:3]
The relative expression of miR-7 was further determined by at indicated time point. [score:3]
Importantly, we found that the expression of miR-7 decreased obviously in pHuR transfected group in a time dependent manner (Figure  2B and C, p < 0.05). [score:3]
Our recent evidence showed that Toll like receptor 9 (TLR9) signaling could enhance the growth and metastatic potential of human lung cancer cells through repressing microRNA-7 (miR-7) expression. [score:3]
In addition, the expression level of miR-7 also increased significantly (data not shown), which was consistent with our previous work [16]. [score:3]
Similarly, the expression level of miR-7 in pHuR transfected human lung cancer cells BE1, NCI-H727 and SPCA/I also decreased respectively (Figure  2D, p < 0.05). [score:3]
However, whether HuR was also involved in the expression of miR-7 in TLR9 signaling treated lung cancer cells still remains to be elucidated. [score:3]
Next, we further detected the expression of miR-7 on 95D cells. [score:3]
Then, the expression of miR-7 and HuR were analyzed at indicated time point. [score:3]
72 hrs later, the relative expression of miR-7 also was determined by. [score:3]
However, whether HuR also contributed to the altered expression of miR-7 in TLR9 signaling stimulated human lung cancer cells remains to be elucidated. [score:3]
The relative expression of miR-7 was performed according to our previous description [16]. [score:3]
To investigate the potential role of HuR on the expression of miR-7, we firstly detected the expression of HuR in CpG ODNs, TLR9 agonist, treated human lung cancer cells. [score:3]
Such as, Kong et al. reported that activated macrophage-derived small molecule could reduce the expression of miR-7 in gastric tumor cells [26]. [score:3]
Next, we further investigated whether HuR could regulate the expression of miR-7 in human lung cancer cells. [score:2]
Mechanistic evidence showed that miR-7 could regulate the transduction of Akt pathway, which was critical for growth and metastasis of tumor cells [14, 15]. [score:2]
However, the mechanism that downregulation of miR-7 in TLR9 signaling treated lung cancer cells remains to be investigated. [score:2]
TLRs: Toll like receptors; ODNs: Oligonucleotides; miR-7: microRNA-7; RNAi: RNA interference; HuR: Human antigen R. The authors declare that they have no competing interests. [score:1]
In addition, it should be noted that our previous data also showed the activity of miR-7 promoter also decreased in TLR9 signaling treated human lung cancer cells [16]. [score:1]
MicroRNA-7 (miR-7), a unique member of miRNAs, played an important role in the progression of various tumors including lung cancer [11- 13]. [score:1]
Here, we carefully evaluated the potential role of HuR in the expression of miR-7 on TLR9 signaling treated human lung cancer cells. [score:1]
[1 to 20 of 48 sentences]
10
[+] score: 200
Fig. 7 In CRC, circHIPK3 is frequently upregulated partly caused by the transcription factor c-Myb overexpression, then circHIPK3 can sponge more endogenous miR-7 to sequester and inhibit miR-7 activity, thereby leading to increased proto-oncogenes (FAK, IGF1R, EGFR, and YY1) expression, which promoting CRC development and progression Previous studies indicated the enrichment for circHIPK3 transcribed by c-Myb in diabetes mellitus 9, 19. c-Myb overexpression occurring in many malignancies, including CRC, often marks poor prognosis [30]. [score:13]
In CRC, circHIPK3 is frequently upregulated partly caused by the transcription factor c-Myb overexpression, then circHIPK3 can sponge more endogenous miR-7 to sequester and inhibit miR-7 activity, thereby leading to increased proto-oncogenes (FAK, IGF1R, EGFR, and YY1) expression, which promoting CRC development and progression Human normal colon epithelial cell (FHC) and colorectal cancer cell lines (HCT116, HT29, SW480, SW620, DLD1) were purchased from American Type Culture Collection (Manassas, VA, USA) and were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Gibco, Vienna, Austria). [score:11]
Likewise, miR-7 overexpression or circHIPK3 knockdown significantly decreased the expression of miR-7 targeting proto-oncogenes (FAK, IGF1R, EGFR, YY1) both at the mRNA and protein levels, and the combined group exhibited less expression of these oncogenes (Supplementary Fig.   2a, b). [score:10]
f qRT-PCR analysis of the expression of growth and metastasis-related miR-7 targets in HCT116 and HT29 cells with circHIPK3 knockdown or overexpression. [score:8]
Mechanistically, ectopic expression of circHIPK3 could rescue the expression of miR-7 targeting oncogenes by sponging miR-7, thereby promoting CRC progression (Fig.   7). [score:7]
In agreement with previous studies, our data indicated that miR-7 overexpression significantly inhibited CRC cells proliferation, migration, invasion and induced apoptosis, and these inhibitory effects were exceedingly similar to circHIPK3 silencing. [score:7]
In addition, we also found that overexpression of miR-7 combined with knockdown of circHIPK3 displayed an additive suppressive effect on CRC cell malignant phenotype compared with miR-7 overexpression or circHIPK3 silencing alone (Supplementary Fig.   1a–c). [score:7]
Moreover, the combination of circHIPK3 knockdown and miR-7 overexpression gave a better tumor-suppressive effect both in vitro and in vivo than did circHIPK3 silencing or miR-7 reintroduction alone. [score:6]
h qRT-PCR analysis of miR-7 expression in HCT116 and HT29 cell lines with circHIPK3 knockdown or overexpression. [score:6]
Moreover, circHIPK3 expression was negatively correlated with the expression of miR-7 in CRC tissues (r = −0.453, p < 0.001) (Fig.   4i). [score:5]
Our data also showed that overexpression of miR-7 significantly suppressed CRC cells proliferation, migration, invasion and induced apoptosis (Fig.   5a–e) resembling that of circHIPK3 silencing (Supplementary Fig.   1a–c). [score:5]
And overexpression of circHIPK3 decreased, but silencing of circHIPK3 increased, the expression of miR-7 in HCT116 and HT29 cell lines (Fig.   4h). [score:5]
We then wonder whether circHIPK3 exert pro-tumor role by elevating the expression of miR-7 targeting oncogenes. [score:5]
Furthermore, circHIPK3 could sponge endogenous miR-7 to sequester and inhibit miR-7 activity, thereby leading to increased FAK, IGF1R, EGFR, and YY1 expression. [score:5]
Silencing of circHIPK3 combined with overexpression of miR-7 exhibits an additive inhibitory effect on CRC growth and metastasis in xenograft animal mo dels. [score:5]
Overexpression of circHIPK3 effectively reverses miR-7 -induced inhibition of CRC cells progression. [score:5]
Thus, our study demonstrate that co -expressing miR-7 along with a circHIPK3 inhibitor may be a promising treatment approach for patients with CRC. [score:5]
These above results implicate that overexpression of circHIPK3 effectively reverses miR-7 -induced attenuation of aggressive phenotypes of CRC cells by sponging miR-7 and subsequent promotion of FAK, IGF1R, EGFR, and YY1 expression. [score:5]
Overall, these data indicate that silencing of circHIPK3 suppresses CRC growth and metastasis in vivo and combined with miR-7 overexpression exhibits an additive effect on tumor repression. [score:5]
Moreover, we found circHIPK3 could sponge endogenous miR-7 to sequester and reduce miR-7 activity, thus resulting in increasing the expression of miR-7 targeting oncogenes (FAK, IGF1R, EGFR, and YY1). [score:5]
MiR-7, a well-known tumor suppressor, was proposed to participate in the development and progression of different types of human cancers [37]. [score:3]
The most well-known circRNA is CDR1as, which harbors more than 70 selectively conserved miR-7 target sites 15, 18. [score:3]
CircHIPK3 silencing retards tumor progression and combined with miR-7 overexpression exhibits a magnifying effect on tumor repression in vivo. [score:3]
d The biotinylated wild-type/mutant miR-7 was, respectively, transfected into HCT116 and HT29 cells with circHIPK3 overexpression. [score:3]
Scare bar = 50 μm Accumulating evidence indicated that miR-7 could simultaneously target various oncogenes involved in diverse signaling pathways in different human tumors [27]. [score:3]
Scare bar = 50 μmAccumulating evidence indicated that miR-7 could simultaneously target various oncogenes involved in diverse signaling pathways in different human tumors [27]. [score:3]
EdU incorporation assay indicated ectopically overexpressed miR-7 together with circHIPK3 promoted CRC cells proliferation compared with miR-7 overexpression alone (Fig.   5b). [score:3]
A panel of growth and metastasis-related miR-7 targets was chosen for qRT-PCR analysis. [score:3]
Gu DN microRNA-7 impairs autophagy-derived pools of glucose to suppress pancreatic cancer progressionCancer Lett. [score:3]
g qRT-PCR analysis of the expression of miR-7 in CRC tissues (n = 178). [score:3]
Our data also suggest that targeting the c-Myb/circHIPK3/miR-7 axis as a potential treatment strategy for fighting CRC. [score:3]
For miR-7 pulled down circHIPK3, HCT116 and HT29 cells with circHIPK3 overexpression were transfected with biotinylated miR-7 mimics or mutant using Lipofectamine 2000. [score:3]
To further consolidate the direct binding of miR-7 and circHIPK3, we utilized biotin-labeled miR-7 and its mutant mimics to pull-down circHIPK3 in HCT116 and HT29 cells with circHIPK3 overexpression, the results showed wild-type miR-7 captured more circHIPK3 compared with the mutant (Fig.   4d). [score:3]
Likewise, transwell invasion assay without or with matrigel reveled that miR-7 together with circHIPK3 overexpression obviously impeded HCT116 and HT29 cells migration (Fig.   5d) and invasion (Fig.   5e) compared with miR-7 overexpression alone. [score:3]
Bhere, D. et al. MicroRNA-7 upregulates death receptor 5 and primes resistant brain tumors to caspase -mediated apoptosis. [score:3]
MiR-7, a well-known tumor suppressor, was involved in many human tumors development and progression 22– 25, including CRC [26]. [score:3]
Next, we carried out luciferase reporter assays and demonstrated that overexpression of miR-7 significantly decreased the luciferase activity of the vector containing the complete circHIPK3 sequence, but did not affect the luciferase activity of the vector with mutant miR-7 -binding site in HCT116 and HT29 cells (Fig.   4e). [score:2]
Cui YX MicroRNA-7 suppresses the homing and migration potential of human endothelial cells to highly metastatic human breast cancer cellsBr. [score:2]
Moreover, the expression of FAK, IGF1R, EGFR, and YY1 was markedly increased in CRC cells (HCT116 and HT29) co -transfected with miR-7 mimics and circHIPK3 vectors compared with the cells transfected with miR-7 mimics alone (Fig.   5g). [score:2]
Furthermore, we applied FISH to assess whether there is a co-location between circHIPK3 and miR-7, the result showed that circHIPK3 and miR-7 were co-localized in cytoplasm (Fig.   4f). [score:1]
In summary, our findings provide robust evidence that c-Myb transcriptionally elevates circHIPK3 and circHIPK3 serves as a novel oncogenic circRNA by sponging miR-7, as well as a promising prognostic biomarker in CRC. [score:1]
qRT-PCR analyses revealed that miR-7 was the only one miRNA that was abundantly pulled down by circHIPK3 probe in both HCT116 and HT29 cells (Fig.   4b and c). [score:1]
Hansen TB Kjems J Damgaard CK Circular RNA and miR-7 in cancerCancer Res. [score:1]
Gu DN Huang Q Tian L The molecular mechanisms and therapeutic potential of microRNA-7 in cancerExpert Opin. [score:1]
Fig. 5. HCT116 and HT29 cells transfected with miR-control, miR-7, circHIPK3, or miR-7 + circHIPK3. [score:1]
HCT116 and HT29 cells transfected with miR-control, miR-7, circHIPK3, or miR-7 + circHIPK3. [score:1]
* vs control group, [#] vs mir-7 group. [score:1]
We then investigated whether circHIPK3 exerted tumor-promoting effect by sponge activity of miR-7, HCT116, and HT29 cells were co -transfected with miR-7 mimics and circHIPK3 expression vectors. [score:1]
e Luciferase activity in HCT116 and HT29 cells co -transfected with luciferase reporter containing circHIPK3 sequences with wild-type or mutated miR-7 binding sites and the mimics of miR-7 or control. [score:1]
CircHIPK3 serves as a sponge for miR-7 in CRC cell lines. [score:1]
Taken together, these data demonstrate that circHIPK3 acts as a miRNA sponge for miR-7 in CRC. [score:1]
si-circHIPK3, si-c-Myb, miR-7 mimics, and their respective control oligonucleotides were synthesized by Gene-Pharma (Shanghai, China). [score:1]
The schematic cartoon of the c-Myb/circHIPK3/miR-7 axis in CRC. [score:1]
CircHIPK3 can sponge miR-7 in CRC cell lines. [score:1]
Scare bar = 50 μm To explore whether circHIPK3 can function as “miRNA sponge” in CRC cells, we selected the top ten (miR-599, miR-93-3p, miR-365a-5p, miR-365b-5p, miR-421, miR-570-3p, miR-597-5p, miR-7, miR-1207-3p, miR-124-5p) candidate miRNAs through CircNet database [21]. [score:1]
[1 to 20 of 55 sentences]
11
[+] score: 199
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-1246
As one of IR -upregulated exosomal miRNAs, miR-7-5p can induce autophagy in the non-irradiated cells through targeting EGFR/Akt/mTOR signaling pathway. [score:6]
Our results indicated that miR-7-5p suppressed the expression of EGFR, and consequently the phosphorylation of Akt and mTOR was also depressed. [score:5]
Therefore, we suggest that the exosomes mediate miR-7-5p transfer to the non-target cells, where miR-7-5p induces autophagy through targeting EGFR signaling pathway. [score:5]
The exosomes were harvested 4 hr post-irradiation, and co -treated the non-irradiated cells with pEGFP-C1-LC3 vector in the presence (IR-exosome + miR-7-5p inhibitor) or absence (IR-exosome) of miR-7-5p inhibitor. [score:5]
Panel F: Densitometric quantitation of western blotting analysis of AKT protein expression represented in panel D. There is no statistical significance (p > 0.05) between miR-NC and miR-7-5p mimic or between miR-7-5p mimic and miR-7-5p mimic + inhibitor. [score:5]
The exosomes from irradiated cells also led to the suppression of EGFR in the recipient cells, and which could be rescued by miR-7-5p inhibitor. [score:5]
miR-7-5p inhibitor attenuated the phosphorylation inhibition of Akt and mTOR by miR-7-5p. [score:5]
U6 or miR-16 expression was used as an internal control for miR-7-5p expression. [score:5]
Importantly, in the presence of miR-7-5p inhibitor, this bystander autophagy induced by the exosomes from irradiated cells has been significantly suppressed. [score:5]
Each sample was tested three times, and the expression of miR-7-5p in the untreated control was set as to generate the relative expression level in the treated cells. [score:5]
[#] p < 0.05 as compared with the cells treated with miR-7-5p mimic Panel I: Densitometric quantitation of western blotting analysis of mTOR protein expression represented in panel G. There is no statistical significance (p > 0.05) between miR-NC and miR-7-5p mimic or between miR-7-5p mimic and miR-7-5p mimic + inhibitor. [score:4]
Among these miRNAs, miR-7-5p level was persistently upregulated at 4 hr and 8 hr post-irradiation. [score:4]
We assumed that the downregulation of intracellular miR-7-5p in irradiated BEP2D cells might be due to the package of miR-7-5p into exosomal cargo after irradiation. [score:4]
A recent paper has demonstrated that EGFR is a direct target of miR-7-5p 54. [score:4]
Roche TaqMan microRNA expression assay was used to quantitate mature miR-7-5p expression following the manufacturer’s protocol. [score:4]
Panel A: BEP2D cells were transfected with miR-7-5p mimic or miR-NC, 24 hr later EGFR mRNA expression was determined by RT-qPCR. [score:3]
The results indicated that the treatment of miR-7-5p mimics (Fig. 2A) or the exosomes from irradiated cells (IR-exo) (Fig. 2B) obviously suppressed the proliferation of BEP2D cells. [score:3]
Panel D: Intracellular miR-7-5p expression in BEP2D cells at 4 h post-2 Gy irradiation was detected by RT-qPCR. [score:3]
As both miR-7-5p mimic and exosomes from the irradiated cells suppressed the cells proliferation, suggesting that the autophagy induced by the exosomal miR-7-5p might result in a detrimental effect of RIBEs. [score:3]
The decreased level of EGFR was largely attenuated by miR-7-5p inhibitor (Fig. 6B,C). [score:3]
Plasmid, miR-7-5p mimic/inhibitor. [score:3]
miR-7-5p mimic (sense:5′-UGGAAGACUAGUGAUUUUGUUGU-3′, antisense: 5′-AACAAAAUCACUAGUCUUCCAUU-3′), miR-7-5p inhibitor (5′-ACAACAAAAUCACUAGUCUUCCA-3′), and miR-NC (control miRNA) (sense: 5′UUCUCCGAACGUGUCACGUTT) were purchased from GenePharma (Shanghai, China). [score:3]
Consistent with this, the level of EGFR was also partially decreased in BEP2D cells treated with the exosomes from 2 Gy irradiated BEP2D cells, and which could also be rescued by miR-7-5p inhibitor (Supplementary Fig. 4A,B). [score:3]
Panel C: Expression of the autophagy markers Beclin 1 and P62 were detected by Western blotting analysis in BEP2D cells 24 hr after transfected with miR-7-5p or miR-NC as above. [score:3]
miR-7-5p mimics or miR-NC were transfected into BEP2D cells and the expression level of EGFR were assessed by western blot and RT-qPCR. [score:3]
For fluorescent-staining, BEP2D cells were co -transfected with 1 μg of pEGFP-C1-LC3 (green fluorescent), and 50 nM of miR-7-5p mimic, miR-7-5p inhibitor or miR-NC for 24 hr, then fixed in chilled phosphate-buffer saline (PBS) containing 4% paraformaldehyde overnight at 4 °C. [score:3]
Considering the fact that both miR-7-5p mimic and exosomes from the irradiated cells suppressed the cells proliferation, we deemed that the autophagy induced by the exosomal miR-7-5p might play the role of producing a detrimental effect. [score:3]
Four hours later, the exosomes were harvested from the medium of 2 Gy-irradiated cells or the non-irradiated control cells, and then added to the cultures of the non-irradiated BEP2D cells together with or without miR-7-5p inhibitor. [score:3]
Our data revealed that exosomal miR-7-5p induced autophagy in the non -targeted bystander cells. [score:3]
These data indicated that the exosomes mediated the transfer of miR-7-5p from the irradiated cells to the bystander cells where miR-7-5p mediates the non-target effects. [score:3]
Our data demonstrated that the bystander autophagy induced by exosomes could be effectively attenuated by miR-7-5p inhibitor. [score:3]
Panel D: AKT and p-AKT protein levels were detected by western blotting analysis in BEP2D cells transfected with miR-7-5p mimic, or miR-7-5p mimic plus miR-7-5p inhibitor, or miR-NC for 24 hr. [score:3]
For the immunoblotting (western blotting) analyses, BEP2D cells were transfected with miR-7-5p mimic, miR-7-5p inhibitor or miR-NC, 24 hr later, the total proteins were isolated. [score:3]
Panel G: mTOR and p-mTOR protein levels were detected by western blotting analysis in BEP2D cells transfected with miR-7-5p mimic, or miR-7-5p mimic plus miR-7-5p inhibitor or miR-NC for 24 hr. [score:3]
We paid special attention to miR-7-5p after further validation of its increased expression in the exosomes from irradiated cells with RT-qPCR analysis. [score:3]
Panel A: Expression of the autophagy marker LC3B was detected by Western blotting analysis in BEP2D cells 24 hr after transfected with 50 nM of miR-NC or miR-7-5p mimic. [score:3]
The bioinformatic analysis suggests that EGFR is a potential target of miR-7-5p. [score:3]
Panel B: EGFR protein level was detected by western blotting analysis in BEP2D cells transfected with miR-7-5p mimic, or miR-7-5p mimic plus miR-7-5p inhibitor, or miR-NC for 24 hr. [score:3]
Although previous report has shown that the exosomal RNA from the irradiated cells induced the bystander effects of DNA/chromosomal damage 38, and our bioinformatics analysis also implied that apoptosis pathway and cell cycle pathway were included in the biological pathways of the predicted targets genes of the IR -induced exosomal miRNAs, miR-7-5p was not shown the effects of inducing DNA damage, cell cycle change and apoptosis in present study. [score:3]
BEP2D cells were treated with miR-7-5p or miR-NC in the presence or absence of lysosomal inhibitor NH [4]Cl for 24 hr, LC3B and P62 proteins were detected by Western blotting analysis. [score:3]
The effects of miR-7-5p on the expression of autophagy related proteins. [score:3]
It was previously reported that miR-7-5p suppresses cell proliferation and induces apoptosis of cancer cells 49 50. [score:3]
Identification of EGFR signaling as the downstream targets of miR-7-5p. [score:3]
Panel C: The change of exosomal miR-7-5p expression at 4 h post-2 Gy irradiation was confirmed by RT-qPCR. [score:3]
Interestingly, the expression level of miR-7-5p has different change trend in secreted exosomes and intracellular after IR treatment (Fig. 1C,D). [score:3]
How to cite this article: Song, M. et al. Bystander autophagy mediated by radiation-inducible exosomal miR-7-5p in non -targeted human bronchial epithelial cells. [score:3]
