sort by

196 publications mentioning hsa-mir-99a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-99a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 423
Other miRNAs from this paper: hsa-mir-100, hsa-mir-99b, hsa-mir-708
The miR-99 family (miR-99a, miR-99b, and miR-100) has been reported to be upregulated following DNA damage, and their expression has been correlated with radiation sensitivity, in breast and PCa cell lines, by their ability to downregulate the chromatin remo deler SWI/SNF-related, matrix -associated, actin -dependent regulator of chromatin (SMARC) A5 (SNF2H) [21]. [score:10]
However, treatment of androgen-independent CB and PC3 cells, with the synthetic androgen R1881 (10 nM), did not result in a change of miR-99a/miR-100 or SMARCA5 and SMARCD1 expression (Figure 6A, 6B, Supplementary Figure S3A), whereas LNCaP, an AR expressing PCa cell line demonstrated a downregulation of both miRNAs after R1881 treatment (Supplementary Figure S3B), confirming previous data [30]. [score:8]
Inhibition of the glucocorticoid receptor upregulates miR-99a/100 expression levels. [score:8]
Since our results showed that inhibition of miR-99a/100 expression led to a faster recovery of CB cells after irradiation (Figure 2D, 2E), we next quantified levels of DNA damage in CB cells with or without miR-99a/100 inhibition. [score:7]
The miRNA inhibitors anti-hsa-miR-99a-5p miScript miRNA Inhibitor (miR99a-i), Anti-hsa-miR-100-5p miScript miRNA Inhibitor (miR100-i) and the endo-ribonuclease prepared siRNA (esiRNA) esiPARP1, esiSMARCA5, esiSMARCD1 (Sigma-Aldrich Company Ltd, Gillingham, UK) were transfected with Lipofectamine® RNAiMAX Transfection Reagent (Life Technologies Ltd, Paisley, UK) according to the manufacturer's protocol. [score:7]
Since we saw no changes in the expression of EMT markers after miR-99a/100 inhibition, the mechanism behind the change in DNA damage response after inhibition of miR-99a or miR100 is not due to dedifferentiation/EMT. [score:7]
Here we show that pre-treatment with Dexamethasone or the GR inhibitor Mifepristone resulted in sensitivity changes of primary PCa to irradiation, by directly influencing the expression levels of miR-99a/100. [score:6]
As reported in other systems, SMARCA5 and SMARCD1 proteins were upregulated (Figure 4A) after inhibition of miR-99a/100 [21, 30]. [score:6]
To further validate this, we attempted to reverse the efficient DNA repair ability acquired by CB cells, due to inhibition of miR-99a, by simultaneously knocking down expression of SMARCA5 or SMARCD1. [score:6]
Glucocorticoids downregulate miR-99a/100 expression levels. [score:6]
In support of these findings we observed that in patient-derived epithelial cells, miR-99a/100 expression was significantly suppressed in CRPC compared to benign disease and tnCancer (P<0.01) (Figure 1H). [score:6]
Committed basal (CB) cells, which express relatively high levels of miR-99a/100, were transfected with control, miR-99a-inihibitor or miR-100 inhibitor for 3 days and then analyzed with or without exposure to 5-Gy radiation. [score:5]
B. FACS analysis for CD49b (ITGB2) and CD49f (ITGB6) expression of CB cells transfected with either control or miR-99a inhibitor for 3 days (n=3 PCa). [score:5]
C. Colony forming experiments of CB cells transfected simultaneously with miR-99a inhibitor and SMARCA5 or SMARCD1 endoribonuclease-prepared siRNA (esiRNAs) following 5-Gy radiation show a rescue of the effects mediated by miR-99a inhibitor alone (n=5 PCa, each sample is in triplicate). [score:5]
miRNAs have been shown to play a key role in chemotherapeutic drug resistance, and we now show that miR-99a/miR-100 are downregulated in patients with CRPC compared with benign disease. [score:5]
Taken together, these data suggest that miR-99a/100 function together, and that their lower expression imparts aggressive PCa disease and a stem cell-like phenotype in a variety of human PCa mo dels. [score:5]
F. Quantification of nuclear SMARCA5 and SMARCD1 in CB cells simultaneously transfected with miR-99a inhibitor and treated with or without the PARP1 inhibitor nicotinamide. [score:5]
PARP1 inhibition ultimately negated the post-radiation survival advantage imparted by miR-99a inhibition in CB cells (Figure 4H), suggesting that PARP1 is required for post-radiation nuclear accumulation of SMARCA5. [score:5]
qRT-PCR analysis of the miR-99a and miR-100 targets SMARCA5 and SMARCD1 showed the expected decrease of both targets after Mifepristone treatment (Figure 6F). [score:5]
We also noted that inhibition of miR-99a/100 (and overexpression of SMARCA5 and SMARCD1) resulted in small but significant increase in colony forming efficiency, but other stem cell markers remain statistically unchanged. [score:5]
