sort by

71 publications mentioning hsa-mir-197

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-197. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 274
Our current results suggest the existence of a novel biochemical inhibition loop; IL-22, as previously shown, through IL22RA1-IL10RB, activates STAT3 which then enhanced the expression of miR-197, and miR-197 targets the expression of IL22RA1, thereby closing the biochemical feedback loop. [score:9]
To study whether miR-197 expression is directly regulated by the IL-22-STAT3 pathway, PHK were treated with a specific STAT3 inhibitor, S3I-201 [34]. [score:7]
However, the biological effects we have observed in keratinocytes overexpressing miR-197; inhibition of proliferation and differentiation (figure 1) probably are the result of additional, more complex effects of miR-197 on additional targets. [score:7]
As can be seen in Fig. S1, the apoptotic rate in control or miR-197 over expressing cells over expression of miR-197 does not activate apoptosis in these cells. [score:5]
0107467.g001 Figure 1 a) HaCaT cells were transfected with miR-197 expressing plasmid or HTR expressing plasmid as a control. [score:5]
miR-197 suppresses the expression of IL22RA1 by binding to its 3′UTR. [score:5]
However, despite the high levels of IL-22 in the blood of psoriatic patients and high expression of IL22RA1 in psoriatic patients’ skin, the expression of miR-197 is decreased in their KC. [score:5]
After 24 h cells were harvested and subjected to miR-197 qPCR as in *p = 0.05. a) HaCaT cells were transfected with miR-197 expressing plasmid or HTR expressing plasmid as a control. [score:5]
Luciferase expression was significantly lower in cells transfected with the luciferase-IL22RA1-3′UTR plasmid together with miR-197 expressing plasmid than in cells transfected with a plasmid lacking the 3′UTR of IL22RA1 (Fig. 4b). [score:5]
It is noteworthy that despite the observed inhibition of proliferation of HaCaT cells stably over expressing miR-197, exposure of HaCaT cells to antago-miR-197 did not affect cell proliferation. [score:5]
b) HEK-293T cells were transfected with psi-CHECK2 vectors encoding luciferase (vector), luciferase fused to the IL22RA1-3′UTR (IL22RA1 wt 3′UTR), or luciferase fused to a mutated in miR-197 binding to the IL22RA1 3′UTR (IL22RA1 mut 3′UTR) together with 2 µg miR-197 expressing plasmid or 2 µg scramble RNA expressing plasmid. [score:5]
It is tempting to speculate that co-evolution of the miR-197 gene and the IL22RA1 subunits occurred in human and some other mammals, and that abnormal function of this interaction contributes to the pathological development of psoriatic skin disease in these species. [score:4]
To determine whether IL22RA1 or IL10RB are miR-197 targets, cells were co -transfected with a plasmid containing the IL22RA1 3′UTR or the IL-10RB 3′UTR downstream of the luciferase reporter together with a miR-197 expressing plasmid, and luciferase reporter assay was performed 72 h later. [score:4]
Our results reveal that IL22RA1 is regulated by miR-197; moreover, they strongly suggest that IL-22, activates the transcription of miR-197 through STAT3 signaling, thus generating a biochemical feedback loop as summarized in Fig. 5. It was previously shown that IL-22 enhances KC proliferation, increases the thickness of reconstituted human epidermis, inhibits KC differentiation [24], [39], and enhances KC migration [40], [41]. [score:4]
These results, taken together, indicate that IL22RA1 and not IL-10RB is a direct biochemical target of miR-197. [score:4]
The IL22RA1 subunit is a direct target of miR-197. [score:4]
Effect of HaCaT cells transfected with miR-197 expressing plasmid or HTR expressing plasmid as a control, were subjected to stained with annexin V-FITC as apoptosis marker and PI analysis and where assay by flow cytometry a) percentage annexin stained cells average of three independent experiments b) Represented experiment flow cytometry output. [score:4]
IL-22 enhances the expression of miR-197. [score:3]
We therefore asked whether the putative promoter of miR-197 is a target of activated STAT3. [score:3]
Our work shows that only IL22RA1, but not IL-10RB, is a bona-fide target of miR-197 (Fig. 4, S1). [score:3]
These results indicate that the increase in miR-197 expression in response to IL-22 is mediated through STAT3. [score:3]
We previously showed that miR-197 expression is significantly decreased in psoriatic lesions [4]. [score:3]
Over expression of pre-miR-197 in PHK cells led to a dramatic decrease in the level of IL22RA1 protein (Fig. 4c–d). [score:3]
S3I-201 prevents the IL-22 -induced expression of miR-197 (Fig. 3a). [score:3]
Several studies showed that miR-197 expression is altered in several cancer types [28]– [31] and in type II diabetes [32]. [score:3]
Moreover, the fact that miR-197 targets only the IL22RA1 subunit of the IL-22 receptor emphasizes the role it might play in the pathogenesis of psoriasis. [score:3]
Stably expressing miR-197 HaCaT cells were chosen as a mo del system, rather than primary human KC (PHK), due to the fact that miRNA mimics are diluted and lost during cell division. [score:3]
Small changes in IL-22 concentration have a dramatic effect on the expression levels of miR-197 and thereby on the levels of IL22RA1 protein. [score:3]
Figure S3 Antago to miR-197 releases miR-197 inhibition impose on IL22RA1-3′UTR depended. [score:3]
Recently we have shown that miR-197 expression is down regulated in the psoriatic lesions compared to normal or uninvolved psoriatic skin [4]. [score:3]
The effect of miR-197 on IL22RA1 expression was further examined by Western blot (WB) analysis. [score:3]
Figure S1 miR-197 over expression does not elevate apoptosis rate in cells. [score:3]
B) HaCaT cells were co -transfected with vector or IL10RB-3′UTR plasmid with a miR-197 expressing plasmid at different concentrations. [score:3]
In this manuscript we focused on IL22RA1 as target of miR-197. [score:3]
These results indicate that IL-22 signaling enhances the expression of miR-197. [score:3]
Interestingly, treatment of cells with IL-22 increases the expression of miR-197 (Fig. 2). [score:3]
We asked whether these biological effects of IL-22 will be affected by miR-197 over -expression. [score:3]
In this study, we establish that the IL-22 receptor subunit IL22RA1 is a target of miR-197 (Fig. 4, and figure S1C). [score:3]
STAT3 mediates between IL-22 and miR-197 expression. [score:3]
The fact that there is no change in the methylation of this region between psoriatic and normal skin could be either due to lack of correlation between this CpG island methylation and the expression of miR-197 or due to other epigenetic mechanisms being responsible to this silencing in psoriasis. [score:3]
org) revealed that both subunits are potential targets of miR-197. [score:3]
To study the cross-talk between miR-197 and IL-22 pathway, we monitored the expression of miR-197 in primary human KC (PHK) cells treated with different concentrations of IL-22. [score:3]
Total RNA of HaCaT-miR-197 or HaCaT-HTR was subjected to RT-PCR analysis for K10 and K14 and normalized by β-Actin expression. [score:3]
Furthermore, in PHK that were grown in high Ca [++] medium, conditions known to drive keratinocytes towards differentiation [33], MiR-197 expression was elevated compared to its expression in cells grown in low Ca [++] medium (Fig. 1f). [score:3]
We now show that miR-197 leads to decreased proliferation and migration of KC in vitro, along with increased expression of KC differentiation marker, involucrin and keratin 10. [score:3]