[#] p < 0.01: IR-exosome + miR-7-5p inhibitor vs IR-exosome. [score:3]
It is valuable to pay more attention to the mechanism how ionizing radiation influences the choice and package of some special exosomal molecules such as miR-7-5p, and which may play a role in the processing of bystander effects in non -targeted cells. [score:3]
Tazawa et al. showed that a genetically engineered oncolytic adenovirus induced autophagic cell death via regulating E2F1-miR-7-EGFR axis in human cancer cells 51. [score:2]
We have further proved that the phosporylation level of phosphor-Akt and phosphor-mTOR, both of which participate in autophagy regulation, notably decreased when the BEP2D cells were transfected with miR-7-5p mimics (Fig. 6D,E for phosphor-AKT-s473, Fig. 6G,H for phosphor-mTOR-s2448). [score:2]
miR-7-5p induces autophagy through regulating the EGFR signal pathway. [score:2]
Although the level of miRNA-7-5p increased more than five times in exosomes collected from the irradiated cells’ culture medium (Fig. 1C and supplementary table 3), the intracellular miRNA-7-5p levels decreased in the irradiated cells (Fig. 1D). [score:1]
Bystander autophagy induced by the exosomal miR-7-5p in recipient BEP2D cells. [score:1]
BPE2D cells were harvested 24 h after transfecting miR-7-5p mimic or miR-NC, and total RNA was extracted using TRlzol reagent. [score:1]
However, our results showed that there was not significant difference on the proportion of apoptosis (Supplementary Fig. 2A,B) and cell cycle distribution (Supplementary Fig. 2C) between miR-7-5p mimics treated BEP2D cells and control cells. [score:1]
Panel G: Densitometric quantitation of western blotting analysis of LC3B protein expression represented in panel F. * p < 0.01 as compared with untreated cells; [#] p < 0.05 as compared with miR-7-5p mimic treated cells. [score:1]
Panel C: BEP2D cells were co -transfected with miR-7-5p mimic or miR-NC and pEGFP-C1-LC3 vector, respectively. [score:1]
Panel B: RT-qPCR estimated the level of miR-7-5p in the non-irradiated cells upon uptake of exogenous exosomes from irradiated cells (IR-exo) or non-irradiated cells (Con-exo). [score:1]
miR-7-5p mimic or the control miR-NC were co -transfected with GFP-LC3 fusion vector into BEP2D cells, repectively. [score:1]
BPE2D cells were transfected with 50 nM of miR-7-5p mimic or miR-NC, 24 h later, the transfected cells were collected and washed with PBS once and re-suspended with 75% ethyl alcohol for fixing more than 12 hr at 4 °C. [score:1]
Among them, the increase of miR-7-5p and miR-1246 is sustained from 4 hr to 8 hr after irradiation. [score:1]
Induction of autophagy by miR-7-5p mimic. [score:1]
BPE2D cells were transfected with 50 nM of miR-7-5p mimic or miR-NC, 24 h later, the transfected cells were planted in 96-well plates at a density of 5 × 10 [3] cells/well. [score:1]
To determined whether EGFR signal pathway also involves in miR-7-5p mediated autophagy in BEP2D cells, the effect of miR-7-5p on EGFR expression was investigated. [score:1]
The biological effect of exosomal miRNA-7-5p on bystander cells attracts our attention. [score:1]
Therefore, the accumulation of LC3B after miR-7-5p treatment was due to the enhanced formation of vesicles. [score:1]
Induction of autophagy by miR-7-5p in BEP2D cells. [score:1]
In present study, we have revealed that the exosomal miR-7-5p from the irradiated cells mediated a bystander autophagy in the non-irradiated human bronchial epithelial BEP2D cells. [score:1]
Our results suggest that the exosomal miR-7-5p induces autophagy in BEP2D cells associating with the EGFR/Akt/mTOR signaling axis. [score:1]
Exogenous exosomes uptake and detection of miR-7-5p in the recipient cells. [score:1]
For apoptosis detection, BPE2D cells were transfected with 50 nM of miR-7-5p mimic or miR-NC, 24 hr later, the transfected cells were collected and stained with Alexa Fluor 488 Annexin V and PI for 5 minutes at room temperature in the dark according to the protocol provided by the manufacturer of Apoptosis Detection Kit (DOJINDO, Japan). [score:1]
As shown in Fig. 2C,D, the number of GFP-LC3 puncta were significanlly increased in miR-7-5p mimics transfected BEP2D cells in compare with the negative control cells. [score:1]
miR-7-5p mediates the autophagy induction by the exosomes from irradiated cells. [score:1]
Panel H: Densitometric quantitation of western blotting analysis of P62 protein expression represented in panel F. * p < 0.05 as compared with untreated cells; [#] p < 0.05 as compared with miR-7-5p mimic treated cells. [score:1]
[1 to 20 of 74 sentences]
12
[+] score: 180
Overexpression of miR-7 inhibited EGFR expression in A549 cells. [score:7]
We previously reported miR-7 as a key tumor suppressor in NSCLC that could suppress cell proliferation, induce apoptosis, inhibit cancer migration and reduce tumorigenicity in A549 adenocarcinomic human alveolar basal cells (23). [score:7]
In NSCLC, miR-7 has been reported to suppress tumorigenesis by targeting a number of important proto-oncogenes, including EGFR, IRS1 (insulin receptor substrate 1), IRS2, RAF1 (v-raf-1 murine leukemia viral oncogene homologue 1), and PAK1 (p21/CDC42/RAC1-activated kinase 1), and by inhibiting EGFR/AKT pathway activation (30– 33). [score:7]
Additionally, inhibition of cell proliferation is associated with EGFR downregulation following transfection of miR-7 into NSCLC cells. [score:6]
The primer sequences for U6 and miR-7 are listed in Table I. The human miR-7 mimics (miR-7) (dsRNA oligonucleotides), miR-7 inhibitor (single-stranded chemically modified oligonucleotides), negative control mimic (miR-NC), and negative control inhibitor (Ctrl inhibitor) were purchased from RiboBio (Guangzhou RiboBio Co. [score:6]
Lee et al (38) reported that the overexpression of miR-7 increases the radiosensitivity of various human cancers by directly suppressing the activation of EGFR-PI3K-AKT. [score:6]
By contrast, the miR-7 inhibitor increased EGFR expression in PTX -treated cells. [score:5]
MiR-7 is a putative tumor suppressor in a large range of solid tumors, and is often downregulated in NSCLC (29). [score:5]
miR-7 was overexpressed in A549 cells by transfection with miR-7 mimics, which resulted in the inhibition of A549 cell proliferation, especially after 72 h (Fig. 2A and B). [score:5]
It was observed that a higher expression of miR-7 in 95D cells correlated with a higher sensitivity of this cell line to PTX, strongly suggesting a positive association between PTX sensitivity and endogenous miR-7 expression (Fig. 1B). [score:5]
Conversely, the inhibition of miR-7 was associated with an increased mRNA and protein expression of EGFR in 95D cells treated with PTX (Fig. 4C). [score:5]
As expected, the combined treatment of 95D cells with an miR-7 inhibitor and PTX restored the PTX -mediated suppression of cell viability and apoptosis (Fig. 3C and D). [score:5]
Primers for GAPDH and EGFR were designed using Primer Express [®] (Invitrogen Life Technologies) and are listed in Table I. Proteins were extracted from A549 or 95D cells following transfection with miR-7, miR-NC, miR-7 inhibitor, or Ctrl inhibitor for 48 h using SDS lysis buffer (P0013G, Beyotime, Shanghai China). [score:5]
In the present study, miR-7 expression was shown to be frequently downregulated in these NSCLC cell lines as compared with the normal lung epithelial cell line (HBE). [score:5]
A549 or 95D cells were seeded in 24-well plates, incubated for 24 h, and then transfected with miR-7, miR-NC, miR-7 inhibitor, or Ctrl inhibitor for a further 24 h. Following transfection, the cells were treated with PTX (20 nM) for 24 h and then collected. [score:5]
To the best of our knowledge, this study provides the first evidence of the potential utility of miR-7 as a sensitizer in PTX therapy for NSCLC and thus provides a novel molecular target for therapeutic development. [score:4]
MiR-7 inhibitor was used to knock down endogenous miR-7 (Fig. 3A). [score:4]
It was hypothesized that the upregulation of miR-7 increases the sensitivity of NSCLC cells to PTX. [score:4]
A549 cells, a line with lower miR-7 expression, was selected as an in vitro mo del. [score:3]
These data indicate that miR-7 -mediated enhancement of A549 chemosensitivity to PTX may occur through EGFR targeting. [score:3]
It was first shown that PTX sensitivity is dependent on endogenous miR-7 expression in NSCLC cell lines. [score:3]
An inverse correlation was observed between the endogenous miR-7 expression levels and PTX sensitivities. [score:3]
Our previous screen detected miR-7 expression in these cell lines (24). [score:3]
The interindividual variability of miR-7 expression was confirmed (data not shown). [score:3]
PTX-sensitivity of NSCLC cells is dependent on endogenous miR-7 expression. [score:3]
Cells were seeded in 24-well plates (5×10 [4] cells/well) for 24 h. When the cells were 30–50% confluent, they were transfected with miR-7 or miR-7 inhibitor (50 nmol final concentration) using Lipofectamine [®] 2000 (Invitrogen Life Technologies). [score:3]
It was also found that miR-7 expression varied in different cell lines, similar to the variation observed in PTX sensitivity. [score:3]
These data showed that the overexpression of miR-7 enabled reduction of the dose of PTX used for treatment. [score:3]
Following transfection with the miR-7 or control inhibitor, 95D cells were treated with PTX at various concentrations. [score:3]
In comparison to PTX treatment alone, PTX and miR-7 overexpression induced apoptosis in A549 cells (11.57 vs. [score:3]
Combined treatment with PTX and miR-7 mimics reduced EGFR expression at the mRNA and protein levels. [score:3]
The present study has focused on EGFR since it was previously identified as a critical target of miR-7 in many solid tumors, including NSCLC, and it contributes to tumor progression and poor prognosis (30, 32, 34). [score:3]
Pre-treatment with miR-7 mimics enhanced PTX -mediated suppression of A549 cell viability, most notably at lower doses of PTX. [score:3]
Therefore, miR-7 expression sensitized the cells to PTX -induced apoptosis, thus enhancing its cytotoxic effect. [score:3]
The expression of EGFR was then examined in A549 cells treated with miR-7 mimics, PTX, or both, by qPCR and western blotting. [score:3]
Overexpression of miR-7 sensitized NSCLC cells to PTX, mainly by promoting PTX -induced cell apoptosis. [score:3]
In comparison to PTX plus miR-NC, the cells treated with PTX following pretreatment with miR-7 mimics exhibited a significantly lower EGFR expression, at the mRNA and protein level (Fig. 4B). [score:3]
Overexpression of miR-7 sensitizes NSCLC cells to PTX. [score:3]
These findings indicated that PTX sensitivity in NSCLC cell lines is dependent on endogenous miR-7 expression. [score:3]
of the present study have shown that the expression of miR-7 varied in different NSCLC cell lines, since these cell lines originated from different individuals. [score:3]
Inhibition of miR-7 promotes NSCLC cell resistance to PTX. [score:3]
The identification of miR-7 as a potential sensitizer in PTX therapy provides a fundamental basis for new approaches in the development of novel and PTX therapeutic strategies. [score:2]
Given the function of EGFR in NSCLC development and apoptosis, it was hypothesized that EGFR is involved in miR-7 -mediated NSCLC cell sensitivity to PTX. [score:2]
Given that our previous study demonstrated the importance of miR-7 in NSCLC pathogenesis, the present study hypothesized that miR-7 plays a crucial role in regulating NSCLC sensitivity to PTX. [score:2]
In summary, our findings have improved the understanding of the role of miR-7 in promoting chemosensitivity of cancer cells to PTX, and has enhanced existing knowledge on miRNAs in modulating chemotherapeutic efficacy. [score:1]
This finding suggests that miR-7 may allow for a reduction in the PTX doses used in chemotherapy and help address the problem of therapeutic resistance in NSCLC. [score:1]
To investigate the role of miR-7 in PTX sensitivity, the high miR-7 -expressing PTX-sensitive NSCLC cell line, 95D, was used as an in vitro mo del. [score:1]
The present study has demonstrated that EGFR functions in miR-7-enhanced chemosensitivity to PTX, and a similar signaling pathway downstream of EGFR may be involved. [score:1]
Therefore, both the gain- and loss-of-function experiments indicated an important function for miR-7 in the PTX sensitivity of NSCLC cells. [score:1]
It was observed that 20 nM PTX combined with miR-7 mimics was as effective as 80 nM PTX treatment alone (Fig. 2C). [score:1]
miR-7-enhanced PTX sensitivity in NSCLC cells is mediated by EGFR. [score:1]
In the present study, miR-7 was identified as an important molecule in PTX treatment. [score:1]
These data indicate that EGFR may mediate the molecular mechanism of NSCLC sensitization to PTX by miR-7. Accumulating reports have indicated that chemotherapeutic treatments alter miRNA profiles in cancer (15, 25, 26). [score:1]
[1 to 20 of 53 sentences]
13
[+] score: 151
For miR-7 regulated expression of TINCR, TINCR full length of transcript (wild-type, miR-7 target region deletion, miR-7 target region mutation) was fused to luciferase, and co -transfected MCF-7 or MDA-MB-468 cells with miR-7a/b. [score:9]
a The relative expression of miR-7 in response to TINCR knockdown or miR-7 specific inhibitor was determined by real-time PCR in both MCF-7 and MDA-MB-468 cells. [score:6]
Consistent with previous results, TINCR-knockdown significantly suppressed breast cancer cell proliferation, while simultaneous inhibition of miR-7 in this setting almost abolished this effect (Fig. 6b, c). [score:6]
Consistent with these observations, our data suggested that inhibitory effect on KLF4 expression of miR-7 was significantly mitigated by TINCR in breast cancer via competitive mechanism. [score:5]
Several studies implied that KLF4 was the potential target of miR-7. Along this line, here we further investigated the potential that TINCR modulated KLF4 expression via competing with miR-7. The putative target site in 3’UTR region of KLF4 aligned with miR-7 seed region based on the micrRNA. [score:5]
Our data further experimentally confirmed the direct interaction between miR-7 and TINCR, which underlaid its competitive regulation of miR-7 target genes. [score:5]
miR-7 inhibition abrogated TINCR-silencing elicited tumor suppressive effect. [score:5]
Most notably, several studies indicated that miR-7 functioned as tumor suppressor gene via direct regulation of KLF4. [score:5]
This inhibitory effect was readily reversed by co-introduction of either TINCR or miR-7 specific inhibitor (Fig. 5g). [score:5]
Our data suggested a crucial role of TINCR-miR-7-KLF4 axis in human breast cancer and up-regulation of ceRNA TINCR by SP1 contributes to tumorigenesis in breast cancer. [score:4]
Moreover, miR-7 was shown to arrest cell cycle in G1 phase by directly targeting CCNE1 in human hepatocellular carcinoma cells [27]. [score:4]
We employed LncRNABase online algorithm to predict the candidate miR with the potential to directly compete with TINCR, and identified miR-7 as the top one in the putative targets list. [score:4]
For instance, miR-7 has been demonstrated to function as a tumor-suppressor gene in pancreatic carcinoma via regulation of ILF2 [40]. [score:4]
MiR-7 also suppressed cell proliferation and induced apoptosis of breast cancer cells predominately by targeting REGγ [25]. [score:4]
The endogenous expression of miR-7 in response to TINCR knockdown was analyzed in both MCF-7 and MDA-MB-468 cells. [score:4]
On the other hand, inhibition of miR-7 was shown to promote angiogenesis in human umbilical vein endothelial cells by up -regulating VEGF via KLF4 [22]. [score:4]
Either deletion or mutation introduced into the suspected regions of TINCR abolished miR-7 -inhibited luciferase activities (Fig. 5b, c, d, e). [score:4]
Chang et al. reported that miR-7 inhibited the tumorigenesis and stemness of prostate cancer via repressing KLF4/PI3K/Akt/p21 pathway [41]. [score:3]
Exogenous scramble, miR-7 a/b, TINCR or anti-miR-7 were transfected into MCF-7 (left) and MDA-MB-468 cells in combination as indicated, the relative expression of KLF4 was determined by immunoblotting. [score:3]
Okuda et al. reported that miR-7 capable of suppressing brain metastasis of breast cancer stem-like cells by modulating KLF4 [23]. [score:3]
Consistently, the transcripts of KLF4 were decreased in response to miR-7a/b, and subsequently restored by ectopic TINCR or miR-7 inhibitor treatment (Fig. 5h). [score:3]
f The putative target sites of miR-7 in KLF4 3’UTR by microRNA online tool. [score:3]
The expression status of SP1-TINCR-miR-7-KLF4 was further characterized in xenograft tumor at both transcriptional and translational level (Fig. 5i), which definitely consolidated our in vitro observations. [score:3]
Similarly, the reduction in colony formation capacity elicited by TINCR silencing was readily restored while miR-7 was specifically inhibited (Fig. 6d). [score:3]
In line with this notion, in this study we performed bioinformatic analysis to identify miR-7 as one of TINCR targets. [score:3]
g miR-7 negatively modulated KLF4 expression, which was antagonized by TINCR. [score:3]
High level of TINCR in turn competed with miR-7, and stabilized and promoted KLF4 expression, which consequently contributed to the oncogenic activity of TINCR. [score:3]
However, the opposite conclusion emerged as well in especially lung cancer [39], suggested both oncogene and tumor suppressor roles of miR-7 probably in an organ context -dependent manner. [score:3]
As shown in Fig.   6a, TINCR-silencing induced more than 3-fold increase of miR-7, which was completely abrogated by co-treatment with miR-7 inhibitor. [score:3]
Mechanistically, TINCR modulated KLF4 expression via competing with miR-7, which consequently contributed to its oncogenic potential. [score:3]
Most importantly, our data suggested that either specific inhibition of TINCR or complement with miR-7 likely held great promise for breast cancer therapeutics. [score:3]
The candidate target genes of miR-7 involving in tumor biology have been extensively identified and systematically reviewed by Gu et al. [20]. [score:3]
TINCR functioned as endogenous competing lncRNA of miR-7 and involved in KLF4 regulation. [score:2]
Fig. 5TINCR functioned as endogenous competing lncRNA against miR-7 to regulate KLF4. [score:2]
Our previous data suggested that TINCR functioned as competing endogenous RNA (ceRNA) to compete with miR-7 in regulation of KLF4. [score:2]
MiR-7 is conventionally considered as a tumor suppressor miRNA in variety of human malignancies including breast cancer [24], brain cancer [21], liver cancer [38], colon cancer [26]. [score:2]
MiR-7 inhibition severely compromised TINCR silencing-elicited tumor repressive effects. [score:2]
We further experimentally validated the putative binding sites of miR-7 on TINCR transcript. [score:1]
a The prediction of miR-7 seeding region in TINCR transcript using Starbase online tool. [score:1]
Our results clearly demonstrated the critical role of TINCR in tumorigenesis and metastasis-related malignant behavior in breast cancer, and predominant role of miR-7 in mediating this effect. [score:1]
The exogenous introduction of miR-7 caused about 75% reduction in MDA-MB-468 and 60% reduction in MCF-7 of TINCR-fused luciferase activity (Fig. 5b, c). [score:1]
TINCR miR-7 KLF4 Breast cancer Long non-coding RNA Breast cancer is one of the most common malignancies in women [1]. [score:1]
In line with previous observations, the direct binding of miR-7 with TINCR was experimentally validated in our luciferase reporter assay. [score:1]
The alignment between TINCR and miR-7 was shown in Fig.   5a. [score:1]
Our data uncovered a crucial role of TINCR-miR-7-KLF4 axis in human breast cancer. [score:1]
Our data unambiguously demonstrated that miR-7 predominately involved in oncogenic activity of TINCR in breast cancer. [score:1]
b, c Luciferase reporter assay was performed to validate the regulatory effect of miR-7 on TINCR. [score:1]
d, e Luciferase reporter assay was performed to validate the regulatory effect of miR-7 on TINCR. [score:1]
Range of investigations have uncovered the important roles of miR-7 in human malignancies with increased list of target genes have been identified [20– 27]. [score:1]
Taken together, our data suggested that TINCR might function as molecular sponge of miR-7, which eventually contributed to its oncogenic activity. [score:1]
[1 to 20 of 50 sentences]
14
[+] score: 140
These results all indicated that the signals regulated E2 -induced miR-7 expression through EGFR, and the inhibition or suppression of ER -mediated signaling suppressed miR-7 and subsequently increased EGFR mRNA expression in ER -positive breast carcinoma cells. [score:12]
In our present study, we focused on the change in EGFR expression because miR-7 was reported to inhibit EGFR expression and subsequently suppress cell proliferation in several human carcinoma cell lines [19- 21]. [score:9]