miR-99a/100 function together and their lower expression imparts aggressive PCa disease and stem cell-like phenotype. [score:5]
Perhaps miR-99a/100 inhibition or expression of SMARCA5/SMARCD1 alone is required but not sufficient for de-differentiation. [score:5]
Figure 5 A. Representative western blot analysis of epithelial-mesenchymal transition -associated proteins E-cadherin (CDH1), fibronectin (FN1) and Vimentin (VIM) in CB cells transfected with control, miR-99a -inhibitor, and miR-100 -inhibitor, for 3 days. [score:5]
Having demonstrated that stimulation of the GR with DEX led to suppression of miR-99a/100 expression (Figure 6A, 6B), total cell populations of patient-derived prostate cells were treated with the GR antagonist Mifepristone at the clinically achievable concentration of 1 μM [53]. [score:5]
Suppression of miR-99a and miR-100 promotes efficient DNA repair in cells with high miR-99a/100 expression. [score:5]
When CB cells, where miR-99a expression was inhibited, were treated with 15 μM nicotinamide, for 12 hours, and then irradiated with 5Gy radiation, we observed that the post-radiation nuclear accumulation of SMARCA5/SMARCD1 was significantly reduced (Figure 4F). [score:5]
Inhibition of miR-99a/100 inhibition produced only a modest, but significant, increase in colony forming efficiency of CB cells (Figure 5D). [score:5]
These data provide further evidence that lower expression of miR-99a/100 permits efficient DNA repair, whilst expression of miR-99a/100 induces p53 -dependent apoptosis following DNA damage. [score:5]
C. mRNA levels of differentiation -associated genes (Nuclear factor kappa-light-chain-enhancer of activated B cells 1 (NFkB1), DNA -binding protein inhibitor ID-2 (ID2), prominin 1 (PROM1), Sex determining region Y-box 2 (SOX2), Homeobox protein Nkx-3.1 (NKX3.1), Wingless-Type MMTV Integration Site Family, Member 5A (WNT5a) and Pappalysin A (PAP)) after miR-99a -inhibitor transfection in CB cells, for 3 days, relative to control transfection. [score:5]
E. Representative pictures of immunofluorescence staining for phosphop53 (s-20), cleaved caspase 3, and cleaved PARP expression in miR-99a/100 inhibitor transfected CB cells, 24 h after exposure to 5-Gy radiation (n=3 PCa, each sample in triplicate). [score:5]
Lower expression of miR-99a/100 and higher expression of SMARCA5/SMARCD1, and even PARP1 have all been associated with EMT and the stem cell phenotype in various other tissue types [39– 45]. [score:5]
To further investigate the role of miR-99a/100 in radiation response, we inhibited miR-99a or miR-100 expression in highly expressing BPH and PCa-derived primary CB cells (Figure 2C). [score:5]
A. Representative western blot analysis of epithelial-mesenchymal transition -associated proteins E-cadherin (CDH1), fibronectin (FN1) and Vimentin (VIM) in CB cells transfected with control, miR-99a -inhibitor, and miR-100 -inhibitor, for 3 days. [score:5]
miR-99a/miR-100 were significantly upregulated in the treated samples (Figure 6E). [score:4]
Similarly, the low miR-99a/100 expressing SC fraction accumulated significantly higher levels of the SMARCA5 and SMARCD1 in the nucleus, compared with the high miR-99a/100 expressing CB population after radiation exposure (Supplementary Figure S2B). [score:4]
Analysis of our published miRNA expression array data demonstrates that the miR-99 family members, miR-99a and miR-100 (miR-99a/100), are significantly suppressed in prostate stem-like cells (SC) compared to their differentiated progeny; committed basal (CB) cells (Figure 1A, 1B) [24, 25]. [score:4]
B. Proliferation assays showing the relative surviving fraction of LNCaP cells transfected with control, miR-99a -inhibitor, and miR-100 -inhibitor cells 48 h after exposing the to 2, 5, 10 Gy radiation (n=3). [score:4]
E. Wound healing assay miR-99a/100 inhibitor transfected CB cells after 48 h. Data are expressed as mean ± s. d. *P < 0.05, **P < 0.01, ***P < 0.001 (Student's ttest). [score:4]
Whilst in androgen -dependent LNCaP cells, treatment with the anti-androgen Bicalutamide (BC) reverses the down-regulation of miR-99a/100, no BC effects were seen in androgen-independent PC3 cells (Supplementary Figure S3A, S3B). [score:4]
Analysis of two further expression arrays published by other groups revealed that miR-99a and miR-100 are also significantly suppressed in primary tumors compared to benign samples (Figure 1C, 1D) [26, 27]. [score:4]
Our data demonstrate that the expression of miR-99a/100 is also regulated by GR control of the DNA damage response following irradiation. [score:4]