The mutant was co -transfected with the miR-197 expression plasmid as before and luciferase activity was assessed. [score:3]
IL-22 enhances miR-197 expression. [score:3]
Anago-miR-197 (Anti-miR miRNA Inhibitors, 5 nmol ID AM10354) was purchased from Applied Biosystems). [score:3]
Our result in psoriatic lesion showed a decrease in the expression of miR-197, therefore we tried to determine the effect of hsa-miR-197 depletion on KC proliferation. [score:3]
Figure S4 IL10RB subunit is not a target of miR-197. [score:3]
The results of cells transfected with vector lacking the IL10RB-3′UTR and without miR-197 expressing plasmid was valued as 100%. [score:3]
Bioinformatics predict that miR-197 targets the two units of the hetrodimeric IL-22 receptor, namely IL22RA1 and IL-10RB. [score:3]
It is tempting to speculate that miR-197 has a role in imposing such tight and delicate regulation. [score:2]
MiR-197 over -expression decreases proliferation and induces differentiation of KC. [score:2]
Mir-197 inhibits the effects of IL-22 on KC phenotypes. [score:2]
All proving that miR-197 seed sequence at the IL22RA1 3′UTR is essential for the regulation of IL22RA1 by miR-197. [score:2]
We previously showed by qRT- PCR, that the expression of mir-197 was ∼3-fold lower in psoriatic skin as compared to normal skin. [score:2]
Despite the high output of the IL-22 signaling pathway, miR-197 is down regulated in psoriasis [4]. [score:2]
A knockdown of miR-197 using antago-mir did not affect the growth or proliferation of HaCaT cells (Figure S2). [score:2]
The ∼2000 bases up stream of the pre-miR-197 sequences comprise the regulatory elements of promoter and contain one CpG island (Figure 7a). [score:2]
In contrast, the other subunit of the receptor to IL-22, IL10RB, seems not to be a target of miR-197, as indicated by the luciferase reporter assays with the IL10RB 3′UTR and miR-197 (Figure S4). [score:2]
We were able to show by ChIP assay that one of its targets is the miR-197 putative promoter region (Fig. 3c). [score:2]
These results indicate that miR-197 slows KC proliferation rate and directs them towards differentiation. [score:2]
b–c) Cell Proliferation of HaCaT cells stably expressing hsa-miR-197 or the HTR control RNA was assessed by (b) BrdU incorporation (c) MTT and assays. [score:2]
c) Western blot (WB) analysis of IL22RA1 protein 48 h after transfection with 5/10 nM of scramble control pre-miR or with 5/10 nM of pre-miR-197. [score:1]
There is no mouse homolog of miR-197. [score:1]
BrdU incorporation was decreased in HaCaT-miR-197 cells relative to HaCaT cells transfected with HTR control RNA (HaCaT-HTR) at both the 24 h and 72 h time points (Fig. 1b). [score:1]
a) Using the miRviewer program, the present of miR-197 was examined in various animals genome. [score:1]
a) miR-197 binding site on IL22RA1 3′UTR. [score:1]
The plasmids pMSCV-miR-197 and pMSCV-HTR were kindly provided by Agami, R. [64]. [score:1]
The miR-197 gene is located on human chromosome 1p13.3, in a region distinct from other known transcription units. [score:1]
a) Schematic presentation of miR-197 putative promoter. [score:1]
We can see that the methylation pattern of the mapped CpG island in the miR-197 putative promoter, in psoriatic samples is similar to normal skin (figure 7b). [score:1]
HaCaT-miR-197 had a significantly lower level of baseline migration, covering only 5–10% of the empty area at 48 h, without any significant change in migration following IL-22 treatment (Fig. 6b). [score:1]
After 24 h cells were harvested and subjected to miR-197 qPCR as in *p = 0.05. [score:1]
DNA methylation of the miR-197 putative promoter regions. [score:1]
In summary, this study revel the feedback loop between IL22 and miR-197 and suggests that miR-197 acts as a modulator, linking between the immune system and KC, which may play a substantial role in the pathogenesis of psoriasis. [score:1]
0107467.g007 Figure 7 a) Schematic presentation of miR-197 putative promoter. [score:1]
Evolutionary conservation of miR-197 and its putative binding site on IL22RA13′UTR. [score:1]
c) Alignment of the IL22RA1 3′UTR of some of the above species and the miR-197 putative binding site is marked. [score:1]
0107467.g008 Figure 8 a) Using the miRviewer program, the present of miR-197 was examined in various animals genome. [score:1]
Yet the binding site of miR-197 in the 3′UTR of IL22RA1 is found only in primates, dog, cow and horse but not in mouse or rat Figure 8C. [score:1]
Putative interactions of miR-197 with the IL22RA1 3′UTR and IL-10RB 3′UTR are shown in Fig. 4a and Fig. S3a. [score:1]
According to the miRBase data, miR-197 gene is even more infrequent, being present only in primates, horse, cow and dog [49]. [score:1]
miR-197 slows proliferation and migration of KC. [score:1]
Figure S5 Effect of antago-miR-197 on KC proliferation. [score:1]
Moreover, there is a significant difference (p = 0.027) when comparing the luciferase active of luciferase-IL22RA1-3′UTR plasmid in the presence or absence of miR-197. [score:1]
The same results we observed with 5 nM of pre-miR-197 RNA, as seen in figure S2. [score:1]
In parallel one set of cells was transfected with 5 nM of mimic miR-197 together with antago-miR-197. [score:1]
The immortalized KC cell line HaCaT was stably transfected with miR-197 (HaCaT-miR-197) (Fig. 1a). [score:1]
This miR-197 repression was released in cells transfected with pre-miR-197 RNA together with antago-miR-197, this also suggests that the antago miR-197 is active (Figure S3). [score:1]
Feedback loop mo del between IL-22 signaling and miR-197. [score:1]
The effect of miR-197 on proliferation and differentiation of KC. [score:1]
Our results suggest that the antago-miR-197 had no significant effect on KC proliferation (figure S5 a–b). [score:1]
The addition of IL-22 resulted in significant enrichment of precipitation of the miR-197 putative promoter area by p-STAT3 antibodies (Fig. 3c). [score:1]
We and others previously showed that miR-197 is significantly down regulated in psoriatic lesions compared to normal skin [4], [27]. [score:1]
Cells were harvested and subjected to miR-197 specific qPCR. [score:1]
0107467.g004 Figure 4 a) miR-197 binding site on IL22RA1 3′UTR. [score:1]
In the present study we did not detect any difference in cytosine methylation of the putative miR-197 promoter from biopsies of normal, uninvolved, or psoriatic skins. [score:1]
Pri-miR-197 marked in blue; mature miR-197 marked in red; miRNA “seed” marked in blue box. [score:1]
0107467.g006 Figure 6HaCaT-miR-197 or control HaCaT–HTR were subject to; a) BrdU incorporation as in figure 1a. [score:1]
We hypothesized that cytosine methylation of the miR-197 putative promoter in psoriatic lesion compare to normal skin might be different and thereby explain why miR-197 is silenced in psoriasis despite the high levels of IL-22 in the patients’ blood. [score:1]
Our results show that miR-197 is activated by IL-22 at a specific range of concentrations. [score:1]
d) Densitometry analysis of 4 WBs analysis of IL22RA1 protein 48 h after transfection with 10 nM of scramble control RNA (scramb), or 10 nM pre-miR-197 *p = 0.0000818. [score:1]
STAT3 binds to the putative promoter region of miR-197 after IL-22 treatment. [score:1]
Figure 4b (IL22RA1 mutant 3′UTR panel) clearly demonstrates that miR-197 has lesser effect on the mutated IL22RA1-3′UTR; there is no difference between the luciferase active in the presence or absence of miR-197 (p = 0.2199). [score:1]
The bioinformatics tools Tfsitescan [36] and TFSEARCH [37] mapped four putative STAT binding sites (TTN [(4–6)]AA) [38] within the ∼2000 bases upstream of the miR-197 gene, its potential promoter (Fig. 3b). [score:1]