E2-depletion from culture media of MCF-7 cells suppressed miR-7 expression and increased EGFR expression. [score:7]
The expression of miR-7 was up-regulated 2.94-fold by E2 treatment. [score:6]
indicated EGFR as one of the target genes of miR-7. Therefore, in this study, we focused on the correlation between EGFR mRNA and miR-7 expression. [score:5]
We first screened the miRNA expression profiles induced by 17β-Estradiol (E2) using RT [2] miRNA PCR Array in the ER -positive breast carcinoma cell line MCF-7. We identified miR-7 as the important miRNA associated with estrogen actions in these cells and further examined the changes of estrogen -dependent EGFR expression by miR-7 in ER -positive or -negative breast carcinoma cell lines including MCF-7. We also evaluated the correlation between miR-7 and EGFR expression in breast carcinoma cells derived from 21 patients using laser capture microdissection combined with quantitative reverse transcriptase-PCR. [score:5]
Analysis of potential target genes of miR-7 was evaluated using TargetScan, Microcosm Targets, and microRNA. [score:5]
miR-7 was reported to suppress epidermal growth factor receptor (EGFR) expression in several human malignancies. [score:5]
Other EGFR family such as HER2, HER3, and HER4 were not potential target gene of miR-7 in three target prediction algorisms described above. [score:5]
These results suggest that miR-7 may play a role in the development of resistance to endocrine therapy in breast cancer patients through regulating EGFR expression of carcinoma cells. [score:5]
The results of our study suggest that miR-7 may play central roles in the development of resistance to endocrine therapy in breast cancer patients through regulating EGFR expression of cancer cells. [score:5]
These results suggested that an up-regulation of miR-7 by E2 was due to the splicing of hnRNP K, which was also increased by E2 treatment in MCF-7 cells [18]. [score:4]
The miR-7 expression level was significantly decreased by the depletion of E2 in MCF-7 cells (Fig. 3B). [score:3]
In this study, we also examined the expression of miR-7 in T-47D cells. [score:3]
Among 17 miRNAs induced by estradiol treatment, only miR-7 expression was significantly decreased by subsequent ICI treatment. [score:3]
Expression of miR-7 in breast cancer tissues. [score:3]
Figure 4 (A) Alterations of miR-7 expression by depletion of E2 in T-47D. [score:3]
Quantitative RT-PCR of miR-7. Search for putative targets of miR-7. miR-7 transfection. [score:3]
Among these 17 miRNAs induced by E2, only mir-7 was significantly decreased in its expression by the treatment of ICI compound (Table 2). [score:3]
MiR-7 was also reported to regulate IGF-1R expression in tongue squamous cell carcinoma cells [27]. [score:3]
In our present study, among 17 miRNAs induced by E2 treatment, ICI treatment significantly decreased the expression of miR-7 alone. [score:3]
Transfection of miR-7 significantly suppressed EGFR mRNA levels in MCF-7 cells. [score:3]
In T-47D cells, the expression levels of miR-7 (Fig. 4A) and EGFR mRNA (Fig. 4B) were increased by E2 (10nM) treatment and depletion of E2, respectively. [score:3]
Therefore, further examinations including the alterations of the miR-7 expression in those who received neoadjuvant endocrine therapy are required to clarify the roles of miR-7 in ER and EGFR signaling. [score:3]
do) to compute miR-7 target predictions. [score:3]
No significant correlations were detected between the levels of miR-7 expression and ER (Fig. 5A) or PR (Fig. 5B) LIs in 21 ER -positive breast carcinoma cases. [score:3]
The miR-7 expression was increased by E2 treatment in T-47D cells but the change did not reach statistical significance (p=0.0508). [score:3]
Effects of miR-7 on EGFR mRNA expression in MCF-7. Effects of E2 on EGFR mRNA in breast carcinoma cells. [score:3]
Levels of miR-7 expression were normalized using U6 probe. [score:3]
Therefore, in this study, we focused on expression of miR-7 and further examined biological feature of miR-7 as an estrogen inducible miRNA in breast carcinoma cells. [score:3]
Therefore, the induction of miR-7 by E2 treatment through the hnRNP K is considered to be influenced by the expression patterns of ER subtypes in the cells. [score:2]
Figure 5 MiR-7 expression in breast cancer tissues. [score:2]
Correlation between miR-7 and (C) ER or (D) EGFR mRNA in twenty fresh frozen breast carcinoma tissues. [score:1]
The culture medium was exchanged with miR-7 on three days after the first transfection. [score:1]
MiR-7 belongs to intronic miRNA and is present in an intron of hnRNP K (heterogeneous nuclear ribonucleic protein K) in both insects and mammals [16, 17]. [score:1]
There were no significant correlations between miR-7 and ER (Fig. 5C) or EGFR (Fig. 5D) mRNA detected in carcinoma cells isolated by LCM from 20 ER -positive fresh frozen breast carcinoma tissues in this study. [score:1]
However, the correlation between miR-7 and ER or EGFR was not detected in our in vitro analysis of the tumor samples of breast cancer patients, but none of them received endocrine therapy before surgery. [score:1]
EGFR mRNA levels in MCF-7 transfected with miR-7 for five days. [score:1]
Figure 2 Effects of miR-7 upon EGFR mRNA abundance in MCF-7 cell line. [score:1]
Correlation between miR-7 and (A) ER or (B) PR LIs (%) in fourteen ER -positive FFPE breast carcinoma tissues. [score:1]
Transient transfections were performed with 10 nM miR-7 (has-miR-7; 5’-UGGAAGACUAGUGAUUUUGUUGU-3’) using G-fectin (Genolution Pharmaceutical, Seoul, Korea). [score:1]
[1 to 20 of 41 sentences]
15
[+] score: 133
Bioinformatics analysis results indicated that IGF-1R could be a target of miR-7. and luciferase reporter assays showed that miR-7 modulated IGF-1R expression by directly targeting the binding site within the 3′-untranslated region. [score:9]
To further clarify the molecular mechanisms of miR-7 in tumor suppression, we used a target prediction program, TargetScan, to predict the putative targets of miR-7. The 3 [′]-UTR of IGF-1R mRNA contained a complementary site for miR-7 (Figure  3A). [score:9]
IGF-1R as a direct target of miR-7. IGF-1R downregulation inhibits glioma cell growth and glycometabolism in vitro. [score:9]
Forced expression of miR-7 or IGF-1R knockdown inhibited colony formation and glucose metabolic capabilities of glioma cells in vitro and decreased the p-Akt expression level. [score:8]
Bioinformatics analysis results indicated that IGF-1R could be a target of miR-7. and luciferase reporter assays showed that miR-7 modulated IGF-1R expression by directly targeting the binding site within the 3′-UTR. [score:7]
Upregulation of miR-7 inhibited cellular growth and glucose metabolism. [score:6]
In this study, we used miRNA expression data downloaded from The Cancer Genome Atlas (TCGA) database to examine the effects of miR-7 expression. [score:5]
This study provides the first evidence that miR-7, as a regulator of AKT pathway, serves a critical function in cellular growth and glucose metabolism by directly targeting IGF-1R. [score:5]
We confirmed that miR-7 served a critical function in cellular growth and metabolism by directly targeting insulin-like growth factor 1 receptor (IGF-1R), which is an upstream regulator of Akt [18, 19]. [score:5]
miR-7 was downregulated in human glioma tissues based on TCGA database. [score:4]
A previous study showed that some important functional molecules, such as epidermal growth factor receptor (EGFR) and focal adhesion kinase, are the direct target genes of miR-7 [16, 17]. [score:4]
Consistent with previous reports, miR-7 was downregulated in human glioma tissues in the current study [17]. [score:4]
This study provides the first evidence that miR-7 inhibits cellular growth and glucose metabolism in gliomas, at least partially, by regulating the IGF-1R/Akt signaling pathway. [score:4]
Figure 3 IGF-1R is a direct target of miR-7 in glioma cells. [score:4]
This study was conducted to detect the function of miR-7 targeting insulin-like growth factor 1 receptor (IGF-1R), which is an upstream regulator of Akt. [score:4]
Cell tablet assays revealed that miR-7 overexpression can significantly inhibit the number of colonies (Figure  2B and C). [score:4]
Similar to the treatment with miR-7, the ability of colony formation and glucose metabolism decreased after IGF-1R inhibition (Figure  4A, B, and C). [score:3]
miR-7 inhibits viability, invasiveness, and metastasis in glioma cells. [score:3]
In TCGA database, the miR-7 expression in the GBM group was significantly lower than that in the normal brain tissue group (Figure  1). [score:3]
Figure 2 miR-7 suppresses glioma cellsgrowth and glycometabolismin vitro. [score:3]
miR-7 expression and function in glioma cells in vitro. [score:3]
Upregulation of miR-7 weakened the glycolysis and glycolytic abilities of glioma cells compared with those of the control (Figure  2D and E). [score:3]
was used to measure the microRNA-7 (miR-7) expression level, and was performed to detect protein expression in U87 and U251 cells. [score:3]
Thus, miR-7 could directly regulate the IGF-1R/Akt signaling pathway in glioma cells. [score:3]
First, the miR-7 expression level in the cells transfected with miR-7 mimics was determined by real-time PCR (Figure  2A). [score:3]
Luciferase activity assays were conducted to confirm whether IGF-1R is a putative target of miR-7. The wild- or mutant-type luciferase reporter plasmids were constructed and co -transfected with miR-7 mimics or scrambled into glioma cells. [score:2]
Lu also reported that miR-7 exhibits low expression compared with that in normal brain tissues [15]. [score:2]
Reporter assay results revealed that miR-7 overexpression led to a significant decrease in the luciferase activity of pGL3-WT-IGF-1R without changing that of pGL3-MUT-IGF-1R 3 [′]-UTR (Figure  3B). [score:2]
eu/vs/13000_2014_211 Glioblastoma multiforme miR-7 IGF-1R AKT Malignant glioma is the most common and lethal primary brain tumor in adults. [score:1]
Therefore, miR-7 is a promising molecular drug for glioma treatment. [score:1]
Luciferase reporter assay was used to identify the mechanism of IGF-1R and miR-7 regulation. [score:1]
Figure 1 Clinical significance of miR-7 in glioma cases and normal brain tissues. [score:1]
After 72 h of miR-7 mimic processing, the cells were washed thrice with phosphate-buffered saline (PBS), and fresh broth was supplied. [score:1]
The mutant-type reporter was generated by deleting the binding site of miR-7 “GUCUUCC. [score:1]
All miRNA mimics were chemically synthesized and purified by GenePharma (Shanghai, China) based on the following sequences: has-miR-7 mimic: 5 [′]-UGGAAGACUAGUGAUUUUGUUGU-3 [′], miR -negative control (miR-NC):5′-UUCUCCGAACGUGUCCGGAGAATT-3′. [score:1]
To assess the function of miR-7 in glucose metabolism, we performed a glycolysis stress test. [score:1]
” The cells were co -transfected with wild-type (pGL3-WT-IGF-1R-3′-UTR) or mutant-type (pGL3-MUT-IGF-1R-3′-UTR) luciferase reports and miR-7 mimic or miR-NC. [score:1]
[1 to 20 of 37 sentences]
16
[+] score: 123
Putative miRNA sponges Target miRNAs Hypothesized miRNA functioncircRNA Sry (Hansen et al., 2013b) miR-138Tumor suppressor (Liu et al., 2016)ciRS-7 (Hansen et al., 2013b) miR-7Tumor suppressor (Kalinowski et al., 2014) Oncogene (Hansen et al., 2013a)circHIPK3 (Zheng et al., 2016) miR-124Tumor suppressor (Shi et al., 2013)cirITCH (Li F. et al., 2015) miR-7, miR-20aTumor suppressor (Kalinowski et al., 2014) Oncogene (Pesta et al., 2010)circTCF25 (Zhong et al., 2016) miR-103a-3p miR-107Tumor suppressor (Zhong et al., 2016) Tumor suppressor (Zhong et al., 2016)circPVT1 (Panda et al., 2016) let-7Cell senescence suppressor (Panda et al., 2016) Tumor suppressor (Boyerinas et al., 2010) Figure 2 circRNA sponges. [score:19]
Up-regulation of miR-7 in the AD brain, due to a deficiency in, down-regulates several AD-relevant mRNA targets and their expression, including the ubiquitin conjugase (UBE2A) protein. [score:11]
miR-7 can directly downregulate oncogenes, including epidermal growth factor receptor (EGFR), P21-activated kinase-1 (Pak1), insulin receptor substrate-1 (IRS-1), phosphoinositide 3-kinase catalytic subunit delta (PIK3CD), and mammalian target of rapamycin (mTOR) (Dong et al., 2017). [score:7]
In hepatocellular cancer (HCC), was over-expressed in cancer tissues with the corresponding miR-7 expression levels down-regulated when compared with adjacent non-tumor tissues (Yu et al., 2016). [score:7]
Other researchers have shown that overexpression of in cancer tissues permitted inhibition of miR-7 and subsequent activation of EGFR and RAF1 oncogenes, again, strengthening the argument that circRNAs play a role in cancer initiation and development (Weng et al., 2017). [score:6]
microRNA-7 inhibits the epidermal growth factor receptor and the akt pathway and is down-regulated in glioblastoma. [score:6]
The most studied miRNA in circRNA research is miR-7, which regulates a variety of functions in disease and carcinogenesis such as cell development, proliferation and apoptosis (Li and Rana, 2014; Zhao et al., 2015). [score:5]
The circular RNA Cdr1as act as an oncogene in hepatocellular carcinoma through targeting miR-7 EXPRESSION. [score:5]
MicroRNA-7, a homeobox D10 target, inhibits p21-activated kinase 1 and regulates its functions. [score:5]
In diabetic mouse mo dels, cirRS-7 overexpression has been shown to improve insulin secretion by inhibiting miR-7 function in pancreatic islet cells (Memczak et al., 2013; Xu et al., 2015). [score:5]
Similarly, it has also been shown that overexpression of inhibits miR-7 function in islet β cells, which in turn improves insulin secretion (Xu et al., 2015). [score:5]
As ciRs-7 is a known miR-7 sponge, further investigations, which included knockdown of ciRs-7 and overexpression of miR-7, found that acts as an oncogene partly through targeting miR-7 in HCC. [score:4]
One of the most studied miRNAs in the ceRNA network is miR-7. Emerging evidence indicates that cirs-7 regulates miR-7 expression. [score:4]
The potential gene targets for miR-7 were identified from bioinformatics analyses and include Myrip (regulates insulin granule secretion) and Pax6 (enhances insulin transcription). [score:4]
The circular RNA Cdr1as, via miR-7 and its targets, regulates insulin transcription and secretion in islet cells. [score:4]
miRNA-7-5p inhibits melanoma cell migration and invasion. [score:3]
EGFR promotes lung tumorigenesis by activating miR-7 through a Ras/ERK/Myc pathway that targets the Ets2 transcriptional repressor ERF. [score:3]
Xu et al. have shown overexpression of miR-7 in transgenic mouse β cells results in diabetes. [score:3]
microRNA-7: a tumor suppressor miRNA with therapeutic potential. [score:3]
Inhibits miR-7 function in islet β cells, which in turn improves insulin secretion (Lukiw, 2013). [score:3]
Regulation of epidermal growth factor receptor signaling and erlotinib sensitivity in head and neck cancer cells by miR-7. PLoS ONE 7: e47067. [score:2]
MicroRNA-7: a promising new target in cancer therapy. [score:2]
Cerebellar degeneration-related protein 1 antisense RNA (CDR1as), also known as circular RNA sponge for miR-7 (ciRS-7), binds to miR-7 and regulates its function, providing the first evidence that circRNAs behave as miRNA sponges (Hansen et al., 2013a). [score:2]
This is further supported by research from Lukiw et al., who detected a mis-regulated miR-7-circRNA system in the sporadic (AD) hippocampal CA1 region of the brain (Lukiw, 2013). [score:2]
Circular RNA and miR-7 in cancer. [score:1]
A recently discovered circRNA, called, similarly acts as a miRNA sponge via miR-7 and miR-20a. [score:1]
contains over 70 binding sites for miR-7 and is densely bound by Argonaute (AGO) proteins (Hansen et al., 2013b). [score:1]
[1 to 20 of 27 sentences]
17
[+] score: 123
Chronic exposure of these cells to 75 mM ethanol for five days resulted in a significant up-regulation of the expression of miR-7 and miR-144 and down-regulation of miR-203 and miR-15B with no significant change in the expression of miR-152 or miR-153 (Table 1). [score:11]
When cells were exposed to 75 mM ethanol for 5 days followed by a withdrawal period for 5 days, the expression of miR-7 and miR-15B was significantly down-regulated, the expression of miR-152 and miR-153 was unchanged and miR-203 was down-regulated to the extent that it could not be detected (Table 1). [score:11]
Chronic ethanol exposure resulted in a significant up-regulation of the expression of miR-7 and miR-144 and down-regulation of miR-203 and miR-15B. [score:9]
Specifically, miR-203, miR-144, miR-15B and miR-153 are all predicted to target the α1 isoform of the GABA [A] receptor, miR-7 and miR-153 are known to act co-operatively to regulate the expression of α-synuclein and miR-203, miR-144, miR-152, miR-7 and miR-15B are predicted to target isoforms of the 14-3-3 family. [score:8]
Chronic exposure of these cells to 75 mM ethanol for five days resulted in a significant down-regulation of the expression of miR-153 whereas the expression of miR-7, miR-152 and miR-15B was not significantly altered (Table 1). [score:8]
Chronic exposure of these cells to 75 mM ethanol for five days resulted in a significant down-regulation of the expression of miR-7, miR-15B and miR-152 with no change in the expression of miR-153. [score:8]
All four miRNAs were up-regulated in 1321 N1 cells following chronic ethanol exposure plus withdrawal whereas only miR-7, miR-152 and miR-15B were up-regulated in HEK293T cells. [score:7]
Interestingly, ethanol withdrawal resulted in an up-regulation of miR-7, miR-152, miR-203 and miR-15B similar to the expression changes seen in post mortem human brain [15]. [score:6]
Chronic-intermittent exposure to 75 mM ethanol (12 h on, 12 h off) for 5 days followed by removal of ethanol for five days resulted in a significant up-regulation in the expression of miR-7 which returned to normal levels following ethanol removal. [score:6]
Interestingly, ethanol withdrawal resulted in an up-regulation of miR-7, miR-152, miR-203 and miR-15B similar to the expression changes seen in post mortem human brain. [score:6]
We measured the expression of six miRNAs—miR-7, miR-153, miR-152, miR-15B, miR-203 and miR-144—which are predicted to target key genes involved in chronic alcoholism and other neurodegenerative diseases. [score:5]
Here we measured the expression of six miRNAs—miR-7, miR-153, miR-152, miR-15B, miR-203 and miR-144—which are predicted to target key genes involved in chronic alcoholism and other neurodegenerative disease. [score:5]
However, chronic ethanol exposure followed by withdrawal resulted in a significant up-regulation of miR-7, miR-153, miR-152 and miR-15B. [score:4]
We selected six miRNAs—miR-7, miR-152, miR-153, miR-144, miR-203 and miR-15B—which are predicted to target key genes involved in chronic alcoholism including GABA [A] receptors [18], α-synuclein [19], regulators of G protein signaling [20], and the 14-3-3 family of molecular chaperones [21]. [score:4]
Interestingly, miR-7 was up-regulated following the removal of ethanol with no change in the other three miRNAs (Table 2). [score:4]
Overall, exposure of these cells to chronic ethanol resulted in significant down-regulation of miR-7, miR-15B, miR-152 and miR-203 which persisted even after removal of ethanol. [score:4]
The same general trend was also seen following chronic-intermittent ethanol exposure and withdrawal, however, only miR-7 was significantly up-regulated. [score:4]
The expression of miR-7 was unchanged following chronic-intermittent treatment but decreased by ~2 fold following ethanol removal. [score:3]
MiR-7, miR-152, miR-153 and miR-15B were expressed in the 1321 N1 cell line whereas miR-144 and miR-203 were below the threshold for reliable detection. [score:3]
The expression of miR-7 was unchanged following ethanol exposure but decreased ~2-fold following ethanol removal. [score:3]
Furthermore, the expression pattern of these four miRNAs was also significantly different between the three cell lines studied (MANOVA, Cell Line × Treatment Group, miR-7, F [2,8] = 9.92 P < 0.0001; miR-153, F [2,8] = 15.35 P < 0.0001; miR-152, F [2,8] = 10.62 P < 0.0001; miR-15B, F [2,8] = 14.58 P < 0.0001). [score:3]
We measured the changes in expression of six miRNAs (miR-7, miR-153, miR-152, miR-144, miR-203 and miR-15B) in HEK293T cells, SH SY5Y neuroblastoma and 1321 N1 cells following ethanol treatment. [score:1]
[1 to 20 of 22 sentences]
18
[+] score: 115
MiR-7 was shown to be down-regulated in human glioblastoma and bladder cancer and a further study showed that miR-7 may suppress tumor growth in human bladder cancer by inhibiting growth factor receptor expression and by impairing the antiapoptotic Akt-pathway [17]. [score:10]
In another study it was reported that miR-7 was down-regulated in bladder cancer and may suppress tumor growth by inhibiting growth factor receptor expression and by impairing the anti-apoptotic Akt pathway [17]. [score:10]