The tone of green defined the degree of conservation b) Alignment of pre-miR-197 gene sequences of few primates, mouse, rat, cow, dog, horse, and guinea pig. [score:1]
HaCaT cells were co -transfected with vector plasmid or luciferase-IL22RA1-3′UTR plasmid and 5 nM of scrambled control RNA, or mimic miR-197 RNA. [score:1]
These results indicate that upon treatment of PHK by IL-22, activated STAT3 binds to the putative miR-197 promoter region. [score:1]
HaCaT-miR-197 or control HaCaT–HTR were subject to; a) BrdU incorporation as in figure 1a. [score:1]
Figure S2 Effect of antago-miR-197 on KC proliferation. [score:1]
The experiment shown in figure S3 and discussed in the results, proves that the antago-miR-197 is indeed active, since it releases miR-197 effect on reporter mRNA containing the 3′UTR of IL22RA1 (figure S3). [score:1]
Total RNA of HaCaT-miR-197 or HaCaT-HTR was subjected to qPCR analysis for involucrin, keratin 10 (K10) or keratin 14 (K14) and normalized by Rplp0. [score:1]
The miRviewer program [48] reveals that the miR-197 gene exists only in some placental mammals (primates, horse, cow, dog, cat and guinea pig; Fig. 8 a,b). [score:1]
HaCaT cells were transfected with antago-miR-197 or scrambled control RNA. [score:1]
We show that miR-197 activation by IL-22 is mediated through STAT3 (Fig. 3). [score:1]
This implies that miR-197, by controlling IL22RA1, can fine-tune several aspects of cytokine signaling pathways. [score:1]
Stably transfected HaCaT cells were generated by transfecting with plasmids pMSCV-miR-197 or pMSCV-HTR [64] and lines were achieved after selection for 4 weeks with Blasticidin at a final concentration of 16 µg/ml. [score:1]
In parallel we treated HaCAT with antago-miR-197, in the presence or absence of IL-22. [score:1]
To further explore miR-197 effect on IL22RA1, we generated a IL22RA1-3′UTR-luc mutant in which four nucleotides in the seed response sequence were changed from GUGGUGAA to GUaacaAA. [score:1]
The expression of involucrin, K10 and K14, KC differentiation markers were evaluated; involucrin and K10 were higher in HaCaT-miR-197 cells vs. [score:1]
[1 to 20 of 122 sentences]
2
[+] score: 50
Therefore, over -expression of miR-21-3p and down -expression of miR-197-3p targeting L1CAM, SERPINA3 and TSPAN3, respectively, could induce or maintain the inflammatory process in mutated desmoid tumor. [score:7]
To further explore the role of the reduced expression of miR-197-3p in mutated sporadic DT, we investigated the expression of two target genes, SERPINA3 and TSPAN3, that are negatively regulated by miR-197-3p [24]. [score:6]
Expression of the miR-21-3p and miR-197-3p mRNA targets. [score:5]
The miR-21-3p is a positive regulator for L1CAM and COL1A1 [21, 22] and a negative regulator for MAT2A [23], while SERPINA3 and TSPAN3 are inversely correlated to miR-197-3p expression [24]. [score:5]
The finding of dysregulated miR-197-3p and miR-21-3p expression, in combination with the mutational analysis of the CTNNB1 gene, could also be used by pathologists as an additional tool for a correct diagnosis in case of unclear pathological assignment. [score:5]
Furthermore, our data suggest that the analysis of the miR-197-3p and miR-21-3p expression, in combination with the mutational analysis of the CTNNB1 gene, could be today a useful tool for a correct diagnosis of sporadic DTs. [score:4]
miR-21-3p was more present in M than in Wt group, whereas miR-197-3p was down-regulated in M group. [score:4]
We selected three mRNAs, Collagen Type I, Alpha 1 (COL1A1), SAM synthetase2 (MAT2A) and L1 cell adhesion molecule (L1CAM), regulated by miR-21-3p, and two miRNAs, Serpin Family member 3 (SERPINA3) and Tetraspanin 3 (TSPAN3), regulated by miR-197-3p by DIANA-TarBase v7.0 database and literature data. [score:3]
Decreased levels of miR-197-3p induce a TSPAN3 and SEPINA3 mRNA over -expression in M vs. [score:3]
miR-21-3p and miR-197-3p are involved in the inflammatory process and pro-fibrotic effect via their mRNA targets [21– 24]. [score:3]
However, in pancreatic cancer cells miR-197 act as a negative regulator of the delta-catenin, an adhesive junction protein of the armadillo/beta-catenin superfamily [29]. [score:2]
Although the physiological function of the SERPINA3 and TSPAN3 proteins in sporadic DTs is unknown, in HCC cell mo del the inflammatory pathway interferes with mature miR-197-3p biosynthesis [30] and, in particular, increased SERPINA3 levels were associated to the acute and chronic inflammation [31]. [score:1]
The miR-197-3p role in the tumors is not yet fully understood. [score:1]
Among them, miR-21-3p and miR-197-3p showed a different distribution between two subgroups (Figure 2). [score:1]
[1 to 20 of 14 sentences]
3
[+] score: 27
Other miRNAs from this paper: hsa-mir-145, hsa-mir-129-2, hsa-mir-328, hsa-mir-505, hsa-mir-1207
Among the coexpressed mRNAs, 17 mRNAs were also miRNA targets reported by at least one miRNA target database, including WNK1 for miR-197-3p. [score:7]
mRNAs coexpressed with pleiotropic miRNAs were enriched for RNA metabolism (miR-505-5p), ubiquitin -dependent protein catabolism (miR-197-3p, miR-328) and chromatin assembly (miR-328). [score:3]
These highly pleiotropic miRNAs were associated with a large number of mRNAs (1109 mRNAs in total; 396 coexpressed mRNAs for miR-505-5p, 241 for miR-197-3p, 177 for miR-145-5p, and 649 for miR-328). [score:3]
Our findings do suggest, however, that key miRNAs (“hub” miRNAs, such as miR-197-3p) are shared across CM traits and co-express with genes previously associated with CM traits, e. g. WNK1 [38]. [score:3]
The coexpressed mRNAs for miR-197-3p and miR-328 were enriched for cellular macromolecule catabolism (P = 7.67 × 10 [−7]) and ubiquitin -dependent protein catabolism (P = 1.86 × 10 [−10]). [score:3]
Gene ontology enrichment analysis (Additional file 1: Table S15) revealed that coexpressed mRNAs for the most pleiotropic miRNAs were enriched for RNA metabolism (miR-505-5p), ubiquitin -dependent protein catabolism (miR-197-3p and miR-328), and chromatin assembly (miR-328). [score:3]
Fifty miRNAs were associated with three or more CM traits and four were associated with four CM traits (miR-197-3p, miR-328, miR-505-5p, miR-145-5p) (Table  3 and Fig.   1). [score:1]
miRNAs miR-505-5p, miR-197-3p, miR-145-5p, and miR-328 exhibited significant associations with BMI, SBP, DBP, and TG. [score:1]
In another recent study, circulating levels of miR-197 were associated with dyslipidemia in participants with metabolic syndrome and miR-197 levels correlation tightly to body mass index (p = 0.029) [34]. [score:1]
Four mRNAs (FAM13A, CSF2RB, HIST1H2AC, WNK1) were associated with all 6 CM traits (FDR < 0.001) and four miRNAs (miR-197-3p, miR-328, miR-505-5p, miR-145-5p) were associated with four CM traits (FDR < 0.05). [score:1]
Another notable finding was the association between miR-197-3p with SLC4A1, which encodes Band 3 anion transport protein. [score:1]
[1 to 20 of 11 sentences]
4
[+] score: 26
The miRWalk database also contains experimentally validated target genes for the additional three miRNAs (miR-1224-3p, miR-197 and miR-532-3p) that were differentially overexpressed in response to both proanthocyanidin extracts (Table 5), although the number of target genes for these miRNAs was much lower than for miR-30b*. [score:7]
On the other hand, the two procyanidin extracts upregulated the expression of miR-1224-3p, miR-197 and miR-532-3p. [score:6]