A. HOXB5 was predicted as a direct target of miR-7 by miRanda, PicTar and TargetScan. [score:6]
0040127.g003 Figure 3 A. HOXB5 was predicted as a direct target of miR-7 by miRanda, PicTar and TargetScan. [score:6]
We observed that the overexpression of miR-7 could significantly inhibit the expression level of HOXB5 mRNA compared with the NC group? [score:6]
C. Effect of miR-7 overexpression on the expression levels of endogenous HOXB5 in T24, 5637 and TCCSUP cells. [score:5]
Both A and G alleles of the mRNA transfected with miR-7 exhibited down-regulation relative to the NC group. [score:4]
These results indicated that miR-7 may regulate HOXB5 expression at both the post-transcription and mRNA levels. [score:4]
To further explore the regulation of HOXB5 expression by miR-7, we transfected miR-7 mimics and NC into the cell lines T24, 5637 and TCCSUP. [score:4]
To validate HOXB5 as a bona fide target of miR-7, a human HOXB5 3′-UTR fragment containing either the wild-type or mutant miR-7 -binding sequence was subcloned downstream of the Renilla luciferase reporter gene as described in the Materials and section. [score:3]
The relative luciferase activity of the reporter containing the wild-type HOXB5 3′-UTR was significantly suppressed when miR-7 was co -transfected (p<0.01). [score:3]
The Binding Activity of miR-7 for Different Alleles of mRNA affects HOXB5 Expression Level. [score:3]
HOXB5 was also predicted to be one of the target genes of miRNA-7 according to 3 of the different systemic bioinformatics software that we used, and the SNP (1010 A/G) was located within the miRNA-7 binding site (Figure 3A). [score:3]
These results suggested that the SNP located within the miR-7 binding sites may affect HOXB5 expression, which in turn may affect bladder tumorigenesis. [score:3]
C. HOXB5 expression level after transfection with miR-7 relative to NC in 5637 cells (GA genotype). [score:3]
HOXB5 is a target of miR-7.. [score:3]
We propose that the SNP (1010A/G) may affect the expression of HOXB5 in bladder cancer by differential mRNA stability and binding activity of miR-7. Furthermore, multivariate logistic regression analysis showed that genotypes with the G allele (GG and AG) were associated with the risk of high grade (Grade 2 and 3, aOR = 4.25, p<0.001) and high stage (T2–T4, muscle invasive type, aOR = 2.25, p = 0.003) cancers. [score:3]
We found that the HOXB5 mRNA and protein levels were down-regulated in the miR-7 transfected groups compared with the NC groups (Figure 3 C1 & C2). [score:3]
Interestingly, the expression level of the HOXB5 mRNA with the A allele decreased much more than the level of the mRNA with the G allele (Figure 5C), indicating that the binding of miR-7 to the HOXB5 mRNA with the A allele was greater than the mRNA with the G allele. [score:3]
Here, we reported a SNP (1010A/G) that was located within the miR-7 binding site of the 3′-UTR of the HOXB5 gene, and found that the different SNP (A or G) genotype could affect HOXB5 mRNA expression. [score:3]
These results showed that the binding activity of miR-7 with either the 1010A or 1010G allele may be another important mechanism involved in the different HOXB5 expression levels affected by the SNP. [score:3]
Next, we demonstrated that a SNP (1010A/G), located within the microRNA-7 binding site in the 3′-UTR of HOXB5, could affect HOXB5 expression in bladder cancer mainly by differential binding activity of microRNA-7 and SNP-related mRNA stability. [score:3]
Accordingly, we proposed that miR-7 binding activity and mRNA stability which can be affected by SNP may be involved in the differential expression of HOXB5. [score:3]
We found that a SNP (1010A/G) within the miR-7 binding site of HOXB5 3′-UTR affects HOXB5 expression and this SNP may be correlated with bladder tumorigenesis and the risk of high grade and high stage human bladder cancers. [score:3]
The relative luciferase activity was suppressed much more in the reporter containing the 1010A transfected with miR-7 than that containing the 1010G allele (Figure 5D). [score:3]
We have shown that this SNP could affect the expression of HOXB5 mainly by interfering with the function of miRNA-7 and SNP-related mRNA stability; Furthermore, the frequency of 1010G genotype was higher in cancer group compared to normal controls, and was found to be correlated with the risk of high grade and high stage. [score:2]
The sequences used for si-HOXB5 were, sense: 5′-GGAUGGACCUCAGCGUCAATT-3′, antisense: 5′-UUGACGCUGAGGUCCAUCCTT-3′; for miR-7 mimics, sense: 5′-CAACAAAUCACAGUCUGCCAUA-3′, antisense: 5′-UAUGGCAGACUGUGAUUUGUUG-3′; and for the negative control, sense: 5′-UUCUCCGAACGUGUCACGUTT-3′, antisense: 5′-ACGUGACACGUUCGGAGAATT-3′. [score:1]
D. Luciferase analysis in HEK-293T cells of miR-7 activity. [score:1]
analyses predicted a miR-7 -binding SNP (1010A/G) within the 3′-UTR of the HOXB5 gene. [score:1]
We found a SNP (1010 A/G) in the 3′-UTR of the HOXB5 gene, which was also within a miRNA-7 binding site. [score:1]
siRNAs designed to HOXB5 and miRNA-7 mimics were transfected into the bladder cancer cells T24, 5637 and TCCSUP using Lipofectamine -RNAiMAX (Invitrogen). [score:1]
In contrast, the luciferase activity of the reporter containing the mutant miR-7 -binding site was almost unaffected (p>0.05) (Figure 3B). [score:1]
Different alleles affect HOXB5 mRNA stability and the activity of miR-7 binding. [score:1]
We also found a SNP (1010 A/G) in the 3′-UTR of the HOXB5 gene which is within the miRNA-7 binding site. [score:1]
Using bioinformatics, a SNP (1010A/G) was found located within the microRNA-7 binding site in the 3′-UTR of HOXB5. [score:1]
SNP-1010A/G is Located within miRNA-7 Binding Site in HOXB5 3′-UTR. [score:1]
[1 to 20 of 36 sentences]
19
[+] score: 86
Downregulation of ciRS-7 increased miR-7 expression and significantly suppressed colorectal cancer cell proliferation and invasion. [score:8]
Overexpression of ciRS-7 leads to a significant decrease in miR-7 activity and results in increasing the miR-7 target gene expression level [34]. [score:7]
When compared to healthy adjacent tissues, ciRS-7 expression levels were significantly upregulated and ciRS-7 expression inversely correlated with miR-7 [91]. [score:7]
Since circRNA ciRS-7 acts as a miR-7 sponge, quenching the activity of miR-7 may increase the expression levels of miR-7 target oncogenes, resulting in a decreased tumor suppression [83]. [score:7]
In addition, knockdown of ciRS-7 in HCC cell lines suppressed cell invasion and proliferation through miR-7 targeting [91]. [score:6]
Conversely, miR-7 overexpression has also been associated with upregulated oncogenes in several tumor cell lines and advanced colorectal cancer tissues, when compared to healthy controls [93]. [score:5]
There is emerging evidence that miR-7 can directly downregulate oncogenes in a variety of cancers [82, 83]. [score:5]
Regarding the data obtained from the study, ciRS-7 suppression could increase the expression levels of miR-7 and reduce EGFR-RAF1 activity. [score:5]
Studies in mice have revealed an overlapping coexpression of ciRS-7 and miR-7 in brain tissues, which indicates that this circRNA may be crucial for normal neuronal development [34]. [score:4]
As demonstrated, ciRS-7 blocked miR-7 activity and positively regulated the expression of EGFR and IGF-1R oncogenes, indicating that the ciRS-7/miR-7 axis was associated with colorectal cancer progression. [score:4]
This suggests that miR-671 -mediated degradation of ciRS-7 may diminish the ciRS-7 -mediated miR-7 inhibition and enhance miR-7 levels in tumor cells [83]. [score:3]
It contains more than 70 selectively conserved miRNA target sites and associates with Argonaute (AGO) proteins in a miR-7 -dependent manner [34]. [score:3]
miR-7 has been shown to be involved in suppressing melanoma [84], breast cancer [85], glioma [86], gastric cancer [87], liver cancer [88], non-small-cell lung cancer (NSCLC) [89], colorectal cancer [90], and other cancer types. [score:3]
In vitro experiments revealed that ciRS-7 inhibited miR-7 activity and activated the EGFR/RAF1/MAPK pathway, which linked ciRS-7 activity with colorectal cancer progression and aggressiveness [132]. [score:3]
CiRS-7 -mediated oncogenic activity, acting partly through targeting miR-7, was recently demonstrated in cancer tissues of hepatocellular carcinoma (HCC) patients. [score:3]
Also, ciRS-7 could promote MVI by inhibiting miR-7 and disrupting the PIK3CD/p70S6K/mTOR pathway [137]. [score:3]
However, ciRS-7 may also regulate colorectal cancer progression through other mechanisms than as a miR-7 sponge [92]. [score:2]
However, despite its potential oncogenic properties, only few studies have revealed ciRS-7 involvement in cancer development through miR-7 binding. [score:2]
Thereby, the ciRS-7/miR-7 axis is likely involved in cancer-related pathways and cancer development and progression [83]. [score:2]
The combination of ciRS-7 and miR-671 triggers the linearization and AGO2 -mediated cleavage of ciRS-7, which enables the release of the absorbed miR-7 molecules [42]. [score:1]
Despite its assumed involvement in promoting various cancer types, mainly due to its ability to sponge miR-7, the clinical significance of ciRS-7 in colorectal cancer was only recently demonstrated. [score:1]
CircRNA cir-ITCH may act as a miRNA sponge for cancer -associated miR-7, miR-17, and miR-214 in esophageal squamous cell carcinoma (ESCC) [104] and miR-7 and miR-20a in colorectal cancer [105] and as a sponge for miR-7 and miR-214 in lung cancer [106]. [score:1]
In addition to miR-7 binding sites, ciRS-7 contains an additional binding site for miR-671. [score:1]
[1 to 20 of 23 sentences]
20
[+] score: 65
Their results indicated that upregulation of miR-7 sensitized SCLCs to all drugs, while downregulation of miR-7 desensitized SCLCs. [score:7]
There was suppressed luciferase activity when the miR-7 agomir was cotransfected with K [IR]2.1-3′UTR-wt, but not when K [IR]2.1-3′UTR-mutant was cotransfected with either MiR-7 agomir or antagomir, suggesting that Kir2.1 is a direct target of miR-7 in SCLCs. [score:6]
Upregulation of inwardly rectifying potassium channel Kir (KCNJ2) modulates multidrug resistance of small-cell lung cancer under the regulation of miR-7 and the Ras/MAPK pathway. [score:5]
Correlation data demonstrated that miR-7 expression was inversely correlated to K [IR]2.1 and MRP1 expression. [score:5]
Indeed, SCLC patients with low levels of miR-7 expression exhibited shorter survival times than patients with high miR-7 expression. [score:5]
Lastly, the authors confirmed the association between the expression of K [IR]2.1 and miR-7 by analyzing the miR-7 expression, by qRT-PCR, in 52 human SCLC tissue specimens. [score:5]
These data suggested that miR-7 downregulation may explain the effects of K [IR]2.1 on the chemoresistance of SCLCs. [score:4]
There was a inverse correlation between MiR-7 expression levels and the expression of K [IR]2.1 and multi-drug resitance protein 1 which resulted in increased chemosenetivity to SCLCs. [score:4]
Next, Lui and colleagues hypothesized that the high expression of K [IR]2.1 might be regulated by endogenous miR-7. Indeed, they identified, that miR-7 had a potential interaction site in the 3′UTR of K [IR]2.1. [score:4]
Recently, Liu et al. (2015) provided a link between miR-7 and the upregulation of K [IR]2.1 in the modulation of multidrug resistance of SCLCs. [score:4]
When miR-7 levels was elevated, the mRNA for K [IR]2.1 was reduced which reduced the expression of K [IR]2.1 at the membrane. [score:3]
Additionally, low-level expression of miR-7 was significantly seen with a more aggressive clinical stage of SCLC. [score:3]
In summary, Liu et al. (2015) provided a novel method in which K [IR]2.1 and miR-7 regulate the sensitivity of SCLC to chemotherapeutic drugs possibly through the regulation of MRP1 (Figure 2D). [score:3]
Role of miR-7 in regulation of K [IR]2.1 (KCNJ2) in small-cell lung cancer cells (SCLCs). [score:2]
MiR-7 plays an integral part in initiation, proliferation, invasion, survival, and death by targeting oncogenic signaling pathways (Gu et al., 2015). [score:2]
The molecular mechanisms and therapeutic potential of microRNA-7 in cancer. [score:1]
Using a luciferase reporter approach, they transfected H69 cells (human SCLC cell line) with either K [IR]2.1-3′UTR-wt, K [IR]2.1-3′UTR-mutant, or control vector with miR-7 agomir or antagomir or negative control vector. [score:1]
The authors examined the effect of miR-7 on chemoresistance of SCLCs by analyzing the sensitivity of SCLCs to chemotherapeutic drugs (adriamycin, cisplatin, and eroposide) after the transfection of miR-7 agomir, antagomir, or negative control vector. [score:1]
[1 to 20 of 18 sentences]
21
[+] score: 60
Moreover, overexpression of miR-7 directly targeted and inhibited expression of Ack1, Pak1, and EGFR in schwannoma cells. [score:10]
Studies supporting a role for Pak1 [45,46], EGFR [47], and Ack1 [20] activation/overexpression in schwannoma growth, suggests alternative strategies and rationale for the development of new therapies for these tumors based on overexpression of miR-7 or inhibition of Ack1, Pak1, and EGFR pathways. [score:8]
A recent study showed that miR-7 inhibited EGFR and Akt signaling by directly targeting the EGFR mRNA and the 3'UTR of IRS-1 and IRS-2, which function as upstream regulators of the Akt pathway [34,43]. [score:7]
Another study demonstrated that Pak1 mRNA is also a target for miR-7, with upregulation of this miRNA leading to degradation of Pak1 mRNA in transformed HeLa, ZR-75, and HEK 293 cells [33]. [score:6]
A significant inverse correlation was also found between miR-7 downregulation and Ack1 and Pak1 upregulation in schwannoma tumor samples compared to control nerve tissue. [score:6]
Additional mechanisms to activate Pak1, for example, via downregulation of miR-7 may also contribute to tumorigenesis. [score:4]
To investigate the possible contribution of miR-7 to schwannoma growth, we performed gain-of-function studies and found that upregulation of miR-7 inhibited schwannoma cell growth both in culture and in a xenograft tumor mo del in vivo. [score:4]
Previously known targets for miR-7 include messages for signaling proteins, Pak1 [33] and epidermal growth factor receptor (EGFR) [34], known to be activated in many forms of cancer. [score:3]
Taken together, our results and other reports [33,34] support the function of miR-7 as a potential tumor suppressor in tumors, including malignant gliomas and benign schwannomas. [score:3]
A new target for miR-7, found in our study, associated cdc42 kinase 1 (Ack1) is a non-receptor protein tyrosine kinase [39], and the gene encoding Ack1 has been recently shown to be amplified in breast, esophageal, lung, ovarian, pancreatic, and prostate cancer [40]. [score:3]
In our study [20], we found that miR-7 was one of the most downregulated miRNAs (~9-fold) in schwannomas compared to control nerves. [score:3]
It remains to be investigated how upregulation of Ack1 by decreased miR-7 contributes to schwannoma tumorigenesis. [score:2]
MIR-7 TAKE ON THREE ONCOGENIC SIGNALING PATHWAYS. [score:1]
[1 to 20 of 13 sentences]
22
[+] score: 59
In addition to targeting EGFR, hsa-miR-7-5p targets upstream regulator, insulin receptor substrate (IRS-1) of the Akt pathway, which is essential for regulation of cell cycle progression, cell survival and cellular growth as noted by Kefas et al. 58. [score:7]
Besides that, hsa-miR-7-5p also down-regulates C-FOS1 transcription regulator, which is known as a marker for neuron activity. [score:5]
The most highly up-regulated miRNA is the hsa-miR-7-5p, which controls and acts on kinase-related gene EGFR, enzyme-related gene IRS1 and also transcriptional regulator C-FOS1. [score:5]
Validation of this interaction was found in a few studies that confirm that hsa-miR-7-5p directly targets EGFR 56, 57. [score:4]
EGFR gene as a direct target of microRNA hsa-miR-7-5p. [score:4]
Therefore, we suggest that the role of hsa-miR-7-5p in gene regulation may suppress cell cycle progression and proliferation, either for differentiation or to maintain DPSCs in a quiescent state. [score:4]
Likewise, we found that EGFR is a potential hsa-miR-7-5p target as its 3'UTR is matched with hsa-miR-7-5p seed region (Fig. 7A). [score:3]
The miRNA mimics, inhibitors and negative controls for hsa-miR-516a-3p and hsa-miR-7-5p were purchased from (mirVana [®], Life Technologies™). [score:3]
Hence, no further validation was carried out for hsa-miR-7-5p and EGFR target relation. [score:3]
Thus, hsa-miR-7-5p in DPSC is predicted to inhibit C-FOS1, eventually decreasing cell proliferation and growth. [score:3]
Fig 7EGFR is a potential hsa-miR-7-5p target. [score:3]
Consistent with the array results, the hsa-miR-516a-3p and hsa-miR-7-5p exhibited substantial increase in expression in DPSCs and further carried out in the downstream work. [score:3]
Quantitative assessment on two highly expressed miRNAs; hsa-miR-516a-3p and hsa-miR-7-5p in DPSCs. [score:3]
We paid special attention to hsa-miR-516a-3p and hsa-miR-7-5p as these miRNAs were highly expressed upon validation with qRT-PCR analysis. [score:3]
Our results correspond well with previous works 18 conducted to validate the interaction between hsa-miR-7-5p and EGFR 3′-UTR target sites by using reporter assay. [score:2]
We found in this study that the positive interaction between hsa-miR-7-5p and its target EGFR through gain and loss assay. [score:2]
Apart from that, it is also shown that EIF2C2 and DICER1 modulate hsa-miR-7-5p. [score:1]
The miRNAs are namely hsa-miR-7-5p, hsa-miR-221-5p, hsa-miR-377-5p, hsa-miR-376a-5p, and let-7f-2-3p. [score:1]
[1 to 20 of 18 sentences]
23
[+] score: 59
Consistently, western blot analysis from the DCM samples shows significant upregulation of miRNA -7 specific nodal molecules like ERBB2 and COL1A without changes in RB1 suggesting the ERBB2 and COL1A are targets for miRNA-7. Indeed, overexpression of miRNA-7 in cells shows significant downregulation of ERBB2 but not EGFR1 (Fig 4D) in contrast to EGFR being targeted by miRNA 7 in cancer cells [34, 35] suggesting cell specific regulation of miRNA targeting the EGFR receptors. [score:16]
Importantly, analysis of some of the predicated targets of miRNA-7 like Phospholipase Cβ (PLCβ), regulator of G-protein signaling (RGS), RAF1, phosphodiesterase 4 (PDE4) which are well studied in heart failure [24– 26] are all upregulated in cardiac hypertrophy and heart failure [36– 38] consistent with downregulation of miRNA 7. Studies on neuronal development have shown that miRNA 7 targets basic helix-loop-helix (HLH) and Brd box [39, 40] containing transcriptional repressor proteins that interpret notch signaling. [score:13]
D, miRNA-7 expressing cells were lysed and western immunoblotting carried out for nodal molecule target ERBB2. [score:5]
Interestingly, EGFR is not altered post-miRNA7 expression. [score:3]
miRNA-7 encoding plasmid co-expresses green-fluorescence protein (GFP) to visualize transfection. [score:3]
Predicted targets of miRNA-7 encompass many of the key nodal molecules in merged networks including ERBB2 (epidermal growth factor receptor 2) and collagen 1 (COL1A) that are known to play key roles in cardiac remo deling. [score:3]
C, To test for expression of miRNA7, northern blot analysis was carried. [score:3]
Human miRNA-7 expressing pRNAT. [score:3]
Con, represents vector transfected cells, miRNA7, represents cells expressing miRNA-7. Lower panel shows methylene blue staining of the nylon membrane depicting equal loading of RNA for each of the samples for northern analysis. [score:3]
B, Phase contrast and confocal microscopy showing expression of miRNA7 transfected in HEK 293 cells. [score:3]
In addition to identifying miRNAs previously reported to be altered in human heart failure or mouse mo dels of heart failure, our profiling with the custom miRNA microarray identified a novel miR, hsa-miRNA-7 to be significantly down regulated in DCM samples. [score:2]
Mature human miRNA-7 (5’- UGGAAGACUAGUGAUUUUGUUGU-3’) was cloned into pRNAT. [score:1]
After de-staining the membrane was hybridized with [[32]P] labeled mature miRNA-7 cDNA. [score:1]
[1 to 20 of 13 sentences]
24
[+] score: 59
In vitro and in vivo CDR1as overexpression increases the oncogenic phenotype(47) Down Glioma Potentially anti-tumorigenic role, CDR1as is a target of miR-671-5p, and overexpressing miR-671-5p leads to downregulation of CDR1as, increasing cellular migration and proliferation(48) (Cir-ITCH) ITCH Down ESCCPotentially anti-tumorigenic role, by sponging miR-7 positively regulates ITCH, an inhibitor of WNT/beta-catenin. [score:13]
Mechanistically, the overexpressed CDRas1 sponges the tumor suppressor miR-7 and the downstream target of miR-7 – EGFR – is upregulated (46, 47). [score:10]