However, fatty acid synthase, which plays a central role in liver lipogenesis [37], is a validated target gene of miR-197, which was upregulated by both proanthocyanidin extracts. [score:6]
miR-1224-3p, miR-197 and miR-532-3p were differentially expressed after treatment with the two procyanidin extracts; however, only miR-30b* was differentially expressed in response to all the three treatments. [score:5]
It has been reported that oligomeric forms of proanthocyanidins specifically control endogenous liver lipid production [29], in accordance with the fact that miR-197 was only modulated by the extracts. [score:1]
has-miR-197 BRCA1 Type of ubiquitin ligase (E3). [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 25
However, the identification of target genes specific for miR-519d is especially challenging because it shares target sequence specificity with miR-17-5p, miR-20 A and B, as well as miR-106 A and B. Other microRNAs overexpressed more than twofold in human male breast cancer, but not yet described in female breast cancer are miR-183, miR-197, miR-493-5p, and 519d. [score:7]
[23]), miR-197 targets the tumor-suppressor FUS1 [15], whereas for miR-493-5p convincing experimental data for a validated target gene are still missing. [score:7]
miR-21, miR519d, miR-183, miR-197, and miR-493-5p were identified as most prominently up-regulated, miR-145 and miR-497 as most prominently down-regulated in male breast cancer. [score:7]
Up-regulation of miR-519d, miR-183, miR197, and miR-493-5p (more than twofold in comparison to gynecomastia, see Table 2) has not been reported so far in female breast cancer. [score:4]
[1 to 20 of 4 sentences]
6
[+] score: 24
a High level of six hsa-miRNAs randomly selected for the validation of expression level by qRT-PCR is consistent with the result from miRNA microarray; b Low level of six hsa-miRNAs randomly selected for the validation of expression level by real-time RT-PCR is consistent with the result from miRNA microarray Fig.  3Validation of 12 hsa-miRNAs using qRT PCR shows hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p were up-regulated and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p were down-regulated in each of the peripheral blood samples from narcolepsy patients. [score:11]
Consistent with the results from the microRNA microarray (Fig.   2a, b), hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p were up-regulated and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p were down-regulated in each of the peripheral blood samples (Fig.   3). [score:7]
Among these miRNAs with significant change, 12 hsa-miRNAs were validated by qRT PCR which showed that hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p had significantly high expression and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p had significantly low expression in each of the peripheral blood samples. [score:5]
In conclusion, we have identified 12 aberrant miRNAs (hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p, hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p) in plasma from patients with sleep disorder. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 23
The miR-27a and miR-197 showed expression patterns that go from down-regulation between normal cervical tissues and CINI and CINIII samples to slight up-regulation in cervical cancer. [score:9]
Among the miRNAs that were down-regulated between normal and pre-neoplasic cervical samples, but had increased expression in cervical cancer samples, were miR-106a, miR-205, miR-197, miR-16, miR-27a and miR-142-5p. [score:6]
Six miRNAs displayed relative decreased expression in the transition from normal cervix to atypical dysplasia and increased expression in the transition from atypical dysplasia to cervical carcinoma, namely miR-106a, miR-205, miR-197, miR-16, miR-27a and miR-142-5p (Figure 4B). [score:5]
The expression pattern of miR-197 is similar to that of miR-27a suggesting a similar role. [score:3]
[1 to 20 of 4 sentences]
8
[+] score: 22
As mir-197 has been reported to regulate the expression of tumour suppressor gene FUS1 [67] and to be upregulated in type two diabetes patients [32], it is plausible that the effect of rs6658641 genotype on downstream expression and metabolic traits is mediated via the miRNA expression level. [score:13]
SNP ID small RNA ID Type Chr P-value eQTL P-value GWAS GWAS phenotype rs8033963 hsa-miR-184 mature-miRNA 15 1.98E-06 1.01E-02 BMI rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 4.93E-02 BMI rs2440129 hsa-miR-195-3p mature-miRNA 17 2.44E-05 3.58E-02 BMI rs2053005 SNORD18A snoRNA 15 6.83E-09 4.57E-02 BMI rs16868443 hsa-miR-653 mature-miRNA 7 1.38E-04 3.70E-02 WHR(adjBMI) rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 7.89E-04 LDL rs2986039 hsa-miR-1307-3p mature-miRNA 10 6.31E-06 1.84E-02 HDL rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 1.14E-03 TCWhile on the whole, none of the cis-SNPs were genome-wide significant in the GWAS data, they were significantly enriched for nominally significant (p<0.05) SNPs in the BMI GWAS results ([65], binomial p = 0.007), indicating either their pleiotropic effect, or metabolic trait regulation through small RNA expression levels. [score:4]
SNP ID small RNA ID Type Chr P-value eQTL P-value GWAS GWAS phenotype rs8033963 hsa-miR-184 mature-miRNA 15 1.98E-06 1.01E-02 BMI rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 4.93E-02 BMI rs2440129 hsa-miR-195-3p mature-miRNA 17 2.44E-05 3.58E-02 BMI rs2053005 SNORD18A snoRNA 15 6.83E-09 4.57E-02 BMI rs16868443 hsa-miR-653 mature-miRNA 7 1.38E-04 3.70E-02 WHR(adjBMI) rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 7.89E-04 LDL rs2986039 hsa-miR-1307-3p mature-miRNA 10 6.31E-06 1.84E-02 HDL rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 1.14E-03 TC While on the whole, none of the cis-SNPs were genome-wide significant in the GWAS data, they were significantly enriched for nominally significant (p<0.05) SNPs in the BMI GWAS results ([65], binomial p = 0.007), indicating either their pleiotropic effect, or metabolic trait regulation through small RNA expression levels. [score:4]
Rs6658641 has a significant (FDR<5%, p<1.6×10 [−4]) cis association with mir-197-3p in our data (Table 1), GNAI3 mRNA in three tissues (Table 2), as well as nominally significant associations to metabolic traits in GWAS. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 22
Another study revealed a role of miR-197 as tumour suppressor in mediating apoptosis in multiple myeloma cells by targeting MCL1 [15], while in non-small cell lung cancer it contributed, when down-regulated, to chemoresistance through the miR-197/CKS1B/STAT3 -mediated PD-L1 network [16]. [score:8]
The expression levels of miRNAs were ranked according to BH values and the top five significant miRNAs were: miR-337-3p, miR-185-5p, miR-485-3p, miR-197-3p, and miR-299-5p, all down-regulated in MPM. [score:6]
We observed a statistically significant down-regulation in MPM samples, after Bonferroni’s correction, for miR-197, miR-185 and miR-299 (see Table  1), whereas we could not validate the results for miR-337 and miR-485. [score:4]
microRNALog [2](FC) p-value miR-197-3p −2.540 3.72 × 10 [−7] miR-185-5p −2.742 2.22 × 10 [−4] miR-299-5p −1.239 0.0014 miR-337-3p −0.758 0.0201 miR-485-3p −0.488 0.1886 In addition, from our microarray analysis we could confirm previous findings from several high-throughput studies where mesothelial cell lines or normal mesothelial tissues were used as controls (Table  2). [score:1]
This approach allowed the identification of six miRNAs (miR-15b, miR-126, miR-145, miR-185, miR-197, and miR-299), three of which (i. e. miR-185, miR-197 and miR-299) have never been linked, to the best of our knowledge, to MPM carcinogenesis. [score:1]
microRNALog [2](FC) p-value miR-197-3p −2.540 3.72 × 10 [−7] miR-185-5p −2.742 2.22 × 10 [−4] miR-299-5p −1.239 0.0014 miR-337-3p −0.758 0.0201 miR-485-3p −0.488 0.1886 In addition, from our microarray analysis we could confirm previous findings from several high-throughput studies where mesothelial cell lines or normal mesothelial tissues were used as controls (Table  2). [score:1]
Thus, overall, we confirmed the role played by miR-126, miR-15b and miR-145 and, in addition, we suggest a role for miR-185, miR-197, and miR-299 in MPM. [score:1]
[1 to 20 of 7 sentences]
10
[+] score: 21
In order to further understand the role of aberrant miRNAs in physiological functions and biologic processes in arsenite -induced neoplastic transformation cells, 11 downregulated miRNAs (miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, and miR-33b-5p) and six upregulated miRNAs (miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, and miR-141-3p) (Table S2) were selected, and their target genes were predicted with the TargetMiner, miRDB, and TarBase databases. [score:11]
Among the 191 dysregulated miRNAs, seventeen miRNAs (downregulation miRNAs: miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, miR-33b-5p; upregulation miRNAs: miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, miR-141-3p, Table S2) were selected for bioinformatics analysis. [score:8]
On the contrary, miRNAs like miR-197-3p, miR-127-3p, and miR-490-3p regulate few genes and are on the edge of the network, suggesting these miRNAs were less important in arsenite-transformed cells. [score:2]
[1 to 20 of 3 sentences]
11
[+] score: 20
Indeed, STAT6 silencing decreases miR-197 expression, leading to increased FOXJ2 expression and subsequent increases in HMGCoA-R, HMGCoA-S1, IDI1, and cholesterol synthesis [42]. [score:5]
Dubey R. Saini N. STAT6 silencing up-regulates cholesterol synthesis via miR-197/FOXJ2 axis and induces ER stress -mediated apoptosis in lung cancer cells Biochim. [score:4]
Milenkovic et al. [72] found that in vivo supplementation with nine different polyphenols modulated the expression of some combination of miRNAs, including miR-10b, miR-30, miR-144, miR-197, and miR-370, all of which are regulators of cholesterol metabolism [5, 27, 42, 63, 73]. [score:4]
Further studies showed that treatment of lung cancer cells with miR-197 led to decreases in expression of HMGCoA-R, HMGCoA-S1, and isopentenyl-diphosphate delta isomerase 1 (IDI1) [42]. [score:3]
Knockdown of miR-197 revealed an increase in forkhead box J2 (FOXJ2), a transcription factor that regulates cholesterol synthetic genes. [score:3]
For example, STAT6 binds the promoter region of certain miRNAs in vitro, including miR-197 [42]. [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 20
In contrast, in the case of miR-197-3p, which is constitutively highly RISC associated (Figure 1), expression of a similar cognate target mRNA species had no significant effect (Figure 5B). [score:5]
As shown in Figure 1A, and detailed in Supplementary Table S1, we observed that several of these highly expressed miRNAs were either more highly RISC associated (e. g., miR-197-3p, miR-191-5p, miR-92a-3p and miR-92b-3p) or significantly less RISC associated (e. g., miR-22-3p, miR-27b-3p and miR-101-3p) than the average miRNA. [score:3]
To test this hypothesis, we used some of the same sensor constructs analysed in Figure 3 and overexpressed the encoded sensor mRNAs specific for miR-22-3p, miR-101-3p and miR-197-3p in 293 cells. [score:3]
A comparison with 293 cells showed that miR-197-3p was overrepresented in RISC in all three cell lines that express this miRNA. [score:3]
We note, however, that RISC association does not perfectly predict functionality in this assay, e. g. miR-191-5p appears to be a less effective inhibitor than miR-197-3p yet is found in RISC at levels that are ∼4-fold higher (Figure 3A). [score:2]
As shown in Figure 1C, we were able to fully confirm the preferential RISC association of miR-92a-3p/miR-92b-3p and miR-197-3p, and the weak RISC association of miR-101-3p and miR-22-3p, by analysis. [score:1]
However, this was not observed at 3 days after transfection (miR-22-3p levels were 1.03 ± 0.56 relative to control cells; miR-101-3p levels were at 0.98 ± 0.19; and miR-197-3p levels were 1.16 ± 0.47. [score:1]
The most highly RISC -associated endogenous miRNA, miR-197-3p, was found to be ∼59 times more RISC associated than the average miRNA, while the least RISC -associated miRNA, miR-1307-5p, was ∼31-fold less highly RISC associated than the average miRNA (Supplementary Table S1). [score:1]
This is a total difference of >1800-fold and implies, assuming that miR-197-3p is 100% in RISC, that <0.1% of the miR-1307-5p detected in these 293 cells is actually present in RISC. [score:1]
[1 to 20 of 9 sentences]
13
[+] score: 18
Several miRs are evident in the pathologies of both MetS and sepsis; MiR-122 regulates lipid synthesis and oxidation, and also serves as a biomarker in hepatic ischemia, viral hepatitis and sepsis; MiR-150 is downregulated in sepsis and correlates with its severity as assessed by clinical scoring, but is upregulated in dysglycemia and diabetes mellitus; MiR-182 regulates glucose levels and its metabolism, and is also upregulated in sepsis; and miR-197, −375, −155 and −132 show dual roles in both infection control and MetS (Supplementary Material). [score:12]
Host microRNA miR-197 plays a negative regulatory role in the enterovirus 71 infectious cycle by targeting the RAN protein. [score:4]
Examples include miR-132, with established roles both in MetS and in the cellular response to viral infections (Lagos et al., 2010; Meydan et al., 2016), and miR-197, dysregulated in adipose tissue dysfunction, and in pulmonary and enteroviral infections (Tang et al., 2015). [score:2]
[1 to 20 of 3 sentences]
14
[+] score: 16
Our data also reiterate the senescence -associated up-regulation of miR-373* and miR-663 and down-regulation of miR-197 observed in WI-38 cells [5] although less is known about the targets of these miRNAs. [score:9]
Our data also corroborate the up-regulation of miR-373* and miR-663 and down-regulation of miR-197 observed in senescent and quiescent WI-38 cells [5]. [score:7]
[1 to 20 of 2 sentences]
15
[+] score: 16
Among the downregulated miRNAs in leiomyomas, the authors identified miR-16, miR-197 and miR-224, three miRNAs we observed to be downregulated in progestin -induced breast cancer [82], highlighting the importance of miR-16 as a tumor suppressor in different cellular contexts. [score:9]
The comparison between control- and MPA -treated cells revealed that 16 miRNAs were significantly modulated by more than two-fold (P < 0.05, Figure 1A), nine miRNAs were upregulated (miR-191*, miR-17*, miR- 470*, miR-451, miR-702, miR-434-3p, miR-493, miR-23a* and miR-485*) and seven were downregulated (miR-378*, miR-376a, miR-224, miR-190b, miR-16, miR-410 and miR-197) (Figure 1B). [score:7]
[1 to 20 of 2 sentences]
16
[+] score: 15
In SC fat, expression of miR-27a, miR-30e, miR-140, miR-155, miR-210 was significantly higher and expression of miR-147 and miR-197 was lower in NGT as compared to the T2D group 10.1371/journal. [score:4]
Our data suggest that expression of miR-17-5p, miR-132, miR-134, miR-181a, miR-27a, miR-30e, miR-140, miR-147, miR-155, miR-197, and miR-210 play a role in the link between adipose tissue dysfunction and the development of obesity associated disorders including type 2 diabetes. [score:4]