The proposed mechanism of action was similar in all three articles: low levels of cir-ITCH are not able to sponge miR-7 and miR-214 which will target ITCH, an inhibitor of WNT/beta-catenin pathway. [score:5]
CircRNA alias(circRNA) Host gene Up/down Tumor type Function and phenotype Reference Hsa_circ_0022383 (hsa_circRNA_100833) FADS2 Down BCC Potentially anti-tumorigenic role, by sponging different miRNAs(42) Down CSCC(41) Hsa_circ_0022392 (hsa_circRNA_100834) FDAS2 Down BCC(42) Down CSCC(41) hsa_circ_0001946 (CDR1as/ciRS-7) CDR1 Up HCC Potentially pro-tumorigenic role, by sponging miR-7. Knockdown of CDR1as inhibits cell proliferation and invasion(44) No change HCC Uncertain role, potential miR-7 sponge(45) Up CRC Potentially pro-tumorigenic role, miR-7 sponge, positively regulating EGFR and IGF-1R. [score:5]
Int J Mol Sci (2017) 18(7): 1378 10.3390/ijms18071378 44 Yu L Gong X Sun L Zhou Q Lu B Zhu L. The circular RNA Cdr1as act as an oncogene in hepatocellular carcinoma through targeting miR-7 expression. [score:5]
Yu et al. detected CDR1as to be upregulated in hepatocellular carcinoma (HCC) compared to normal adjacent tissue and that the expression of miR-7 anticorrelates with that of CDR1as. [score:5]
Knockdown of CDR1as suppresses cell invasion and proliferation(46) Up CRCPotentially pro-tumorigenic, miR-7 sponge, leading to the activation EGFR/RAF1/MAPK pathway. [score:4]
CDR1as, a circRNA abundant in the brain of mammals (34), seems to act as a sponge for miR-7, which in the presence of CDR1as is strongly suppressed (Figure 3A). [score:3]
In vivo, overexpression of CDR1as leads to a phenotype characterized by impaired midbrain development, comparable to miR-7 knockdown mo dels (32). [score:3]
Curiously, a high expression of CDR1as was associated with microvascular invasion and acted as a miR-7 sponge (45). [score:3]
The authors concluded that CDR1as which contains 71 binding sites for miR-7 is an exception and the next best miRNA sponge is circRNA ZNF91 which has 24 binding sites for miR-23 (25). [score:1]
In vitro experiments showed that CDR1as is an oncogene by sponging miR-7 and increasing cancer cell proliferation and invasion potential (44). [score:1]
Simultaneously, two articles reported that the circRNA, antisense to cerebellar degeneration-related protein 1 transcript (CDR1as) has more than 70 binding sites for miR-7. MiR-7, associated with Argonaute proteins, binds to CDR1as, but the RISC complex does not degrade the circRNA (32, 33). [score:1]
[1 to 20 of 13 sentences]
25
[+] score: 49
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
However, more functional analysis of naturally expressed circRNAs within the CNS will provide useful information regarding the precise role of circRNAs and other long-ncRNAs in the regulation of gene expression required through the different developmental stages of the CNS and also, whether miRNAs other than miR-7 are regulated by long-ncRNAs. [score:8]
This observation suggest that miR-671 might function as an indirect regulator of miR-7 activity by targeting and reducing ciRS-7 levels; however, the exact function of the ciRS-7:miR-671 interaction during the development of the CNS is still unknown. [score:6]
Moreover, due to the high degree of conservation of miR-7, the binding sites in the human CDR1as are functional when it is expressed in zebrafish resulting in impaired midbrain development which is similar to the phenotype of knocking-down miR-7 (Memczak et al., 2013). [score:5]
Interestingly, the concentration gradient of a single miRNA is capable of determining specific zones of neuronal differentiation as it is the case of miR-7 that maintains the proper localization of dopaminergic neuronal differentiation regions within the mouse olfactory bulb by having an opposite concentration/expression gradient to that of its target gene, Pax6 (De Chevigny et al., 2012). [score:5]
Silencing QKI in the U343 glioblastoma cell line, results in miR-7 expression and cell cycle arrest, through a mechanism involving miR-7 negative regulation of epidermal growth factor (EGF) receptor (EGFR) protein levels, thus blunting the EGF -dependent ERK activation (Wang et al., 2013). [score:4]
In particular, the human circRNA antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as) contains 63 conserved binding sites for miR-7 and specifically regulates miR-7 expression in neuronal tissues (Memczak et al., 2013). [score:4]
ciRS-7 contains more than 70 conserved binding sites for miR-7 and when miR-7 binds to it, AGO is recruited and binds to ciRS-7:miR-7 complexes however, ciRS-7 is resistant to miR-7 -mediated destabilization resulting in miR-7 activity blockage and derepression of miR-7 target genes (Hansen et al., 2013). [score:3]
Moreover, knock-out mice for MSI2 present higher levels of mature miR-7 without a change in pri-miR-7 abundance confirming that RBPs are key players in the regulatory mechanism controlling miRNA biogenesis (Choudhury et al., 2013). [score:3]
A recent report, demonstrated that the processing of the miR-7 pre-miRNA generated from the heterogeneous nuclear ribonucleoprotein K (hnRNP K) pre-mRNA transcript, is inhibited in non-brain human and mouse cells due to the binding of the RNA binding proteins (RBPs) Musashi homolog 2 (MSI2) and Hu antigen R (HuR) to the terminal loop of the pri-miR-7 and the stabilization of the pri-miRNA structure (Choudhury et al., 2013). [score:3]
Absence of QKI-5 and QKI-6 results in increased mature miR-7 levels due to the fact that these proteins negatively regulate pri-miR-7 to miR-7 processing by maintaining the pri-miR-7 at the nucleus and tightly bounded by Drosha (Wang et al., 2013). [score:2]
In addition, miR-7 biogenesis regulation also occurs via MSI2 and HuR binding during the in vitro neuronal differentiation of the SH-SY5Y cell line (Choudhury et al., 2013). [score:2]
Another study showed that the control of miR-7 biogenesis by the quaking (QKI) RBPs, isoforms QKI-5 and QKI-6 that are localized at the nucleus and throughout the cell respectively, contribute to regulate the proliferation rate of glioblastoma cells cultures (Wang et al., 2013). [score:2]
An independent study, described ciRS-7, another circRNA, as a miR-7 sponge in the human brain and in mouse neocortical and hippocampal neurons (Hansen et al., 2013). [score:1]
Tissue-specific control of brain-enriched miR-7 biogenesis. [score:1]
[1 to 20 of 14 sentences]
26
[+] score: 45
Emerging evidence indicates that miR-7 can directly downregulate cancerigenic factors, including epidermal growth factor receptor (EGFR) [46], P21-activated kinase-1 (Pak1) [47], insulin receptor substrate-1 (IRS-1) [48], phosphoinositide 3-kinase catalytic subunit delta (PIK3CD) [49], and mammalian target of rapamycin (mTOR) [35]. [score:7]
CDR1as contains more than 70 selectively conserved target sites of miR-7, and emerging evidence indicates that miR-7 can directly downregulate oncogenes. [score:7]
As sponge of miR-7, miR-17, and miR-214, cir-ITCH might increase the level of ITCH, which hyper expression promotes ubiquitination and degradation of phosphorylated Dvl2, thereby inhibiting the Wnt/β-catenin pathway [34]. [score:5]
Reddy SDN MicroRNA-7, a homeobox D10 target, inhibits p21-activated kinase 1 and regulates its functionsCancer Res. [score:5]
Xiong S Zheng Y Jiang P MicroRNA-7 inhibits the growth of human non-small cell lung cancer A549 cells through targeting BCL-2Int J Biol Sci. [score:4]
Fang Y MicroRNA-7 inhibits tumor growth and metastasis by targeting the phosphoinositide 3-kinase/Akt pathway in hepatocellular carcinomaHepatology. [score:4]
For example, CDR1as is known highly expressed and has over 60 binding sites for miR-7 [45]. [score:3]
Wang W Regulation of epidermal growth factor receptor signaling by plasmid -based MicroRNA-7 inhibits human malignant gliomas growth and metastasis in vivoNeoplasma. [score:3]
For example, a circRNA named ciRS-7 or CDR1as (circular RNA sponge for miR-7 or antisense to the cerebellar degeneration-related protein 1 transcript) contains more than 70 selectively conserved miRNA target sites, and it is highly associated with Argonaute (AGO) proteins in a miR-7 -dependent manner [14]. [score:3]
Zhao X MicroRNA-7 functions as an anti-metastatic microRNA in gastric cancer by targeting insulin-like growth factor-1 receptorOncogene. [score:2]
Another study also found that cir-ITCH is involved in the regulation of the Wnt/β-catenin signaling pathway in vivo, as sponge of miR-7, miR-17, miR-20a, and miR-214 [27, 36]. [score:2]
[1 to 20 of 11 sentences]
27
[+] score: 43
Deficits in ciRS-7 -mediated “sponging events”, resulting in excess ambient miRNA-7 appear to direct the selective down-regulation in the expression of miRNA-7-sensitive mRNA targets, such as that encoding the ubiquitin conjugating enzyme E2A (UBE2A; chr Xq24). [score:9]
Therapeutically, either alone or combined with other potent and versatile gene vector-encoded technologies or stabilized miRNA constructs, expression of custom-designed “anti-miRNA-7 sponges” could provide a new means of managing complex miRNA mixtures by “soaking up” selective and pathologically over-expressed miRNAs to regain homeostatic control of miRNA-7- and other miRNA-regulated gene expression. [score:8]
Lastly, miRNA-7 (miR-7) is a highly conserved, inducible miRNA abundant in the brain and retina of the human and murine CNS that displays restricted spatiotemporal expression during development, maturity, and disease, and the manipulation of miRNA-7 neurobiology has considerable diagnostic, prognostic, and therapeutic potential in human CNS health and disease [14, 15]. [score:8]
Horsham J. L. Ganda C. Kalinowski F. C. Brown R. A. Epis M. R. Leedman P. J. microRNA-7: A miRNA with expanding roles in development and disease Int. [score:4]
Interestingly, the ubiquitin-conjugating enzyme UBE2A was the first ubiquitination component found to be targeted by a novel miRNA-7-UBE2A-mRNA-3’UTR-ciRS-7 mechanism that appears to normally shuttle neurotoxic and immunogenic amyloid peptides into proteolytic pathways via the ubiquitin-26S proteasome system, and, hence, clears the cytoplasm of end-stage toxic peptides and proteolytic debris (Figure 3) [10, 11, 12, 34, 35, 36, 37]. [score:3]
These studies, using multiple methods of analysis, subsequently uncovered a novel circular RNA (circRNA) for the miRNA-7 (ciRS-7) mechanism coupled to an ambient increase in miRNA-7 in the sporadic AD hippocampal CA1 region and superior temporal lobe neocortex (Brodmann A22) [7, 8, 9, 10, 11, 12, 13]; this may in part explain: (i) an expanding pathological role for increased miRNA-7 in inflammatory degeneration [14, 15]; (ii) the down-regulation of UBE2A protein, a central effector in the ubiquitin-26S proteasome proteolysis and clearance system [3, 4, 5, 6]; and (iii) the consequences of deficits in UBE2A and the ubiquitin-26S proteasome proteolysis, which are the accumulation and aggregation of brain waste products, such as amyloid proteins that are characteristic of the pathogenic lesions that progressively accumulate in the AD brain [16, 17, 18]. [score:2]
In summary, we provide evidence for a novel and significantly misregulated ciRS-7-miRNA-7-UBE2A signaling circuit in sporadic AD neocortex (Brodmann A22) and hippocampal CA1. [score:2]
Using a modified and highly-sensitive LED-Northern probing of AD and control brain hippocampal CA1 total RNA fractions (LED = locked nucleic acids—1-ethyl-3-3-dimethylaminopropyl carbodiimide (EDAC)—digoxigenin; LNA, EDAC, and DIG; detection limit = 0.05 fM of a single miRNA species; apparatus #170-6545, BioRad Life Science Research, Hercules, CA, USA) and a fluorescent- or radiolabeled miRNA-7 probe we detected ciRS-7 in human brain and found evidence for a significantly reduced abundance of ciRS-7 in AD to about 0.18-fold the abundance of age-matched controls (Figure 2C,D) [10, 11, 12, 13, 20]. [score:1]
Using a miRNA-array approach we quantified a significant increase in miRNA-7, miRNA-146a, and miRNA-155 in AD over an unchanging miRNA-183 or 5S RNA in the same sample analyzed; in this study ambient miRNA-7 was found to be increased to a mean (average) of about three-fold over age-matched controls (p < 0.001, ANOVA; Figure 2A,B). [score:1]
Complimentarity maps for miRNA-7-UBE2A-mRNA-3′-UTR (Figure 1) were generated using miRBASE [14]. [score:1]
Current studies involving bioinformatics analysis of microRNA-messenger RNA (miRNA-mRNA) coupling in the aging human brain indicate a significant miRNA-7-UBE2A-mRNA-3′-UTR interaction [7, 8, 9, 10, 11, 12, 13]. [score:1]
Using bioinformatics and complementarity alignment algorithms (see above) we found a strong potential interaction between Homo sapien (hsa) miRNA-7 and the hsa UBE2A mRNA 3′-UTR (Figure 1A). [score:1]
Since ciRS-7 (containing multiple anti-miRNA-7 sequences) appears to act as a type of “molecular sponge” for miRNA-7, we reasoned that miRNA-7 increases may be in part due to ciRS-7 deficits. [score:1]
Predicted circular transcripts were found to consistently resist an RNaseR challenge; 30–35 ug total AD and control hippocampal CA1 or neocortical Brodmann A22 RNA were separated on agarose gels, transferred and probed with biotinylated or radiolabelled miRNA-7 probes, as previously described [8, 10]. [score:1]
[1 to 20 of 14 sentences]
28
[+] score: 38
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2
Because elevated miR-7 expression was reported to inhibit proliferation and induce apoptosis of breast cancer cells [69], the induction of miR-7 in bCSC by B6H12 may also contribute to the observed inhibition of bCSC proliferation by this CD47 antibody. [score:7]
MiR-7 down-regulates expression of KLF4 in breast cancer stem cells [14] and suppresses EGFR mRNA in several cancers by binding to sites in its 3′-UTR [35]. [score:7]
KLF4 -dependent suppression of stem cells by miR-7 expression has also been reported in prostate cancer [68]. [score:5]
However, we noted that both EGFR and KLF4 mRNAs are known targets of microRNA-7 (miR-7) in human cancer cells [14, 35]. [score:3]
IGF1R mRNA is another known target of miR-7 and was also significantly altered by B6H12 (Supplemental Table 5). [score:3]
B6H12 significantly increased miR-7-5P expression in bCSC but had minimal effects on differentiated MDA-MB-231 cells (Figure 5D). [score:3]
Thus, B6H12 induction of miR-7-5P could account for the observed activity of B6H12 to decrease EGFR and KLF4 expression in bCSC. [score:3]
Real -time PCR for miRNA-7 expression. [score:3]
MiR-7 has characteristics of a tumor suppressor in breast cancers and is an emerging cancer therapeutic target [66, 67]. [score:2]
To investigate if B6H12 treatment alters expression of miRNA-7, we measured expression of has-miR-7-5P from differentiated MDA-MB-231 cells and bCSCs cells. [score:1]
D. Differentiated MDA-MB-231 cells and bCSCs cells were treated with B6H12 Ab for 24 h. Total miRNA was extracted, and miR-7 was analyzed using real time PCR. [score:1]
[1 to 20 of 11 sentences]
29
[+] score: 37
Nevertheless, we predicted that KLF4 upregulation could be correlated with hsa-miR-7 downregulation (Figs 6 and 7), which is confirmed by a recent study on neural stem cell differentiation 36. [score:7]
Moreover, KLF4, the predicted target of hsa-miR-7 (Supplementary Table 3), was upregulated during the retinal induction treatment (Fig. 7). [score:6]
Based on expression levels, the predicted miRNA target genes and reported neuron-related miRNA 17 18, 5 miRNAs (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) were selected for validation. [score:5]
Based on expression levels, the predicted miRNA target genes and reported neuron-related miRNA 17 18, 5 miRNAs from microarray results (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) were selected for validation. [score:5]
We chose the 5 miRNAs (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) for validation not just based on the previous reports or the expression levels, but also the predicted target genes. [score:5]
hsa-miR-29b and hsa-miR-7 were downregulated throughout the treatment period (Fig. 6). [score:4]
In addition, 17 miRNAs (miR-136, miR-143, miR-148a, miR-15b, miR-18a, miR-181a, miR-181a*, miR-20b, miR-27b, miR-29b, miR-30d, miR-30e*, miR-301a, miR-376a, miR-376b, miR-410 and miR-7), which are differentially expressed in our retinal induction treatment, are involved in the regulation of developing mouse retina 25. [score:4]
Five significant miRNAs from the microarray profile (hsa-miR-132, hsa-miR-29b, hsa-miR-30d, hsa-miR-630 and hsa-miR-7) were validated using TaqMan PCR approach. [score:1]
[1 to 20 of 8 sentences]
30
[+] score: 36
The following analysis reveals that miR-375 directly targets HNF1β, and overexpression of miR-375 downregulates the protein level of HNF1β, while miR-7 directly targets PAX6, and overexpression of miR-7 decreases the expression level of PAX6 [21]. [score:16]
Similarly, in another cellular IR mo del (C2C12 myoblasts pretreated with fatty acids), overexpression of miR-7 downregulates IRS-1 expression via a direct interaction through binding to its 3′-UTR [42]. [score:9]
Dynamic expression of miRNAs during the differentiation of human embryonic stem cells into islet-like cell clusters has been quantified, and four islet-specific miRNAs (miR-7, miR-375, miR-34a, and miR-146a) exhibit distinct expression patterns during this process. [score:5]
Later studies have also proven that miR-7 and miR-375 are essential for pancreatic β-cell differentiation and development [22], and in vitro forced expression of miR-7 or miR-375 helps to differentiate hPSCs into IPCs [23, 24]. [score:4]
Among them, miR-375 and miR-7 increase from day 4, peak on day 8, and then decline until the end of differentiation. [score:1]
Shae A. Azarpira N. Karimi M. H. Soleimani M. Dehghan S. Differentiation of human -induced pluripotent stem cells into insulin-producing clusters by microRNA-7 Exp. [score:1]
[1 to 20 of 6 sentences]
31
[+] score: 35
Consistent with other glioma miRNA profiling studies [9], [14], [15], [31], we also observed down-regulation of miR-124, miR-128, miR-132, and miR-7, and up-regulation of miR-10b, amongst others, demonstrating that high-throughput sequencing can be an effective method for profiling miRNA expression. [score:9]
Of note, miR-7 can directly repress expression of EGFR, which is often amplified at the genetic level and/or over-expressed at the protein level in gliomas [19]. [score:6]
Brain-enriched miR-124 and miR-7, for example, show poor expression in neural progenitors, but are highly expressed in neurons and have been implicated in neural differentiation [20], [23], [54]. [score:5]
MiRNAs down-regulated in gliomas include miR-7, miR-124, miR-128, miR-137, and miR-181a/b [9], [14], [15], [18], [19]. [score:4]
miR-7, miR-124, miR-128, miR-132, and miR-212 are amongst the most highly down-regulated miRNAs found in glioblastomas compared to non-transformed cells (Fig. 1, Table S4, S6). [score:3]
Congruent with previous studies [42], [43], ATRA treatment of SH-SY5Y cells induced expression of the brain-enriched miRNAs miR-128 and miR-124 (Fig. 5A) as well as miR-132 and miR-7 (not shown). [score:3]
Furthermore, miR-7, miR-124, and miR-128 have been reported to impair cell growth and proliferation when over-expressed in glioma-derived stem cells [14], [15], [19], [41]. [score:3]
At least 20 cellular miRNAs were differentially expressed in the six glioblastomas assayed here compared to non-tumor brain tissue, many of which (miR-128, miR-124, miR-7, miR-132, miR-139) are consistently dysregulated in not only gliomas but also other brain cancers including medulloblastomas and neuroblastomas [33]. [score:2]
[1 to 20 of 8 sentences]
32
[+] score: 35
Notably, five of these six miRNAs exhibit congruent changes between our functional experiments in vitro and their expression patterns in vivo in at least one study, i. e. reduction upon E6/E7 silencing in HeLa and upregulation in cervical cancer biopsies (miR-7–5p [43], miR-17–5p [27– 30, 34, 37], miR-186–5p [35]) or increase upon E6/E7 silencing in HeLa and downregulation in cervical cancer tissue (miR-23b-3p [28, 37] and miR-143–3p [23, 29, 31, 33, 37, 38, 82]) (S2 Dataset). [score:9]
Our results show that continuous E6/E7 expression is linked to an upregulation of let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p and a downregulation of miR-21–5p, in exosomes secreted from HeLa cells. [score:9]
Statistical significance of the qRT-PCR data was obtained for ten of these 17 miRNAs: downregulation of miR-17–5p, miR-186–5p, miR-378a-3p, miR-378f, miR-629–5p and miR-7–5p and upregulation of miR-143–3p, miR-23a-3p, miR-23b-3p and miR-27b-3p, upon E6/E7 silencing (Fig. 2E and indicated in bold in S2 Table). [score:7]
These findings indicate that continuous HPV E6/E7 oncogene expression determines a signature of seven miRNAs in exosomes secreted from HeLa cells in that it leads to significantly increased let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p and decreased miR-21–5p levels. [score:3]