In SC fat, expression of miR-27a, miR-30e, miR-140, miR-155, miR-210 was significantly higher and expression of miR-147 and miR-197 was lower in NGT as compared to the T2D group 10.1371/journal. [score:4]
miR-197 expression in SC fat correlates with fasting plasma glucose (r = 0.7, p = 0.004) and glucose infusion rate during in the clamp (r = −0.77, p = 0.002). [score:3]
[1 to 20 of 4 sentences]
17
[+] score: 15
The differential expression of mir-494, mir-197 and the predicted microRNA target gene TNFSF14 was verified by real-time PCR and ELISA. [score:5]
We analyzed the expression of mir-494 and mir-197 with real-time PCR and confirmed that the expression was significantly decreased in MS patients compared with controls (P = 0.02 and P = 0.04; Figure 3A-B). [score:4]
Figure 3 Verification of the differential expression of A) mir-494 and B) mir-197 between MS patients (n = 16) and healthy controls (n = 12) by real-time PCR. [score:3]
To verify the results from the DNA microarray analysis we selected mir-494 and mir-197 because they were among the microRNAs that had the largest fold change in expression between MS patients and controls of all the microRNA (Table 1). [score:3]
[1 to 20 of 4 sentences]
18
[+] score: 14
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
MiRNA profiles of each group were determined, and miR-320 and miR-197 were found to have significantly different expression levels between the two groups. [score:3]
In conclusion, we have found that miR-320 and miR-197 in human follicular fluid are associated with embryonic development potential. [score:2]
By miRNA profiling and qRT-PCR, we identified miR-320 and miR-197 in the follicular fluid as potential candidates for being associated with embryo development potential. [score:2]
As indicated in Figure 2, among the 15 candidate miRNAs, only miR-320 (p = 0.0073, Figure 2A) and miR-197 (p = 0.0080, Figure 2B) were found to be significantly different between the two groups. [score:1]
Because there is no miR-197 or homologous miRNA in the mouse miRNA database, our in vitro experiments focused solely on studying the function of miR-320. [score:1]
Scatter plots depicting significantly different levels of miR-320 (A) and miR-197 (B) between the two groups. [score:1]
[1 to 20 of 7 sentences]
19
[+] score: 13
This pro-proliferative effect was suggested to correlate with miR-controlled expression of ACVR1 (activin A receptor type 1), TSPAN3 (tetraspanin 3), CFLAR (Caspase 8 and FADD-like apoptosis regulator) and EFEMP2 (fibulin 4), although no direct regulation of these targets by miR-197 or -346 was demonstrated [21]. [score:8]
In vitro, the upregulation of miR-197 and -346 was associated with elevated proliferation of HEK293T and two FTC-derived cell lines. [score:4]
In comprehensive studies aiming at the identification of microRNA signatures distinguishing thyroid carcinomas from non-transformed thyroid tissue (NT), Nikiforova and colleagues [26] could not confirm the results of Weber et al. [21], except for miR-197. [score:1]
[1 to 20 of 3 sentences]
20
[+] score: 11
Second, TAL1 is a putative target of several miRNAs that are up-regulated in hematopoietic stem cells, such as hsa-miR-17-5p, hsa-miR-197, hsa-miR-106 and hsa-miR-20 [39], and of some that are down-regulated in differentiated megakaryocytes, such as hsa-miR-106 and hsa-miR-20 [40], suggesting that miRNAs might regulate TAL1 at different stages of hematopoietic development. [score:11]
[1 to 20 of 1 sentences]
21
[+] score: 11
We used a combination of two microRNA prediction methods, TargetScan and PicTar, to search for all predicted gene targets of the 5 most highly upregulated (let-7s, miR-21, miR-23b, miR-27a and miR-30a) and downregulated (miR-29b, miR-32, miR-144, miR-197 and miR-212) microRNAs [13]. [score:11]
[1 to 20 of 1 sentences]
22
[+] score: 11
92) 43 hsa-mir-302a dbDEMC 19 hsa-let-7g dbDEMC, miR2Disease 44 hsa-mir-212 literature 20 hsa-let-7b dbDEMC, HMDD, miR2Disease 45 hsa-mir-372 dbDEMC 21 hsa-mir-150 dbDEMC, literature 46 hsa-mir-197 dbDEMC 22 hsa-mir-338 dbDEMC 47 hsa-mir-124 literature 23 hsa-mir-103 dbDEMC, miR2Disease 48 hsa-mir-378 HMDD 24 hsa-mir-15b dbDEMC, HMDD 49 hsa-mir-26b dbDEMC, miR2Disease 25 hsa-mir-31 dbDEMC, HMDD, miR2Disease 50 hsa-mir-542 higher RWRMDA (No. [score:11]
[1 to 20 of 1 sentences]
23
[+] score: 11
Twelve radiation -suppressed miRNAs were identified, i. e. let-7d, miR-15a, miR-17, miR-30d, miR-92a, miR-197, miR-221, miR-320b, miR-342, miR-361, miR-501 and miR-671, and a significantly different expression between prostate cancer and the corresponding adjacent part was found, including 11 upregulated and 1 downregulated (Fig. 3B). [score:11]
[1 to 20 of 1 sentences]
24
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
They observed that all four miRNAs were significantly differentially expressed between lung cancer patients and HC, three miRNAs (miR-21, miR-155, and miR-197) distinguished pneumonia patients from controls, but only one miRNA (miR-197) was significantly differentially expressed between the pulmonary TB group and the control group. [score:5]
Aberrant serum miRNA expression in non-vaccinated children that contracted varicella revealed a panel of five miRNAs (miR-197, miR-629, miR-363, miR-132, and miR-122) that could differentiate, with moderate sensitivity and specificity, varicella patients from HC, and also varicella patients from patients with three other microbial infections (B. pertussis, measles virus, and enterovirus) (217). [score:3]
Using RT-qPCR, these workers examined expression of four miRNAs (miR-21, miR-155, miR-182, and miR-197) in serum from pulmonary TB, lung cancer, and pneumonia patient groups compared to a HC group. [score:2]
[1 to 20 of 3 sentences]
25
[+] score: 10
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
[1 to 20 of 2 sentences]
26
[+] score: 9
Downregulation of miR-197-3p and -1249 in HPV16 E6/E7 -expressing HFKs is driven by E7 (Table S1C), whereas downregulation of miR-34a-5p and -34c-3p is driven by E6 (Table S1D). [score:9]
[1 to 20 of 1 sentences]
27
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Selected miRNAs were also analyzed in nasal biopsies from asthmatic patients and healthy donors, revealing differential expression of 10 miRNAs (miR-18a, miR-126, let-7e, miR-155, miR-224 were down-regulated, while miR-498, miR-197, miR-874, miR-143, miR-886-3p were up-regulated) [25]. [score:9]
[1 to 20 of 1 sentences]
28
[+] score: 9
On the other hand, these 19 miRNAs (hsa-miR106a, hsa-miR-125a, hsa-miR-140, hsa-miR-146a, hsa-miR-146b, hsa-miR-155, hsa-miR-16, hsa-miR-17, hsa-miR186, hsa-miR-191, hsa-miR-197, hsa-miR-200b, hsa-miR-200c, hsa-miR-339, hsa-miR-374, hsa-miR-422, hsa-miR-422, hsa-miR-454, hsa-miR-484 and hsa-miR-590) were up-expressed in VP and ART (block1-group2) and down-expressed in EC and HIV- (block2-group2). [score:5]
hsa-miR-29b was the most highly expressed miRNA (fold change 2.1) and hsa-miR-197 the one with the lowest expression level (fold change -2.2) compared to ART. [score:4]
[1 to 20 of 2 sentences]
29
[+] score: 8
Among the altered microRNAs by TLDA analysis, only miR-197 was significantly downregulated, and miR-361-5p was the most upregulated microRNA as judged by differential expression, but this marked change was not validated by individual qRT-PCR assays. [score:8]
[1 to 20 of 1 sentences]
30
[+] score: 7
As a result, we selected 11 miRNAs (miR-27a, miR-27b, miR-145, miR-185, miR-197, miR-203, miR-221, miR-222, miR-338-3p, miR-376a, and miR-376b) that were potentially regulated by CD82 to target FZD2, -3, -5, -7, and -9 for further study (Table 1). [score:4]
No significant differences in miR-27a, miR-27b, miR-145, miR-185, miR-197, miR-221, miR-222, miR-376a, or miR-376b expression levels were observed between h1299/zeo and h1299/CD82 cells (Fig 1). [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 7
Additional studies in adult male mice subjected to IPC or ischemia revealed 8 miRNAs that together comprise the miR-200 and miR-182 families of miRNAs that were selectively upregulated 3 h after IPC, and 2 miRNAs (miR-681 and miR-197) that were selectively upregulated 24 h after IPC (88). [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 7
hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs. [score:7]
[1 to 20 of 1 sentences]
33
[+] score: 7
Dai et al. have correlated a miRNA signature (downregulation of miR-100, miR-130a, and miR-197 and upregulation of miR-181b, miR-181d, miR-101, and miR-195) in HNSCC cells with multiple drug resistance phenotypes in vitro [84]. [score:7]
[1 to 20 of 1 sentences]
34
[+] score: 7
For top 10 upregulated microRNAs (hsa-miR-197-3p, hsa-miR-574-3p, hsa-miR-885-5p, hsa-miR-483-3p, hsa-miR-1281, hsa-miR-328, hsa-miR-4254, hsa-miR-4290, hsa-miR-1825, hsa-miR-766-3p), we included those have been shown to be deregulated in cancer, and have either expression data or functional studies in stem cells. [score:7]
[1 to 20 of 1 sentences]
35
[+] score: 7
Correspondingly, Qi et al. also detected over -expression of miR-197 in TB patients [22]. [score:3]
In this study, a combination of increased miR-182 and miR-197 expression was found to be specific for TB. [score:3]
miR-22, miR-25, miR-197, miR-365, miR-483-5p, miR-590-5p, and miR-885-5p are yet the most promising candidates since these miRNAs were validated for discrimination of TB and healthy controls in two studies (see Table  2). [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 7
The up-regulation of miR-197 and down-regulation of miR-15, -146b, -181c, and miR-338 are commonly altered in AD brain parenchyma and CSF. [score:7]
[1 to 20 of 1 sentences]
37
[+] score: 7
a Meta-analysis algorithm of the most significant pathways targeted by miR-222-3p, miR-16-5p, miR-484, miR-17-5p, miR-106a-5p, miR-365b-5p, miR-196b-5p, miR-19b-3p, miR-197-3p, miR-193b-3p, miR-518d-5p and miR-191-5p. [score:3]
Moreover, a further and deeper comparison among pre-miR-214-3p-EV, antago-miR-24-3p-EV and anti-IL-3R-EV miR content led us to hypothesize that their overlapping anti-angiogenic effects might also depend on the combined action of a pattern of shared miRs (miR-222-3p, miR-16-5p, miR-484 for all EV samples; miR-19b-3p miR-17-5p, miR-196b-5p, miR-365b-5p for pre-miR-214-3p-EVs and anti-IL-3R-EVs; miR-106a-5p, miR-197-3p, miR-193b-3p for antago-miR-24-3p-EVs and anti-IL-3R-EVs) which may be involved in the regulation of a network of genes related to cancer development/progression. [score:3]
As shown in Fig.   8a and resumed in Fig.   8b, miR-222-3p, miR-16-5p, miR-484, miR-17-5p, miR-106a-5p, miR-365b-5p, miR-196b-5p, miR-19b-3p, miR-197-3p, and miR-193b-3p significantly correlated with at least 2 of the following pathways: pathway in cancer, adherens junction, p53 signaling pathway, cell cycle and ECM receptor interaction; whereas, miR-518d-5p and miR-191-5p did not. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 7
Among miRNA analyzed, miR-23b, miR-30d, miR-132, miR-140-3p, miR-145, miR-150, miR-204 were up-regulated in OA chondrocytes whereas miR-22, miR-25, miR-26, miR-30c, miR-92b, miR-127, miR-194, miR-197, miR-296-5p, miR-342-3p, miR-488 were down-regulated in OA chondrocytes (Figure  1B). [score:7]
[1 to 20 of 1 sentences]
39
[+] score: 6
Another study determined that 5-FU and oxaliplatin (L-OHP) down-regulated the expression of miR-197, miR-191, miR-92a, miR-93, miR-222 and miR-826 in HCT-8 and HCT-116 colon cancer cells [96]. [score:6]
[1 to 20 of 1 sentences]
40
[+] score: 6
With the exception of the patient S2, two groups of miRNAs can be observed, one group in which the expression is lower in the patients with short-OS (miR-211, miR-1207-3p, miR-326, miR-197, let-7b*, miR-1296, miR-4290) and one group that has an opposite expression profile (miR-4321, miR-3610, miR-1914*). [score:5]
As observed from Table S3, the top 10 miRs were the same, except for miR-1200 and miR-766 that replaced miR-197 and miR-1296. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 5
Activation of miR-93, miR-98 and miR-197 inhibits expression of FUS1, enhancing cell cycle progression and chemo-resistance in lung cancer cells [12], [13]. [score:5]
[1 to 20 of 1 sentences]
42
[+] score: 5
Dai W. Wang C. Wang F. Wang Y. Shen M. Chen K. Cheng P. Zhang Y. Yang J. Zhu R. Anti-miR-197 inhibits migration in HCC cells by targeting KAI 1/CD82 Biochem. [score:5]
[1 to 20 of 1 sentences]
43
[+] score: 5
Also, differentially regulated miR-197 was shown to be involved in the reciprocal regulation of the IL6/STAT3 pathway [89]. [score:3]
Additionally, a modulated cytokine profile towards the IL6 and TGFβ side caused by decreased levels of miR-128 and miR-197, as well as increased levels of miR-744 positively affect the maturation of T cells towards the Th17 side. [score:1]
Using DESeq2, we identified 11 miRNAs as statistically significant DEmiRs after accounting for the level of hemolysis: eca-miR-128, eca-miR-744, eca-miR-197, eca-miR-103 and the closely related eca-miR-107a, eca-miR-30d, eca-miR-140-3p, eca-miR-7, eca-miR-361-3p, eca-miR-148b-3p and eca-miR-215. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 5
The miRNA miR-197-3p showed down regulation trend during JEV infection across all the time points in this miRNA array experiment, although the data showed only downward trend for this miRNA at 48 h time points (Fig. 3E). [score:2]
Only miR-197-3p was found to be down regulated miRNAs, common to all time points (Fig. 2C, Table S2). [score:2]
The results of qPCR analysis of (A) miR-3648, (B) miR-3687 (C) miR-572, (D) miR-129-5p, (E) miR-197-3p, (F) miR-145-5p, (G) miR-374b-5p, (H) miR-26b-5p, (I) miR-149-5p, at three different time points are presented. [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 5
miR197 targets the tumour suppressor protein FUS1 [56]. [score:5]
[1 to 20 of 1 sentences]
46
[+] score: 4
Other miRNAs from this paper: mmu-mir-125a, hsa-mir-125a
In glioblastoma, both miRNA-197 and miR125a-5p inhibit glioma cell proliferation and invasion by negatively regulating Gab2 (51, 52). [score:4]
[1 to 20 of 1 sentences]
47
[+] score: 4
Several mechanisms have been implicated in the regulation of PD-L1 expression by cancer cells such as activation of mitogenic and pro-survival pathways including MAPK and PI3K/AKT, increased activity of transcriptional factors HIF-1, STAT-3 and NF-κB, and presence of epigenetic modulators including miR-513, miR-570, miR-34a, miR-200 and miR-197 [14]. [score:4]
[1 to 20 of 1 sentences]
48
[+] score: 4
miRNA profiling of 80 type 2 diabetic patients compared with age and gender matched controls showed overexpression of miR-28-3p and underexpression of 12 miRNAs (miR-223, miR-320, miR-486, miR-150, miR-24, miR-21, miR-29b, miR-20b, miR-15a, miR-126, miR-191, and miR-197). [score:4]
[1 to 20 of 1 sentences]
49
[+] score: 3
24 *** hsa-mir-770-5p 19 *** 75.47 *** hsa-mir-93* 9.5 *** 92.1 - Inhibited differentiation & low cell count *** hsa-let-7b* 4.75 *** 28.64 *** hsa-mir-1224-3p 2.38 *** 51.46 *** hsa-mir-1228 2.38 ** 9.43 *** hsa-mir-1249 1.66 *** 53.17 *** hsa-mir-125a-5p 19 *** 69.8 *** hsa-mir-1260 7.12 *** 61.75 *** hsa-mir-1280 11.88 *** 68.95 *** hsa-mir-129-3p 9.5 *** 65.64 - hsa-mir-1296 9.5 *** 36.36 *** hsa-mir-133a/hsa-mir-133b 42.75 * 0.85 *** hsa-mir-150 4.75 *** 60.37 *** hsa-mir-197 4.75 *** 27.79 *** hsa-mir-204 2.85 *** 27.44 *** hsa-mir-328 0.1 ** 30.87 *** hsa-mir-342-3p 33.25 *** 58. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Mir-23a/b, let-7, miR-145, miR-197, miR-411 and miR-412 are overexpressed in black women ULM patients than white women ULM patients. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