Specifically, continuous E6/E7 expression is necessary to maintain high intracellular levels of miR-7–5p, miR-629–5p, miR-378a-3p, miR378f, miR-17–5p, and miR-186–5p (S2 Table), which all have been linked to pro-tumorigenic activities. [score:3]
A statistically significant and > 1.5-fold decrease upon E6/E7 silencing was detected for exosomal let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p, whereas miR-21–5p exhibited a statistically significant and > 1.5-fold increase upon E6/E7 silencing (illustrated in bold in S4 Table). [score:1]
Reduced miR-7–5p or miR-629–5p levels have also been both associated with cellular senescence [87]. [score:1]
The pro-oncogenic potential of miR-7–5p and miR-378a-3p is discussed above. [score:1]
For example, miR-7–5p stimulated cell proliferation and tumorigenicity in lung cancer cells [83] and is linked to a more aggressive growth behavior of breast cancers [84]. [score:1]
[1 to 20 of 9 sentences]
33
[+] score: 35
For example, the up-regulation of miR-34a and miR-195 was associated with a down-regulation of BCL2 and SGK1 protein levels, respectively; whereas the down-regulation of miR-193b, miR-221, miR-222 and miR-7 was associated with an up-regulation of MCL1, BCL2L11 (Bim), CDN1B (p 27) and VDAC1 protein levels, respectively (Figure 9A). [score:13]
The Par-4-down-regulated microRNAs miR-221, miR-222 and miR-7 were predicted to target the pro-apoptotic genes BCL2L11 (Bim), CDN1B (p27) and VDAC1, respectively (Figure 8B and 8C; see Additional file 8). [score:6]
Our qRT-PCR results showed that miR-18a, miR-193, miR-221, miR-222 and miR-7 were down-regulated, whereas miR-195, miR-30d and miR-34a were up-regulated in Par-4 -transfected cells when compared with empty vector -transfected cells (Figure 8C). [score:6]
To the best of our knowledge, the predicted target mRNAs of miR-193b, miR-195 and miR-7 have yet to be functionally validated; whereas BCL2, BCL2L11 (Bim) and CDN1B (p 27) have been functionally validated (by Western blot or qRT-PCR analysis) as target mRNAs of miR-34a, miR-221 and miR-222 in human neuroblastoma, prostate cancer and rat PC12 cell lines [40- 42]. [score:5]
Eleven (miR-30d, miR-10b, miR-34a, miR-195, miR-222, miR-221, miR-31, miR-7, miR-663, miR-193b and miR-18a) out of 22 deregulated microRNAs accounted for the 283 predicted target mRNAs linked to cell death (e. g. pro- or anti-apoptotic genes) (see Additional file 8). [score:4]
Fold changes for miR-18a, miR-193b, mi-195, miR-221, miR-222, miR-30d, miR-30d, miR-34a and miR-7 are indicated. [score:1]
[1 to 20 of 6 sentences]
34
[+] score: 34
Tumor suppressive miRNA: miR-7, 520, 375, 25,217. miR-221 is one of the most frequently and consistently upregulated miRNAs in human cancer, including in HCC, pancreatic, colon, stomach, glioblastoma, kidney, bladder, prostate and thyroid cancer, which indicates its importance in tumorigenesis [48]. [score:6]
Tumor suppressive miRNA: miR-7, 520, 375, 25,217. miR-221 is one of the most frequently and consistently upregulated miRNAs in human cancer, including in HCC, pancreatic, colon, stomach, glioblastoma, kidney, bladder, prostate and thyroid cancer, which indicates its importance in tumorigenesis [48]. [score:6]
These findings indicate that miR-7 functions as a tumor suppressor and plays a substantial role in inhibiting the tumorigenesis and reversing the metastasis of HCC through the PI3K/Akt/mTOR-signaling pathway. [score:5]
Phosphoinositide 3-kinase catalytic subunit delta (PIK3CD) was first identified as a miR-7 target, and further study suggested that miR-7 might be a key regulator of the PI3K/Akt/mTOR signaling pathway. [score:4]
miR-7 inhibits HCC cell growth and metastasis in vitro and in vivo. [score:3]
In a xenograft mo del, overexpressed miR-7 effectively repressed tumor growth and decreased metastasis to the lung. [score:3]
[48] miR-7 HCC PIK3CD In a xenograft mo del, overexpressed miR-7 effectively repressed tumor growth and decreased metastasis to the lung. [score:3]
Given these results, miR-7 may be a potential therapeutic or diagnostic/prognostic target for treating HCC [49]. [score:3]
miR-7 in hepatocellular carcinoma (HCC) cells. [score:1]
[1 to 20 of 9 sentences]
35
[+] score: 34
The authors also identified that cir-ITCH acts as a sponge of miR-7, miR-17, and miR-214, thereby up-regulated the target gene ITCH, which negatively regulates the Wnt/β-catenin pathway via targeting dishevelled (Dvl) protein [85]. [score:9]
In a recent report examining tissue specific and developmental-stage-specific expression of human circRNAs, one of the examined circRNAs, CDR1as (also known as ciRS-7), a non-coding antisense transcript to the cerebellar degeneration-related protein 1 (CDR1), was identified to contain 63 conserved binding sites for miR-7 located within neural tissue, which acted to impair midbrain development in zebrafish due to inhibition of miR-7 function [2]. [score:7]
Thus, ciRS-7 was verified as a miR-7 sponge, acting to fine tune the expression of miR-7 targeted genes through an indirect regulation pathway. [score:7]
When ciRS-7 is knocked-down, there is a significant inhibition of HCC cell proliferation and invasion, which is likely due to the release of miR-7 [64, 65]. [score:4]
Thus, these results indicate that in lung cancer cells cir-ITCH can inhibit miR-7 and miR-214 through binding them as sponge [56]. [score:3]
In both cell lines transfected with empty vector (control of cir-ITCH plasmid), luciferase activity was significantly decreased, in a concentration dependent manner, by a miR-7 or miR-214 mimic. [score:1]
In a study of the CRC cell lines, HCT116 and SW480, sponge activity of cir-ITCH was demonstrated towards miR-7, miR-20a, and miR-214 [55]. [score:1]
Cir-ITCH has been verified to bind with many different miRs, including, miR-7, miR-17, miR-214, miR-128, and miR-216b [2, 14, 55]. [score:1]
For instance, in one study of CDR1as/ciRS-7, a circRNA sponge for miR-7 over 60 conserved seed match segments were identified, suggesting very dense binding [2, 48]. [score:1]
[1 to 20 of 9 sentences]
36
[+] score: 33
In differentiated hNSCs, downregulated hsa-miR-96 correlated with SOX5 upregulation of gene and protein expression; similar results were obtained for hsa-miR-302a, hsa-miR-182, hsa-miR-7, hsa-miR-20a/b, and hsa-miR-17 and their target NR4A3. [score:11]
Moreover, SOX5 was identified as a direct target gene of hsa-miR-96, and NR43A, a direct target of hsa-miR-7 and hsa-mir-17 by luciferase reporter assays. [score:6]
NR4A3, a target of the hsa-miR-7, hsa-miR302a, and miR-17 family, is a member of the NR4A family of nuclear receptors, which, depending on their level of expression, are involved in the differentiation, survival, apoptosis, and regulation of hippocampal axon guidance [50]. [score:6]
For the luciferase assay, cells were plated at a density of 10 [5] cells/well in 24-well plates and co -transfected with either 100 ng of MiTarget MicroRNA 3′ UTR Target Clone HmiT019538-MT01 (GeneCopoeia, NR4A3 3′ UTR) or HmiT017632-MT01 (GeneCopoeia, SOX5 3′ UTR), as well as 20 n M miRNA mimics (hsa-miR-96-5p for SOX5 3′ UTR, and hsa-miR-7-5p, and hsa-miR-17-5p for NR4A3 3′ UTR, respectively) per well. [score:4]
Furthermore, SOX5 and NR4A3 were identified as direct target genes of hsa-miR-96, and hsa-miR-7 and 17, respectively, by luciferase reporter assays. [score:3]
Top-ranked downregulated miRNAs: hsa-miR-96, hsa-miR-182, hsa-miR-183, hsa-miR-7 and hsa-miR-302a were analyzed by using the DIANA-microT 4.0 algorithm to investigate the KEGG pathway. [score:2]
Same analysis of NR4A3 3′-UTR revealed three putative binding sites for hsa-miR-7 located at nucleotides 490–518, 568–596, and 2,612–2,640, and for hsa-miR-17, located at nucleotides 262–290, 1,556–1,584, and 1,688–1,716, respectively. [score:1]
[1 to 20 of 7 sentences]
37
[+] score: 32
In neurons, miR-7 was identified as a regulator of alpha-synuclein, whose over -expression is associated with impaired function of dopamine-generating cells and development of Parkinson's disease. [score:7]
In the study by Hansen et al. (2011), the circRNA CDR1as, which is the antisense transcript of CDR1, has been identified to be targeted by miR-7, a miRNA implicated in various disease, including Parkinson's disease and several types of cancers. [score:7]
Its expression was primarily found in the brain where it was co-expressed with miR-7 (Hansen et al., 2011). [score:5]
The study by Hansen et al. (2011) revealed overlaps in expression of the circRNA CDR1as and miR-7 in mouse brain suggesting that a major amount of miR-7 is attached to CDR1as in mouse brain. [score:3]
Repression of alpha-synuclein expression and toxicity by microRNA-7. Proc. [score:3]
The fact that circular RNAs are targeted by endogenous miRNAs was reported by Hansen et al. The authors outlined a circRNA destruction mechanism in which miR-671 binds CDR1as/ciRS-7 with greater complementarities than miR-7 and induces cleavage of this circRNA mediated by Ago [the catalytic component of RNA induced silencing complex (RISC) which is a central component of RNA interference (RNAi) machinery] (Hansen et al., 2011). [score:3]
Loss of miR-7 in cultured Parkinson's disease cells possibly contributes to increased alpha-synuclein level (Junn et al., 2009). [score:3]
Circular RNA and miR-7 in cancer. [score:1]
[1 to 20 of 8 sentences]
38
[+] score: 32
While it cannot be totally excluded that the age-related or age-limited changes are due to disease status per se, the changes in the expression of these miRNAs with age seem not to be simply due to the disease status for the following two considerations: (a) the heat maps of the differentially expressed miRNAs (Figs 2 and 3) show that the age effect is much stronger than disease effect; and (b) in view of the direction of gene expression changes, except miR-652, miR-28-5p, miR-133b, and miR-7, the age effect on the expressions of other 12 disease-related miRNAs would be under-estimated rather than over-estimated. [score:18]
For example, among the 23 miRNAs with age-limited expression and 101 differentially expressed miRNAs, one (miR-652) was up-regulated in schizophrenia (Lai et al., 2011), and three others were either down-regulated (miR-152) or up-regulated (miR-133b and miR-7) in bronchopulmonary dysplasia (Wu et al., 2013), all in peripheral blood. [score:14]
[1 to 20 of 2 sentences]
39
[+] score: 29
Moreover, miR-7 silencing experiments, performed with anti-miR-7 morpholinos, demonstrate an increase in the expression of spata2 mRNA (in ex vivo cultured islets or in the pancreatic β-cell line MIN6) thus confirming that spata2 is down-regulated by miR-7. Since spata2 and miR-7 transcript expression seems to be inversely correlated, it has been proposed that spata2/miR-7 could be involved in islet biogenesis [20]. [score:8]
Bravo-Egana et al. performed a differential expression analysis of miRNAs in human adult acinar and islets pancreatic tissue and identified miR-7 to be the most highly and selectively expressed miRNA in islets, with an islet/acinar ratio of expression greater than 200 [17]. [score:7]
The RNA target predictive algorithms TargetScan, Miranda and PicTar identified spata2 gene as the miR-7 target with the highest rank. [score:7]
Other studies confirmed the major expression of miR-7 during human pancreatic islet development and differentiation and revealed the correlation between its expression and the observed increase in pro-insulin gene transcripts [18, 19]. [score:6]
THE LAST PART OF THE STORY: SPATA2, MIR-7 AND PANCREATIC ISLETS. [score:1]
[1 to 20 of 5 sentences]
40
[+] score: 28
Our analysis indicated that the WSSV early gene wsv477 was also targeted by host miR-7, suggesting that host might inhibit virus infection by targeting viral transcripts with host miRNAs. [score:7]
The miR-7 might act as a regulator of components of the immune system to inhibit virus replication through their direct interaction with viral mRNA. [score:5]
Phylogenetic analysis, target gene prediction and pathway analysis showed that, among the 13 conserved miRNAs (miR-1, miR-100, miR-10a, miR-124, miR-125, miR-184, miR-33, miR-34, miR-7, miR-9, miR-92a, miR-92b and miR-let7), several highly conserved miRNAs (miR-1, miR-7 and miR-34) targeted the same or similar genes leading to the same pathways in shrimp, fruit fly and human (Figure 3b). [score:5]
Among the differentially expressed miRNAs found, miR-1, miR-7 and miR-34 are highly conserved and mediate similar pathways, suggesting that some beneficial miRNAs have been preserved in animals during evolution. [score:3]
One of the predicted viral target genes of miR-7 was wsv477, an early gene that might have a key role in DNA replication and virus proliferation [33]. [score:3]
Our analyses predicted that miR-7, one of the miRNAs highly conserved between invertebrates and vertebrates, could target the mitogen-activated protein kinases (MAPKs), a situation identical to that in humans [43- 45]. [score:3]
Evolutionary analysis showed that three of them, miR-1, miR-7 and miR-34, are highly conserved in shrimp, fruit fly and humans and function in the similar pathways. [score:1]
In our study, phylogenetic analysis showed that the miR-1, miR-7 and miR-34 are highly conserved in shrimp, fruit fly and human and function in similar pathways. [score:1]
[1 to 20 of 8 sentences]
41
[+] score: 28
miR-7 targets the 3′-untranslated region (UTR) of Pak1 and inhibits its expression. [score:9]
In addition, another regulatory molecule with tumor suppressive characteristics is miR-7, which targets a wi dely upregulated signaling kinase, p21-activated kinase 1 (Pak1). [score:7]
Thus, during breast cancer progression, there are increased levels of Pak1 protein while miR-7 expression levels and HoxD10 are both downregulated as the cancer becomes more invasive. [score:6]
The study concluded that miR-7 inhibits the motility, invasiveness, and tumorigenic potential of highly invasive breast cancer cells. [score:3]
Studies showed that miR-7 has an inverse correlation with Pak1 expression in human breast cancer cells [127]. [score:3]
[1 to 20 of 5 sentences]
42
[+] score: 25
Transfection of HeLa cells with a plasmid expressing miR7, which is predicted to target PIK3CD, suppressed luminescence, whilst a site-directed mutant within the predicted binding region did not, confirming that miR-7 may directly bind to PIK3CD to reduce mRNA or protein levels (Fig 8F). [score:9]
F. miR-7 targeting the 3’UTR of PIK3CD suppresses luciferase activity. [score:5]
To determine direct targeting of PIK3CD by miR-7, the pCDNA 3.1_miR-7 construct was co -transfected in to HeLa cells with either pRL-TK_ PIK3CD-3’UTR or pRL-TK_ PIK3CD-3’UTR_MUTANT vectors, using SuperFect (Qiagen) and manufacturers recommendations. [score:4]
Hela cells were co -transfected with a miR-7 expressing vector (miR-7) and a Renilla Luciferase construct harbouring either a PIK3CD-3’UTR fragment containing the miR-7-5p binding site (bp 268–275) (Wild Type, WT), the same PIK3CD-3’UTR construct with mutated miR-7-5p binding site (bp 268–275) (Mutant), or empty construct (Control). [score:3]
To assess the specificity of the miR-7-5p putative binding site in the PIK3CD-3’UTR fragment, a 4nt substitution removing sequence complementarity to the miR-7-5p seed sequence was performed by QuickChange Site Directed Mutagenesis (Stratagene), using a previously outlined method [43]. [score:2]
We demonstrated that miR-7 binds to the 3’UTR of PIK3CD, as predicted bioinformatically. [score:1]
The amplified sequences of interest were removed from pCR 2.1 TOPO and inserted into pCDNA 3.1 (miR-7) or pRLTK (PIK3CD-3’UTR) using XHOI/HINDIII or XBAI/NOTI restriction sites, respectively. [score:1]
[1 to 20 of 7 sentences]
43
[+] score: 23
In an intriguing elaboration of this regulatory pathway, the activity of the mammalian miR-7 miRNA can be inhibited by CDR1as/ciRS-7, which is in turn targeted by another miRNA, miR-671, which shows near-perfect complementarity and triggers endonucleolytic cleavage of CDR1as [8– 10]. [score:6]
Based on several criteria, including their intriguing expression patterns, their apparently elevated sequence conservation and the compelling hypothesis that CDR1as acts as a miR-7 sponge, these circRNAs have been proposed to comprise a large class of post-transcriptional regulators. [score:4]
With >60 conserved sites for miR-7, CDR1as is thought to act as a sponge to titrate miR-7 from its other targets [8, 9]. [score:3]
Although a biological context has not yet been identified in which CDR1as loss-of-function influences miR-7 activity, this circRNA has >60 conserved sites to miR-7 and a developmental phenotype following its ectopic delivery [8, 9]. [score:2]
Strikingly, when counting the clusters of AGO2 crosslinks mapping to each circRNA [27], CDR1as had 26 clusters corresponding to miR-7 sites, which was by far the most mapping to any circRNA for any miRNA family (Figure  6B). [score:1]
The circRNA with the most compelling evidence for a biological function is the miR-7 sponge, CDR1as. [score:1]
CDR1as-miR-7 was also the only circRNA-miRNA pair that exceeded the upper limit of results from the negative control, in which the analysis was repeated with permutated miRNA sequences (Figure  6C). [score:1]
CDR1as also had 22 sites for the miR-876-5p/3167 family (Figure S9B in Additional file 12), although they were not as conserved as the miR-7 sites. [score:1]
The previously proposed miR-7 sponge, CDR1as, is one of only two circRNAs with more miRNA sites than expected by chance, with the next best miRNA-sponge candidate deriving from a gene encoding a primate-specific zinc-finger protein, ZNF91. [score:1]
Again, CDR1as ranked on top, containing 71 miR-7 sites (Figure  6C). [score:1]
The outlying CDR1as-miR-7 pair is indicated. [score:1]
Mammalian cells produce a large number of circRNAs, which have captured the interest of many biologists, particularly after the description of CDR1as and its many conserved sites to miR-7. Our work identifies thousands of additional circRNAs and focuses on those that have circular fractions ≥10%. [score:1]
[1 to 20 of 12 sentences]
44
[+] score: 23
Cir-ITCH increased ITCH levels by inhibiting miR-7 and miR-214, which inhibited the activity of disheveled segment polarity protein 2 (Dvl2). [score:5]
Pan H, et al. Overexpression of circular RNA ciRS-7 abrogates the tumor suppressive effect of miR-7 on gastric Cancer via PTEN/PI3K/AKT signaling pathway. [score:5]
For example, it can also promote tumor invasion and migration by inhibiting miR-7 and regulating EGFR and IGF-IR [33, 34, 41] (Fig.   4 ). [score:4]
miR-7 upregulation in cells is associated with significantly reduced CDR1 levels in exosomes. [score:4]
CDR1as/ciRS-7, which acts as a competitive miR-7 sponge and inhibits its function, can release insulin growth factor 1 receptor (IGF-IR) and other molecules and affect the MAPK/ERK1/2 and PI3K/AKT intracellular signaling pathways [33, 40, 41]. [score:3]
ciRS-7 /CDR1, which can be used as a sponge for miR-7, is present in exosomes. [score:1]
Similarly, cir-ITCH plays a similar role in lung cancer by competitively binding to miR-7 [36]. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 23
Interestingly, overexpression of CDR1as in zebrafish decreased the midbrain size, suggesting a functional role for CDR1as in the brain, while knockdown of CDR1as downregulated miR-7 targets in HEK293 cells [3]. [score:9]
This regulation is relevant since miR-7 plays a role in Parkinson’s disease, stress handling and brain development [3, 39], and also has tumor-suppressive properties [39]. [score:7]
According to miRTarBase [34], miR-7 interacts with 578 target genes, some of which include SNCA (synuclein alpha), EIF4E (eukaryotic translation initiation factor 4E), KMT5A (lysine methyltransferase 5A), MAPKAP1 (mitogen-activated protein kinase associated protein 1), and MKNK1 (MAP kinase interacting serine/threonine kinase 1). [score:5]
The circRNA CDR1as (also known as CiRS-7, a circRNA sponge for miR-7) was detected in all 20 of our samples and is a wi dely reported circRNA with 63 conserved seed matches for miR-7, indicating possible miR-7 binding sites [3, 11]. [score:1]
CDR1as was predicted to have binding sites for 74 distinct miRNAs and 63 binding sites for miR-7 (Fig. 2b). [score:1]
[1 to 20 of 5 sentences]
46
[+] score: 22
These studies may provide insights into some forms of human cancer, where the mir-7 ortholog is overexpressed and oncogenic, such as lung and skin cancers [240], or the Ihog orthologs (BOC and CDO) are downregulated or have a tumour-suppressor functions, such as in pancreatic cancer [241] or rhabdomyosarcoma [242]. [score:8]
Consistent with the mechanism, blocking Hedgehog signalling by knocking down expression of the Hh pathway transcription factor, Ci, also cooperated with Delta overexpression to phenocopy the effect of overexpression of mir-7 and Delta [118]. [score:8]
The same group also found that another micro -RNA, mir-7, when overexpressed, enhances Delta -driven tumour overgrowth and promotes invasion in the eye-antennal epithelium, although the cells were still capable of differentiating [118] (Table 1). [score:3]