Intercellular GJ channels in the BM stroma permit the transfer of small noncoding RNA, such as miR-197, a microRNA, which interferes with CXCL12 expression [102, 103, 104]. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-150, hsa-mir-423
In previous studies, miRNAs abnormal expression was frequently reported in psoriasis [19], including miR-99a, miR-150, miR-423 and miR-197 [20]. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
The boxplots show the expression levels of miR-197-5p (a), miR-4697-5p (b), miR-4721 (c), miR-5006-5p (d), miR-575 (e), miR-6893-5p (f), miR-125a-5p (g), miR-1260b (h), miR-224-3p (i), miR-331-3p (j), miR-365a-3p (k), miR-495-3p (l), miR-518b (m), miR-518f-3p (n), miR-543 (o) and miR-7977 (p). [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
The level of miR-126 in mononuclear cells from peripheral blood was positively associated, and those of miR-197 and miR-223 negatively, with the occurrence of AMI. [score:1]
In a multivariable Cox regression analysis, the authors found a signature of three miRNAs, namely, miR-126, miR-197, and miR-223 involved in the prediction of AMI within 10 years. [score:1]
This could be very central considerations to have on studies like the one on the Bruneck cohort already mentioned, in which the interest was put on thrombocyte -associated miRNAs, namely, miR-126, miR-223, and miR-197 (49). [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 3
miRNA profiling of whole blood and blood-derived exosomes obtained from patients with metabolic syndrome detected similar expression of miR-17, miR-197, miR-509-5p, miR-92a, and miR-320a (80). [score:3]
[1 to 20 of 1 sentences]
56
[+] score: 2
Post transcriptionally, in HCC cells KAI1 is negatively regulated via miR-197 interaction with its 3' UTR sequence (8). [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 2
Indeed, when the data of the Yamaura’s study were compared with findings of the present study several miRNAs were regulated in common and included for blunt steatosis miR-10b and miR-183; similarly with NASH the miRNAs miR-17, miR148b-5p and miR-197 were commonly regulated thus providing independent evidence for their diagnostic utility in animal studies. [score:2]
[1 to 20 of 1 sentences]
58
[+] score: 2
The TF MEF2C interacts with the lncRNA JPX, miR-193a/b, miR-145, and miR-197, and every transcript in these structures is associated with breast cancer (Figure 1F), suggesting they may play critical roles in tumorigenesis in combination with an L-FFL motif. [score:1]
MiR-193a/b, miR-145, and miR-197 were previously reported to promote breast cancer [35– 37]. [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 2
Moderately abundant EC reference genes with mean Cq values between 20 and 25, included miR-18a, miR-133a, miR-197, miR-210, miR-214, miR-328 and RNU44. [score:1]
All candidates displayed low variability, with the least variation across all samples for miR-197 (CV = 5.65), and the largest for miR-218 (CV = 9.86). [score:1]
[1 to 20 of 2 sentences]
60
[+] score: 2
In addition, microRNAs, including miR-570, miR-513, miR-197, miR-34a, and miR-200, negatively regulate PD-L1 (100). [score:2]
[1 to 20 of 1 sentences]
61
[+] score: 2
Other miRNAs from this paper: hsa-mir-155, hsa-mir-648
Although miR-197 did not show significant outlier activity in PCa, it was previously proposed as a potential miRNA biomarker for lung cancer in another study [46]. [score:1]
To further investigate the activities of PCa miRNA biomarkers predicted by our approach, we randomly selected three miRNAs (miR-155, miR-648, and miR-197) to detect differences in their expression between PCa tissues and benign prostatic hyperplasia tissues by q-PCR technology. [score:1]
[1 to 20 of 2 sentences]
62
[+] score: 1
0074916hsa-miR-16-5p0.0890.0071513hsa-miR-44540.3420.001154hsa-miR-181a-5p0.1060.041029hsa-miR-46440.3580.004136hsa-miR-25-3p0.1290.000127hsa-miR-197-3p0.3590.005471hsa-miR-4653-3p0.1290.000547hsa-miR-15a-5p0.3620.0302713hsa-miR-146a-5p0.1400.002395hsa-miR-2115-3p0.3640.000163hsa-miR-339-5p0.1460.002487hsa-miR-9370.3650.008018hsa-miR-50890.1560.0017917hsa-miR-331-3p0.3740.0010912hsa-miR-493-5p0.1630.0061914hsa-miR-374b-5p0.3800. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
After a 3-h exposure to 2-Gy X-irradiation, the cells showed induction of miR-181d (2.51-fold, p = 0), miR-574-3p (2.27-fold, p = 2.4 × 10 [−34]), miR-197 (2.12-fold, p = 2.9 × 10 [−26]), and miR-766 (1.64-fold, p = 2.5 × 10 [−7]). [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
Indeed, some miRNAs that have been previously linked to carcinogenesis of different organs and tissues, such as miR-2861 [47, 48], miR-4530 [49], miR-638 [50], miR-371b-5p [51], miR-1225-5p [52, 53], miR-296-5p [54, 55], miR-4787-5p [56], miR-4281 [57], miR-4455 [58], miR-197-3p [59], miR-369-5p [60, 61] and miR-505-3p [62] which were found to be altered in brucellosis in our analysis. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Mir-20 and mir-21 were found to be repressed by LDIR, whereas mir-197 and mir-199a were potently induced more than four-fold by HDIR [26]. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
Five of these switches were very dramatic, going from > 90% of one arm in one study to > 90% of the opposite arm in the other study (fca-miR-1307, fca-miR-144, fca-miR-197, fca-miR-199 and fca-miR-33a). [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
MRESS SNPs FST Gene miR CNM SNPs FST Gene miR rs3822506 0.8743 TCERG1 miR-590 rs7665492 0.8942 ENAM miR-3916 rs1217382 0.8469 BCL2L15 miR-17 rs1043809 0.8900 EPN2 miR-3616-3p rs3087542 0.8428 EMCN miR-197 rs2470102 0.8859 MYEF2 miR-1180 rs3742988 0.8385 CDAN1 miR-378 rs7290134 0.8695 TNFRSF13C miR-1205 rs1071738 0.8298 PALLD miR-182 rs8057598 0.8596 NOL3 miR-769-3p rs1969589 0.8545 RGMA miR-593* rs1246014 0.8476 COPS7B miR-1273d rs12449157 0.8399 GFOD2 miR-125a-3p rs16990309 0.8398 SLC23A2 miR-760 rs3742988 0.8385 CDAN1 miR-326 rs2292549 0.8361 GPBAR1 miR-936 rs1995939 0.8338 STARD9 miR-3943 rs3199486 0.8321 STARD9 miR-2278 rs873258 0.8312 TSPAN14 miR-873MRESS and CNM SNPs showing highest levels of population sub-division among HapMap phase 3 data- All SNPs falling 2 SDs from the mean F [ST ]of 3'UTR SNPs. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
It is of interest that a large number of modulated miRNAs were pointed out to interact with SRC (mmu-miR-197 and -230), CRK and CRKL (mmu-miR-203, -497, -218, -320, -214, -328), and various MAPKs (4 miRNAs for MAPK1, 3, 8 and 14; 7 miRNAs for MAPK9; 13 miRNAs for MAPK7; see Tables S5- S10 for details). [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
miR-93, miR-98, miR-197. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Alterations in circulating miR-23a, miR-27a, miR-130, miR-195, miR-197, miR-320a, and miR-509-5p have been associated to metabolic syndrome [153, 154]. [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
Nevertheless, we observed that the free energy gained through triplex formation can be small, e. g. in case of miR-1::PROS1::miR-320b (Δ G [triplex] = −24.16; ΔΔ G = −0.48) but also rather high as in case of miR-197::CNTN5::miR-320a (Δ G [triplex] = −43.06 kcal/mol; ΔΔ G = −24.08 kcal/mol). [score:1]
[1 to 20 of 1 sentences]