mir-7 reduced translation of the Hedgehog receptor mRNA, ihog (interference hedgehog), whereas Notch signalling blocked transcription of the coreceptor gene, boi (brother of ihog), thereby leading to reduced Hedgehog signalling and enhancing Delta-Notch -driven tumour growth and invasion. [score:3]
[1 to 20 of 4 sentences]
47
[+] score: 21
MiR-7 directly targeted RAF1 mRNA and subsequently down-regulated its expression in lung, breast, and GBM cancer cell lines [103]. [score:8]
MiR-7 expression was down-regulated in GBM, with a mechanism involving processing defect in generating pre-miR-7 from pri-miR-7. Transfection with miR-7 decreased viability and invasiveness of primary GBM lines. [score:6]
MiR-7 potently also suppressed EGFR expression in GBM, and independently inhibited the AKT pathway [25]. [score:6]
Interestingly, miR-7 also bound EGFR mRNA 3′-UTR that encodes an upstream members of the RAS-MAPK pathway [25, 103]. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 21
miR-146b-5p and -424 tended to be upregulated but fold changes were smaller than that of PDGFRα [+] cells, and downregulation of miR-7 were not observed (Table S1). [score:7]
Upregulation of miR-146b-5p and -424 and downregulation of miR-7 were confirmed by qRT-PCR (Figure 5). [score:7]
MiR-19b, -30a, -146b-5p, -199b-5p, and -424 were found to be upregulated, and miR-7, -145*, and -210 were found to be downregulated (Table 1). [score:7]
[1 to 20 of 3 sentences]
49
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
In mammals, miR-7, miR-7b, miR-141, miR-200a, and miR-375 are enriched in the pituitary (Landgraf et al. 2007; Bak et al. 2008); similarly, in situ detection during zebrafish development shows the expression of miR-375 in pituitary (Wienholds et al. 2005; Kapsimali et al. 2007), indicating evolutionary conservation of miRNA in pituitary function. [score:4]
Also, miRNAs are regulated by a feedback loop mechanism with their target (Yang et al. 2009), such as miR-57 and nob-1, or miR-7 and SF2/ASF (Wu et al. 2010; Zhao et al. 2010). [score:4]
Also, tissue-specific inhibition of pri-miR-7 processing by musashi RNA -binding protein 2 (MSI2) and human antigen R (HuR) proteins is reported in mammals (Choudhury et al. 2013). [score:3]
In mammals, miR-7, miR-9, miR-29b, miR-30d, miR-124a, and miR-375 regulate the secretion and islet development (Poy et al. 2004; Baroukh and Van Obberghen 2009; Tang et al. 2009; Pullen et al. 2011). [score:3]
Kapsimali et al. (2007) miR-204 Medaka Knockdown, ISH, luciferase reporter assays, qRT-PCR Lens development Conte et al. (2010) let-7 Zebrafish Luciferase reporter assays, qRT-PCR, knockdown Müller glia cells differentiation Ramachandran et al. (2010) miR-7 and miR-454a Zebrafish and medaka ISH ? [score:2]
Other study showed that loss of miR-7 could result in specific reduction of midbrain size without affecting the telencephalon at the anterior tip of the brain (Memczak et al. 2013). [score:1]
Some of these miRNAs, such as miR-7 and miR-7b, are found both in mice (Bak et al. 2008) and zebrafish (Tessmar-Raible et al. 2007), indicating probable functional conservation. [score:1]
Ason et al. (2006) miR-7, miR-9, miR-34b, miR-96, miR-124a, miR-125b, miR-132, miR-181b, miR-182, miR-183, miR-184, and miR-204, miR-215, miR-216, miR-217 Zebrafish Microarray, ISH ? [score:1]
Kapsimali et al. (2007) miR-7 and miR-9 Zebrafish Gain- and loss-of-function boundary organization Leucht et al. (2008) and Memczak et al. (2013) Eye miR-124 Zebrafish NGS, qRT–PCR ? [score:1]
[1 to 20 of 9 sentences]
50
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
For instance, while miR-181b and miR-7 levels were highly upregulated in injured zebrafish and bichir fins, analysis of regenerating axolotl forelimbs showed expression levels were significantly downregulated. [score:9]
S22 Table Zebrafish Ensembl gene identifiers for 58 genes downregulated in three mo dels with predicted miRNA binding sites for miR-21, miR-181c, miR-181b, miR-31 and miR-7 and members of the network of commonly up- and downregulated genes with functional interactions to 11 blastema -associated genes. [score:7]
S21 Table Zebrafish Ensembl gene identifiers for 136 genes downregulated in three mo dels with predicted miRNA binding sites for miR-21, miR-181c, miR-181b, miR-31 or miR-7 in all three mo dels. [score:4]
[1 to 20 of 3 sentences]
51
[+] score: 19
In a separate luciferase assay, we examined if miR-21-5p and miR-451a downregulate luciferase expression, in comparison to a microRNA that does not target OXTR, miR-7. In fact, miR-451a and miR-21-5p both significantly decreased luciferase expression, in comparison to miR-7 (Fig.   4c). [score:9]
Plasmids expressing miR-451a, miR-21-5p, and miR-7 and plasmid expressing only GFP were purchased from OriGene (Rockville, MD, USA). [score:5]
Louis, MI, USA) with the following plasmids: 100 ng of psiCHECK2-3′ UTR plasmid and 400 ng of pEGFP– miR-451a, pEGFP– miR-21-5p, pEGFP– miR-7, or empty pEGFP overexpression plasmids. [score:3]
c Luciferase assay showing effect of miR-451a and miR-21-5p on luciferase expression, in comparison to miR-7. * p value <0.05, ** p value <0.01. [score:2]
[1 to 20 of 4 sentences]
52
[+] score: 19
In the present study, we examined the levels of a group of miRNAs, which had been reported to regulate the expression of pluripotent genes such as miR-489, miR-370 and miR-433 30, or were predicted to target stem cell pluripotency genes such as miR-7 and miR-21. [score:6]
Our results showed that miR-489, miR-370 and miR-433 were highly expressed in spheroid hMSCs, while miR-7, miR-145, let-7f, miR-21 and miR-24 were down-regulated in spheroid hMSCs, compared to hMSCs that had been cultured in monolayer. [score:5]
showed that miR-489, miR-370 and miR-433 were highly expressed in spheroid hMSCs compared to monolayer hMSCs, especially miR-370 with a fivefold increase, while let-7f, miR-7, miR-145, miR-21 and miR-24 were down-regulated in spheroid hMSCs (Fig. 5A). [score:5]
To understand whether miRNAs were involved with the phenotypical changes of hMSCs in spheroids, real-time PCR analysis was performed to examine the expression of miR-489, miR-370, miR-433, let-7f, miR-7, miR-145, miR-21 and miR-24. [score:3]
[1 to 20 of 4 sentences]
53
[+] score: 19
ciRS-7 might serve as a crucial factor engaged in the functioning of neurons as well as a candidate in neurological disorders and tumor development on basis of several lines of evidence as follows: the widespread involvement of miR-7 as a key regulator of various cancer pathways; the suggested implications of miR-7 in Parkinson's disease by direct targeting of a-synuclein protein expression; direct targeting of the ubiquitin protein ligaseA (UBE2A) in Alzheimer's disease. [score:15]
Moreover, the classic CiRS-7-5p binds with miR-7-5p via 100% perfect-match (Figure 2F). [score:1]
The circular RNA ciRS-7 contains various, tandem miRNA-7 binding sites, thereby acting as an endogenous miRNA “sponge” to adsorb, and hence quench, normal miRNA-7 functions [50]. [score:1]
The extreme case is miR-7 and its sponge, CiRS-7, with over 70 conserved binding sites [31], or CDR1 as [32] as indicated by circBase [33] and CircInteractome [34]. [score:1]
Notably, we found that CiRS-7 or CDR1as (hsa_circ_0001946) harbors 66 consecutive binding sites for miR-7-5p (previous miR-7). [score:1]
[1 to 20 of 5 sentences]
54
[+] score: 18
Expression of miR-124 and miR-137, respectively, increased up to 8- and 24-fold, expression of miR-129 and miR-139, respectively, decreased up to 2- and 4-fold, and expression of miR-7 and miR-218 did not change appreciably. [score:7]
We identified six miRNAs of particular interest, miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218, which were down-regulated in both AAs and GBMs (Figure 1A, Additional file 8 and Table 1) at a more stringent level of significance (P ≤ 0.01). [score:4]
Of the 35 miRNAs, we identified six HGA-miRNAs, which were down-regulated in both AA and GBM tumors at a more stringent degree of significance (P < 0.01): miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218. [score:4]
We observed that the majority of the HGA-miRNAs show expression changes during, or have been implicated in, differentiation of various cell lineages: miR-7 during photoreceptor differentiation [23]; miR-124 and miR-137 during erythropoiesis [24]; miR-124 and miR-218 during neuronal differentiation of embryonal carcinoma cell differentiation [25]; miR-124 during neuronal differentiation of ES cells [12]. [score:3]
[1 to 20 of 4 sentences]
55
[+] score: 18
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, hsa-mir-217
For example, circ_100284 could up-regulate the expression of target gene EZH2 by inhibiting miR-217, elevate the concentration of cyclin D1, promote the cell cycle and induce vicious transformation of cells [9]; circ-ITCH may lead to cell cycle arrest and malignant cells suppression by affecting the Wnt signal pathway [10]; circ-Foxo3 could inhibit tumor angiogenesis [11]; ciRS-7 is closely related to hepatic microvascular invasion (MVI) by modulating the expression of miR-7 as well as its target genes, PIK3CD and p70S6K [12]. [score:18]
[1 to 20 of 1 sentences]
56
[+] score: 18
The circRNA ITCH (cir-ITCH) was newly discovered to be functionally sponging miR-7, miR-17 and miR-214 and inducing the expression level of ITCH, which induced the ubiquitination and degradation of phosphorylated Dvl2 and thereby the inhibition of the Wnt/β-catenin pathway (Li et al., 2016). [score:5]
The ciRS-7 deficiency was expected to induce ambient miR-7 levels in AD-affected brain cells, which is probably responsible for down -regulating AD -associated targets, such as, the ubiquitin protein ligase A (UBE2A; Cogswell et al., 2008; Lukiw, 2013). [score:4]
Recent studies also indicated an endogenous interaction between ciRS-7 and miR-7 based on the observation of the co -expression of ciRS-7 and miR-7 in the mouse brain (Hansen et al., 2013; Memczak et al., 2013). [score:3]
The ciRS-7 functions as a miR-7 sponge that strongly quenches miR-7 activity, thus causing induced levels of miR-7 targets. [score:3]
One brain-specific circRNA, ciRS-7 (circular RNA sponge for miR-7), also known as CDR1as, is transcribed antisense to the cerebellar degeneration-related protein 1 transcript (CDR1) that is highly expressed (even more than the sense transcript) in the mouse and human CNS. [score:3]
[1 to 20 of 5 sentences]
57
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Overexpression of miR-7 in pancreatic progenitors has been shown to impair the differentiation of both α- and β-cells and is associated with a repression of Pax6 expression. [score:5]
The knockdown of miR-7 during early embryonic life determines an overall downregulation of insulin production, a decrease in the number of β-cells, and the onset of glucose intolerance in the postnatal period. [score:5]
Furthermore, an in vitro inhibition of miR-7 promotes death of β-cell in explanted pancreatic buds. [score:3]
Other miRNAs such as miR-7 and miR-124 have been recognized to be engaged in regulation of β-cell differentiation and establishment of pancreatic islets [97]. [score:2]
In summary, data suggest that dysregulation of miR-7 signaling network in response to metabolic stress or cellular insults contribute to the loss of β-cell identity and establishment of T2D [104]. [score:2]
High levels of miR-7 are detectable in the pancreatic cells, both in the developing and adult phases [103]. [score:1]
[1 to 20 of 6 sentences]
58
[+] score: 17
The modulation of miRNA expression following E6/E7 siRNA treatment was further confirmed by real-time quantitative PCR (RT-qPCR) for approximately three-quarters of the targets and among them, let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423-3p, miR-7-5p, miR-92a-3p were downregulated and miR-21-5p was upregulated. [score:11]
Chou Y. T. Lin H. H. Lien Y. C. Wang Y. H. Hong C. F. Kao Y. R. Lin S. C. Chang Y. C. Lin S. Y. Chen S. J. EGFR promotes lung tumorigenesis by activating miR-7 through a Ras/ERK/Myc pathway that targets the Ets2 transcriptional repressor ERFCancer Res. [score:3]
Moreover, the miR-7-5p favors cell proliferation [96], the miR-20a-5p blocks oncogene -induced senescence by targeting p21 [97], and miR-92a-3p possesses anti-apoptotic properties [98]. [score:3]
[1 to 20 of 3 sentences]
59
[+] score: 17
Among the differentially expressed miRNAs, up-regulated miRNAs including miR-34b-5p, miR-578, miR-1304, and miR-324-5p and down-regulated miRNAs including miR-7-5p, and miR-34b-3p were analyzed using primers for mature mRNAs (B). [score:8]
miR-34b-5p showed 1.8 fold increases in expression, whereas miR-7-5p and miR-34b-3p showed 2.0 and 1.6 fold decreases in expression, respectively (p<0.05). [score:5]
The differential expression of miRNAs from array experiments was confirmed by further analysis of selected miRNAs, including miR-7-5p, miR-34b-3p, miR-34b-5p, miR-578, miR-1304, and miR-324-5p, using qRT-PCR. [score:3]
A greater than 1.5 fold increase was observed for 36 miRNAs, including miR-136-5p and miR-34a-5p, and a lower than 1.5 fold decrease was seen for 85 miRNAs including miR-7-5p and miR-34b-3p in spheroids cultured on concave microwell plates. [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 17
We used the miRDB[91, 92] to identify novel miRNA targets (Additional file 2), and we found that the 9 different miRNAs that increased in CD30 [hi] lymphocytes target several genes associated with neoplastic processes (Additional file 2): gga-mir-204 targets FAS apoptosis inhibitory molecule 2, RAB22A (a RAS oncogene family member) and HDAC 9; gga-mir-489 targets FAS associated factor 1 (FAF1) and gga-mir-7 targets RAS related viral oncogene homolog 2. Except FAF1 (which was unchanged) none of these proteins were identified and so we cannot confirm the upregulated miRNA’s potential effects on neoplasia in CD30 [hi] cells. [score:16]
Of these, nine (gga-mir-1b, gga-mir-7, gga-mir-7b, gga-mir-10b, gga-mir-31, gga-mir-130b, gga-mir-204, gga-mir-215, gga-mir-489) are increased, and five (gga-mir-223, gga-mir-124b, gga-mir-140, gga-mir-183, gga-mir-222a) are decreased in CD30 [hi] cells. [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 16
For example, miR-7 is down-regulated in human glioblastoma and directly inhibits EGFR expression by targeting its 3’ UTR. [score:11]
In addition, miR-7 suppresses Akt pathway activation independent of its EGFR inhibition [36]. [score:5]
[1 to 20 of 2 sentences]
62
[+] score: 16
Overexpression of miR-23a enhanced autophagyTo explore the role of miRNAs in autophagy, we performed qRT-PCR analysis for the expression levels of miR-24, miR-7, miR-513a-5p and miR-23a in MCF-7 and T47D cells treated with EBSS. [score:5]
To determine whether miRNAs potentially participated in regulating autophagy, we identified several miRNAs potentially targeting XIAP by bioinformatic analysis, including miR-24, miR-7, miR-23a and miR-513a-5p. [score:4]
To explore the role of miRNAs in autophagy, we performed qRT-PCR analysis for the expression levels of miR-24, miR-7, miR-513a-5p and miR-23a in MCF-7 and T47D cells treated with EBSS. [score:3]
Figure 2Forced expression of miR-23a induces autophagic activity(A) MCF-7 and T47D cells were transfected with miR-24 mimics, miR-7 mimics, miR-23a mimics and miR-513a-5p mimics. [score:3]
Shown is the qRT-PCR analysis for miR-24, miR-7, miR-513a-5p and miR-23a. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 16
The 4.8-kb gigaloop is a putative structure formed by pairing of VCR and a complementary sequence (cVCR) Figure 2. Conserved sequences of stratum 1 (shared by Homo and Callorhinchus IGF1R 3'-UTRs): (a) the 3' end of the long IGF1R transcript; (b) a miR-7-3p target site that has been lost from the Pelodiscus sequence; (c) let-7-3p target site; (d) miR-186 target site; (e) The VCR with predicted binding sites for miR-376c, miR-675 (derived from the imprinted H19 RNA) and miR-16. [score:7]
In addition to the polyadenylation site, this region contains a miR-7-3p target site that has been lost from the Pelodiscus sequence (Fig.  2b), a conserved let-7-3p target site (Fig.  2c) and a conserved miR-186 target site (Fig.  2d). [score:7]
Postranscriptional regulation of IGF1R by let-7, miR-7 and miR-182 are plausible candidates for such ancient functions because these microRNA families are themselves ancient, conserved between protostomes and deuterostomes [32–34]. [score:2]
[1 to 20 of 3 sentences]
64
[+] score: 16
microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma. [score:6]
In fact, recent research has facilitated the replacement of miRNAs for tumor suppressor miR-7, miR-128, and miR-34a over the inhibitory approach (Godlewski et al., 2008; Kefas et al., 2008; Bader, 2012). [score:5]
For instance, a catalytic subunit of DNA -dependent protein kinase (DNA-PKs) is inhibited by miR-7 and miR-101 (Yan et al., 2010; Lee et al., 2011), and ataxia telangiectasia mutated protein (ATM) is regulated with miR-18a, miR-100, miR-101, and miR-421 (Ng et al., 2010; Yan et al., 2010). [score:4]
microRNA-7 increases radiosensitivity of human cancer cells with activated EGFR -associated signaling. [score:1]
[1 to 20 of 4 sentences]
65
[+] score: 16
There are reports suggesting that microRNA-7 suppression leads to the upregulation of epidermal growth factor receptor expression [107]. [score:8]
In vivo studies demonstrated that microRNA-7 is suppressed by inflammatory response [109]. [score:3]
In addition, increasing microRNA-7 in cancer cell line through liposomal delivery could inhibit cell division and is suggested to be a potential treatment modality [110]. [score:3]
MicroRNA-7 is a proliferation suppressor [106]. [score:2]
[1 to 20 of 4 sentences]
66
[+] score: 15
Downregulation of miR-7 was previously reported in glioblastoma [24] along with underexpression of miR-128 in lung cancer [23], but in HNSCC cell lines the expression of these miRNAs was variable as compared to controls (Fig. S1A). [score:7]
Given that miR-7 has known interactions with EGFR as both a tumor suppressor and oncogene [25, 29], but did not show an effect on cell viability in HNSCC, we postulated that miR-27a* targets additional genes in the EGFR signaling axis to reduce cell survival. [score:5]
We used software prediction programs to identify candidate binding sites of miRNAs within the EGFR gene and identified miR-7, −27a (miR-27a-3p), −27a*, −27b (miR-27b-3p), −27b* (miR-27b-5p), and −128 (Fig. 1A). [score:1]
Evaluation of miR-7 expression did not demonstrate a significant difference in the entire cohort or the matched samples. [score:1]
To assess the effects of the miRNAs on tumor viability, three HNSCC cell lines were transfected with miR-7, −27a and −27a* mimics. [score:1]
[1 to 20 of 5 sentences]
67
[+] score: 15
The hsa-miR-7, which targets EGFR, is a potential tumor suppressor in glioblastoma targeting critical cancer signalling pathways. [score:7]
They noted that the miR-7 directly targets EGFR, thus decreasing its level in glioblastoma cells [46]. [score:4]
Kefas et al. have identified miR-7 downregulation in glioblastoma tissue, when compared with the adjacent brain. [score:3]
Furthermore, it has been demonstrated that transfection of miR-7 reduced the viability and invasiveness of glioblastoma cells. [score:1]
[1 to 20 of 4 sentences]
68
[+] score: 15
Experiments in D. melanogaster have identified six new miRNA–target gene pairs: miR-7 targets the notch signaling genes HLHm3, HLHm4, and hairy, and miR-2b targets the genes reaper, grim, and sickle (Stark et al. 2003). [score:7]
Consistent with these experiments, our target predictions in D. melanogaster (Enright et al. 2003) ranked HLHm3, hairy, and HLHm4 at positions 1, 3, and 7, respectively, in the list of 143 target genes for miR-7 (Enright et al. 2003). [score:5]
The targets of some miRNAs were strongly enriched in certain categories, e. g., miR-105 in “small GTPase mediated signal transduction” (5-fold), miR-208 in “transcription factor” (6-fold), and miR-7, which lies in the intron of the hnRNPk (an RNA -binding protein) gene, in “RNA binding proteins. [score:3]
[1 to 20 of 3 sentences]
69
[+] score: 15
OIP5-AS1, a long intergenic ncRNA transcribed in antisense from the OIP5 gene, located at chromosome 15q15.1, was first discovered as cyrano in zebrafish and reported to function as a major regulator of neurogenesis during development and in the maintenance of self-renewal in mouse morula stage modulating the nanog expression by sponging mmu-miR-7 16, 17. [score:5]
To the surprise, the 3′-UTR of human NANOG did not carry any binding site for hsa-miR-7-5p suggesting that NANOG was not targeted by hsa-miR-7-5p. [score:3]
Cui Y The miR-7 identified from collagen biomaterial -based three-dimensional cultured cells regulates neural stem cell differentiationStem Cells Dev. [score:2]
However, the binding site for miRNA miR-7 was conserved in OIP5-AS1 (Fig.   2b and Supplementary Fig.   S1). [score:1]
Therefore, we checked the binding sites for the mouse miRNA counterpart in human (hsa-miR-7-5p), as this particular miRNA is highly conserved across the vertebrates [17]. [score:1]
Though human OIP5-AS1 was poorly conserved, the binding site for hsa-miR-7-5p is preserved at a conserved part of the transcript. [score:1]
Therefore, we checked the conservation of hsa-miR-7–5p and mmu-miR-7 mature sequence and observed 100% sequence similarity between mouse and human (Fig.   2a). [score:1]
We did a clustal alignment of mouse Nanog and human NANOG mRNA and found that human NANOG 3′-UTR is not conserved and thus no binding site for hsa-miR-7 (Supplementary Table  S1). [score:1]
[1 to 20 of 8 sentences]
70
[+] score: 14
Overexpression of miR-7 markedly inhibits GC metastasis by targeting the expression of the insulin-like growth factor-1 receptor (IGF1R) oncogene [18]. [score:9]
Additionally, miR-7 is significantly downregulated in both highly metastatic GC cell lines and metastatic tissues. [score:4]
In addition, we also found that some previously well proved molecules, such as miR-7 [18], miR-25 [17], TOB1 and IGF1R, were not be identified in our microarrays. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 14
This suggests that miR-671 diminishes the inhibition of miR-7 expression through; improves the miR7 level in tumor cells; contributes to the increase of downstream target oncogenes, such as EGFR and XIAP; and promotes vascularization, metastasis and reproduction of tumor cells [41, 44]. [score:7]
Later, it was discovered that can bind to miR7 as a miRNA sponge to downregulate miR-7 expression [41]. [score:6]
miR-671 was found to be another binding site, and the combination of the two molecules mediates the Ago2 -mediated cleavage of to release the absorbed miR-7 [42, 43]. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 14
Moreover, miR-7 blocked SMARCD1 expression by binding to two seed regions in the 3′-UTR of SMARCD1 and downregulated SMARCD1 mRNA expression. [score:8]
With chemotherapy, miR-7 downregulated p53 -dependent apoptosis-related genes BAX and p21 by interfering with the interaction of SMARCD1 and p53, thereby reducing caspase-3 cleavage and the downstream apoptosis cascades [74]. [score:4]
Hong C. F. Lin S. Y. Chou Y. T. Wu C. W. MicroRNA-7 compromises p53 protein -dependent apoptosis by controlling the expression of the chromatin remo deling factor SMARCD1 J. Biol. [score:2]
[1 to 20 of 3 sentences]
73
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
Rai et al. used cationic liposomes loaded with miR-7–expressing plasmid to inhibit EGFR signaling causing a dramatic response in an EGFR-TKI–resistant lung cancer xenograft mo del [225]. [score:5]
This study confirmed that miR-7 negatively regulates also AKT, and ERK 1/2 [205], whereas Rai et al. also confirmed these results finding that miR-7 ectopic expression allowed EGFR TKIs to overcome resistance in lung cancer cell lines [206]. [score:4]
Another study showed that miR-7 downregulates EGFR mRNA in different cancer cell lines, including lung cancer. [score:4]
Among them miR-7, miR-31, miR-125 and miR-183 family members were found disrupted in lung cancer [60]. [score:1]
[1 to 20 of 4 sentences]
74
[+] score: 14
We also observed a significant overexpression of miR-21 (average fold change = 13.3-fold, p-value < 0.001, Student's t-test) and a significant underexpression of miR-7 (average fold change = −7.2-fold, p-value < 0.001, Student's t-test) in the same biopsies (Figure 1A). [score:5]
Cerebellar Degeneration-Related Protein 1 (CDR1) antisense (CDR1-AS, a miR-7 sponge also known as ciRS-7) is the only circRNA known to be targeted and degraded by a microRNA (miR-671-5p) [11]. [score:3]
Expression of miR-671-5p, miR-671-3p, miR-21 and miR-7 in GBM biopsies. [score:3]
All GBM cell lines showed under - and overexpression of miR-7 and miR-21 respectively, compared to whole brain, as reported by literature (Figure 1B). [score:2]
It also functions as miR-7 sponge by sequestering it through multiple binding sites [11, 12]. [score:1]
[1 to 20 of 5 sentences]
75
[+] score: 13
MiR-7 potently suppressed epidermal growth factor receptor (EGFR) expression, and furthermore it independently inhibited the Akt pathway via targeting upstream regulators [36]. [score:9]
MiR-7 is also found to be a tumor suppressor in GBM, targeting critical cancer pathways. [score:4]
[1 to 20 of 2 sentences]
76
[+] score: 13
Figure 9. (a) miRNA module containing hsa-mir-7 enriched for the GO category ‘positive regulation of neuron projection development’ (b) miRNA module containing hsa-mir-214 enriched for the GO category ‘neuron projection development’. [score:4]
For example, it is known that the endogenous knockdown of hsa-miR-7 promotes neurite outgrowth in neuroblastoma cell lines, but no target or mechanism has been identified. [score:4]
In Figure 9a, we see that hsa-miR-7 is a well-connected node within the module ‘Positive Regulation of Neuron Projection Development’ that is principally enriched for the mir-302a family/cluster (P < 1.9-04). [score:3]
Modules providing insight into the possible mechanism of how hsa-mir-7 and hsa-mir-214 regulate neuron projections in neuroblastoma were also uncovered, demonstrating how this approach may aid filling in the gaps in functional mechanism for specific miRNAs. [score:2]
[1 to 20 of 4 sentences]
77
[+] score: 13
In a more recent study, the HBV-encoded x protein indirectly downregulated EGFR expression in HCC cells via microRNA-7, resulting in decreased growth rate of these cells. [score:7]
Chen Y. J. Chien P. H. Chen W. S. Chien Y. F. Hsu Y. Y. Wang L. Y. Chen J. Y. Lin C. W. Huang T. C. Yu Y. L. Hepatitis B virus-encoded x protein downregulates EGFR expression via inducing microRNA-7 in hepatocellular carcinoma cells Evid. [score:6]
[1 to 20 of 2 sentences]
78
[+] score: 13
For example, conserved helix-loop-helix ubiquitous kinase (CHUK), which is also known as IKK1, a protein kinase that plays an important role in pancreatic cancer and prostate cancer by regulating the NF-kB transcription factor, has two in dels that may disrupt targeting by miR-223; RB1 contains one in del in target site of miR-335; STAT3 contains two in dels in target sites of miR-9 and miR-125b; and FOXO1 and EFGR have in dels in target sites of miR-9 and miR-7 respectively. [score:10]
For example, an in del (rs78669011) is located in the 3′ UTR of EGFR that disrupts a site complementary to the seed of miR-7. The targeting of EGFR by miR-7 has been experimentally supported by several experiments [43], [44] and both the gene and miRNA are known to play a role in cancer [59]. [score:3]
[1 to 20 of 2 sentences]
79
[+] score: 13
Particularly in breast cancer, HOTAIR is able to indirectly downregulate miR-7 via HoxD10 inhibition, resulting in EMT progression. [score:7]
miR-7 represents a metastasis-suppressing miRNA that can reverse EMT by downregulating the signal transducer and activator of transcription 3 (STAT3) pathway in breast cancer cells [102]. [score:6]
[1 to 20 of 2 sentences]
80
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
In addition, miR-7 and miR-153 target the 3.0 UTR of SNCA, bind directly to SNCA mRNA to downregulate its expression and are enriched in the brains of PD patients (Doxakis, 2010). [score:9]
Post-transcriptional regulation of alpha synuclein expression by mir-7 and mir-153. [score:4]
[1 to 20 of 2 sentences]
81
[+] score: 13
Two clusters (V and X) significantly correlated with the expression of E genes suggesting that in GBM miRNAs other than miR-200, miR-7, miR-203, or miR-375 regulate the epithelial nature of the cancer cells. [score:4]
In addition to the miR-200 family members, the EMT signature also contained miR-7, miR-203, and miR-375, which we previously identified and validated as novel EMT regulating miRNAs [4]. [score:2]
The epithelial miRNAs also included three miRNAs we previously identified as novel epithelial regulators, miR-7, miR-203, and miR-375 (highlighted in orange in Figure  1C). [score:2]
In addition, we identified and validated three other miRNAs that regulated EMT: miR-7, miR-203 and miR-375 [4]. [score:2]
miRNAs: red, miR-200 family; blue, miR-17 family; orange, other EMT-related miRNAs recently identified [4] (miR-7, miR-203, and miR-375). [score:1]
Exact functional opposites were found in the miRNA group that contained the miR-200 families plus miR-7, miR-203, and miR-375 (Figure  1C). [score:1]
miRNAs: blue, miR-17 family; dark green, miR-221/222 family; red, EMT-related miRNAs (miR-200 family); orange, other EMT-related miRNAs (miR-7, 203 or 375). [score:1]
[1 to 20 of 7 sentences]
82
[+] score: 12
miR-7, which represses the expression of Yan protein and promotes photoreceptor differentiation [44], as well as miR-125-2b, highly abundant in adult retina [45], were down-regulated over 48 hours post-ESMV treatment. [score:6]
The concurrent down-regulation of the miR-let7 cluster, known to promote differentiation in most cells and de-differentiation when it is inhibited [76], miR-125, a highly abundant miRNA in adult retina [45], and miR-7, known to promote photoreceptor differentiation [44] is consistent with Müller cell de-differentiation under the influence of ESMVs. [score:6]
[1 to 20 of 2 sentences]
83
[+] score: 12
Zhang et al. found that HOTAIR inhibits HOXD10, resulting in the indirect downregulation of miR-7 (Table 1). [score:7]
The authors went on to show that miR-7 inhibits the histone methyltransferase SETDB1, and can partially reverse the EMT via the STAT3 pathway [18]. [score:3]
MiR-7 levels have been shown to be low in breast cancer samples, and it has been associated with inhibiting the epithelial to mesenchymal transition (EMT) of cells and preventing metastasis. [score:2]
[1 to 20 of 3 sentences]
84
[+] score: 12
miR-22 [28], miR-101 [29], and miR-7 [30] have all been shown to be downregulated in tumor specimens and function as tumor suppressors; miR-17 [31] and miR-21 [32] have been shown to be upregulated in tumor specimens and function as oncogenes. [score:9]
A mutant of the single miR-7 binding site (5′- GAGCCAG-3′ to 5′- ACCGCGC-3′) in the 3′-UTR of ZBTB2 was included by Site-Directed Mutagenesis Kit (SBS Genetech, Beijing, China). [score:2]
NM_020861.1) containing the putative miR-7 binding sequence was amplified by RT-PCR and cloned into the site between Xho I and Not I downstream of the luciferase reporter gene of the psiCHECK™ vector (Promega, USA). [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 12
Furthermore, overexpression of miR-7, a miRNA involved in the repression of the pro-oncogenic Akt pathway, reduced the proliferation and invasion in different GBM cell lines and in one GBM stem cell line [128], while expression of miR-128 inhibited the proliferation of glioma cells by decreasing the levels of E2F3a [129]. [score:7]
Kefas B. Godlewski J. Comeau L. Li Y. Abounader R. Hawkinson M. Lee J. Fine H. Chiocca E. A. Lawler S. Microrna-7 inhibits the epidermal growth factor receptor and the akt pathway and is down-regulated in glioblastoma Cancer Res. [score:5]
[1 to 20 of 2 sentences]
86
[+] score: 12
Moreover, miR-7-5p downregulates the expression of O-linked N-acetylglucosamine transferase (OGT), leading to decreased expression of vascular endothelial growth factor receptor 2 (VEGFR2) [59]. [score:8]
miR-7-5p [33], miR-128-3p [34], miR-491-5p [35] and miR-218-5p [36] coordinately regulate the expression of EGFR in human GBM. [score:4]
[1 to 20 of 2 sentences]
87
[+] score: 12
For instance, significant down-regulation of circRNA ITCH was discovered in lung cancer and up -regulating its expression could markedly elevate its parental cancer-suppressive gene ITCH through sponging oncogenic miR-7 and miR-214 [9]. [score:9]
Hansen et al. identified ciRS-7, a circular RNA, which acts as a designated miR-7 inhibitor/sponge, has conceptually changed the mechanistic understanding of miRNA networks in cancers [8]. [score:3]
[1 to 20 of 2 sentences]
88
[+] score: 12
For example, the median log2 expression level change of the top 150 TargetScan conserved targets was 0.096 (6.9%) for mir-29 knockdown in fetal lung fibroblasts [89], 0.131 (9.5%) for mir-145 transfection of MB-231 breast cancer cells [90], 0.173 (12.7%) for mir-30 overexpression in melanoma cell lines [91], and 0.465 (38.0%) for mir-7 overexpression in A549 cancer cells [92]. [score:12]
[1 to 20 of 1 sentences]
89
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
When globally analyzed the relapse-related miRNAs-miR-7, miR-100, miR-216 and let-7i—were up-regulated, and miR-486, miR-191, miR-150, miR-487 and miR-342 were down-regulated in early relapse ALL patients [76]. [score:7]
In addition to miR-34, 3 other miRNAs-miR-182-5p, miR-7-5p and miR-320c/d-have also been found as p53 targets in CLL [28]. [score:3]
Furthermore, higher expression of miR-7, miR-198 and miR-633 was found in patients with CNS relapse compared with non-CNS-relapsed ALL [76]. [score:2]
[1 to 20 of 3 sentences]
90
[+] score: 12
miR-7 also serving as a direct regulator of FAK expression by targeting the FAK 3′UTR, as expected, enables suppressing the FAK -mediated malignancies in aggressive breast cancers, such as proliferation, anchorage independent growth, migration, and invasion [65]. [score:9]
In addition, increased FAK expression can rescue the miR-7 negative effect on tumor migration and invasion [65]. [score:3]
[1 to 20 of 2 sentences]
91
[+] score: 12
Since loqs mRNA expression is lowest in the ovaries of loqs [f00791] mutant flies, we analyzed the levels of pre-miR-7 and mature miR-7, a miRNA that is expressed in whole males, manually dissected ovaries, and the female carcasses remaining after removing the ovaries (Figure 2B). [score:5]
The loqs [f00791] mutation caused pre-miRNAs to accumulate in the soma and the germ line and strongly reduced mature miR-7 levels in the female germ line, suggesting that Loqs function is required for miRNA-directed silencing in vivo. [score:3]
While pre-miR-7 increased in all loqs [f00791] homozygous mutant tissues, relative to wild-type or loqs heterozygotes, the disruption of miR-7 production in ovaries was striking: not only did pre-miR-7 accumulate, but also mature miR-7 was dramatically reduced. [score:1]
Thus, Loqs is required for production in vivo of normal levels of miR-7, miR-277, and bantam, and the efficient conversion of pre- let-7 to mature let-7 in vitro. [score:1]
The following probes were used for detection: 5′-UCG UAC CAG AUA GUG CAU UUU CA-3′ for miR-277; 5′-CAG CTT TCA AAA TGA TCT CAC T-3′ for bantam; 5′-ACA ACA AAA UCA CUA GUC UUC CA-3′ for miR-7; 5′-TAC AAC CCT CAA CCA TAT GTA GTC CAA GCA-3′ for 2S rRNA. [score:1]
shtml) accession numbers for the genes and gene products discussed in this paper are: bantam (MI0000387), let-7 (MI0000416), miR-277 (MI0000360), miR-7 (MI0000127), and TAR (RF00250). [score:1]
[1 to 20 of 6 sentences]
92
[+] score: 12
The epidermal growth factor receptor (EGFR) -mediated miRNA miR-7 is a known key player in multiple lung-related diseases and has previously been proposed as a biomarker in serum for chronic obstructive pulmonary disease and is thought to act by suppressing the coupling of SWI/SNF-related matrix -associated actin -dependent regulator of chromatin subfamily D member 1 (SMARCD1) with p53 [101, 102]. [score:8]
Hong C. F. Lin S. Y. Chou Y. T. Wu C. W. MicroRNA-7 compromises p53 protein -dependent apoptosis by controlling the expression of the chromatin remo deling factor SMARCD1J. [score:2]
Using DESeq2, we identified 11 miRNAs as statistically significant DEmiRs after accounting for the level of hemolysis: eca-miR-128, eca-miR-744, eca-miR-197, eca-miR-103 and the closely related eca-miR-107a, eca-miR-30d, eca-miR-140-3p, eca-miR-7, eca-miR-361-3p, eca-miR-148b-3p and eca-miR-215. [score:1]
Eight of these eleven DEmiRs were also reported by edgeR (eca-miR-7, eca-miR-148b-3p and eca-miR-215 missed the significance threshold) (Table 1). [score:1]
[1 to 20 of 4 sentences]
93
[+] score: 12
miR-221, which targets tumor suppressor p27, is up regulated in GBM whereas miR-7 that targets epidermal growth factor (EGFR) is down regulated. [score:9]
In addition, reduced expression of miR-7, miR-128 and miR-34c are linked to poor prognosis in glioblastoma multiforme. [score:3]
[1 to 20 of 2 sentences]
94
[+] score: 12
Kefas B. Godlewski J. Comeau L. Li Y. Abounader R. Hawkinson M. Lee J. Fine H. Chiocca E. A. Lawler S. microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma Cancer Res. [score:6]
Wu D. G. Wang Y. Y. Fan L. G. Luo H. Han B. Sun L. H. Wang X. F. Zhang J. X. Cao L. Wang X. R. MicroRNA-7 regulates glioblastoma cell invasion via targeting focal adhesion kinase expression Chin. [score:5]
Lee K. M. Choi E. J. Kim I. A. microRNA-7 increases radiosensitivity of human cancer cells with activated EGFR -associated signaling Radiother. [score:1]
[1 to 20 of 3 sentences]
95
[+] score: 11
In pancreatic cancer cells, curcumin inhibits cell growth and invasion through up-regulation of miR-7 and down-regulation of its oncogenic target, lysine methyltransferase SET-8 [11]. [score:11]
[1 to 20 of 1 sentences]
96
[+] score: 11
In sporadic Alzheimer's disease (AD), the brain-specific circRNA ciRS-7, which contains sites that are capable of sponging miR-7, was found to be downregulated compared to age-matched control brains, likely by increasing the availability of miR-7 to brain cells in AD [13]. [score:5]
ciRS-7 was also implicated in tumorigenesis, as sequestration of miR-7 by ciRS-7 would be expected to promote the expression of the oncogenic factors EGFR and XIAP [17]. [score:3]
Specific examples illustrating these functions include the exon–intron circRNAs EIciEIF3J and EIciPAIP2, which were found to promote gene transcription [9], and cir-ITCH, which sponged three microRNAs (miR-7, miR-17, and miR-214) and thereby increased the levels of ITCH, an inhibitor of the Wnt/β-catenin signaling pathway [16]. [score:3]
[1 to 20 of 3 sentences]
97
[+] score: 11
Upon maturation, we identified 4 miRNAs (miR-7, miR-9, miR-155, and miR-182) consistently upregulated in aDCs and 4 other miRNAs (miR-17, miR-133b, miR-203, and miR-23b) in tDCs. [score:4]
By analyzing miRNA expression profiles in DCs using qRT-PCR, we identified 4 miRNAs (miR-7, miR-9, miR-155, and miR-182) uniquely overexpressed in aDCs treated for 6 h or 24 h with LPS and IFN- γ compared to untreated immature iDCs and to tDCs cultured with IL-10 and TGF- β. Recent investigations in different immune cell types have shown that TIRs and TNF- α receptor activation results in the rapid expression of miRNAs including miR-9, miR-99b, miR-146a, miR-146b, and miR-155 [29]. [score:4]
Four upregulated miRNAs are important for activation (miR-7, miR-9, miR-155, and miR-182) in aDCs compared to tDCs and iDCs after 6 h and 24 h of maturation. [score:3]
[1 to 20 of 3 sentences]
98
[+] score: 11
However, downregulation of miR-7 with synthesized inhibitor inhibited cell migration in vitro, suppressed cell proliferation, and induced renal cancer cell apoptosis. [score:10]
The top 50 potential miRNAs associated with kidney neoplasms and evidence for the associations with kidney are listed in Table 3. Among the top 50 predicted candidates, 49 miRNA have been confirmed by dbDEMC, and only hsa-mir-7 is not confirmed by dbDEMC. [score:1]
[1 to 20 of 2 sentences]
99
[+] score: 11
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, hsa-mir-127, hsa-mir-502
Sun and coworkers reported that a microRNA (miRNA), miR-7, is a negative regulator of SETD8, inhibits H4K20 monomethylation, and suppresses EMT and the invasive potential of breast cancer cells [61]. [score:6]
The authors demonstrated that SETD8 is a downstream target of miR-7 that binds to SETD8 3′-UTR and inhibits the formation of H4K20me1 by promoting SETD8 mRNA degradation. [score:5]
[1 to 20 of 2 sentences]
100
[+] score: 11
miR-7 also protects dopaminergic neurons against oxidative stress, where it reduces the expression of α-synuclein and leads to enhanced survival [52]. [score:3]
Interestingly, miR-7, which promotes neurite outgrowth and is co-expressed with miR-124 in other cell mo dels [32], is selectively induced in differentiating IKKα+ NPCs (Fig. S4). [score:3]
The induction of miR-7 may contribute to the extensive neurite outgrowth observed in differentiating IKKα+ NPCs (Figs. 2A, B; Fig. S3). [score:1]
Taqman probes were used for qRT-PCR of mature miR-7. Samples were normalized to the small RNA, RNU6. [score:1]
Figure S4 Mature miR-7 accumulates in IKKα+ NPCs. [score:1]
It is intriguing that miR-7, which is implicated in neuronal homeostasis and neurite outgrowth [32], is selectively induced in differentiating IKKα+ NPCs. [score:1]
Thus, in addition to promoting neurite outgrowth, IKKα -induced miR-7 may also contribute to the resiliency of neurons under adverse environmental conditions. [score:1]
[1 to 20 of 7 sentences]