Our results show that inhibition of miR-99a/miR-100 via glucocorticoid treatment results in an increased DNA repair efficiency at least partly through regulation of the SMARCA5 and SMARCD1 proteins in androgen-independent cells. [score:4]
Therefore, when CB populations were treated with DEX the expected lower expression of both miR-99a/miR-100, and a reciprocally increased expression of SMARCA5 and SMARCD1 mRNA, compared with ethanol (EtOH) treated cells (Figure 6A, 6B) was observed. [score:4]
Similarly, concurrent miR-99a inhibition and SMARCA5/SMARCD1 knock-down abrogated efficient BRCA1 and RAD51 nuclear recruitment at the DNA damage sites (Figure 4E). [score:4]
Assessment of the total pixel intensity of the nuclear chromatin accessibility marker, Histone 3 acetylation (H3ac), after 30 min, showed an increased histone H3ac after miR-99a/100 inhibition (Figure 3C). [score:3]
H. Colony forming experiments of CB cells transfected with SCRMBL or PARP1 esiRNA or treated with nicotinamide following by 5-Gy radiation showing a rescue of the effects mediated by miR-99a inhibitor alone (n=5 PCa, each sample in triplicate). [score:3]
Simultaneous inhibition of SMARA5/SMARCD1 and miR-99a reduced the post-radiation colony recovery ability of CB cells (Figure 4C). [score:3]
In our previous work we integrated miRNA-mRNA expression datasets and demonstrated that miR-99a/miR-100 plays an essential role in DNA repair [25, 35]. [score:3]
Suppression of miR-99a/100 -induced efficient DNA repair in CB cells is not due to induction of epithelial–mesenchymal transition or de-differentiation. [score:3]
B. staining for nuclear SMARCA5 and SMARCD1 in miR-99a and 100 -inhibitor transfected CB cells, 5 minutes after exposure to 5-Gy radiation (n=5 PCa). [score:3]
A previous study suggested that miR-99a/100 are suppressed by androgens in androgen -dependent cells with a luminal phenotype [30]. [score:3]
Quantitative real time polymerase chain reaction (qRT-PCR) analysis of commonly used cell lines showed that more tumorigenic PCa cell lines, such as DU145 and 22Rv1, had a lower expression of the miR-99 family than less tumorigenic PCa cell lines, e. g. LNCaP (Figure 1I). [score:3]
Figure 1 A+ B. Expression profiles of miR-99a (A) and miR-100 (B) in the separated populations: stem cell (SC), cancer stem cell (CSC), transit amplifying (TA) and committed basal (CB) (n=5 Benign prostatic hyperplasia (BPH) and treatment naïve Prostate Cancer (tnCancer), n=3 castration resistant PCa (CRPC). [score:3]
We inhibited miR-99a/100 in CB cells and looked for EMT or dedifferentiation, using commonly used EMT and previously reported PCa and normal stem cell markers [10, 11, 35, 46– 48]. [score:3]
Furthermore, inhibition of miR-99a/100 in LNCaP cells (Supplementary Figure S1D) increases radioresistance (Figure 2B). [score:3]
B. Quantification of γH2AX immunofluorescence foci/nucleus at multiple time points after transfection of miR-99a/100 inhibitor in CB cells following 5-Gy radiation exposure (n=3 PCa, each sample in triplicate), >250 cells/sample were counted. [score:3]
Although levels exhibit no correlation with Gleason grade (Supplementary Figures S1A, S1B), Kaplan- Meier survival analysis on the Taylor et al data showed that lower expression of miR-99a/100 is associated with poorer survival (Figure 1E, 1F). [score:3]
Figure 3 A. Quantification of positive nuclear phospho-ATM/ATR substrate and phospho-P53 (s-20) stained CB cells transfected with miR-99a and 100 inhibitor. [score:3]
This finding, combined with the earlier observation that these cells recover faster after irradiation, led us to formulate the hypothesis that DNA damage is repaired more rapidly after miR-99a/100 inhibition. [score:3]
D. Quantification of nuclear pan-histone 3-acetylation immunofluorescence staining by Velocity Quantitation software in miR-99a inhibitor and SMARCA5 or SMARCD1 esiRNAs transfected CB cells. [score:3]
In addition, we show that miR-99a and miR-100 -mediated radiation-sensitivity is influenced by inhibition of the Glucocorticoid receptor (GR, NRC1), revealing a potential new treatment strategy to improve radiotherapy and reduce PCa relapse. [score:3]
H. Comparison of miR-99 and miR-100 expression in unfractionated primary prostate samples from BPH (n=3), tnCancer (n=3) and CRPC (n=3). [score:3]
A. qRT-PCR analysis of miR-99a and miR-100 expression in CB cells treated with R1881 or dexamethasone (DEX) for 72 h (n= 5 PCa). [score:3]
I. Expression profiles of miR-99 and miR-100 in prostate cancer cell lines (n=3). [score:3]
CB cells transfected with miR-99a inhibitor showed an increase in chromatin relaxation by increasing H3-acetylation (Figure 4D), resulting in efficient nuclear recruitment of BRCA1 and RAD51 (Figure 3D, 4E). [score:3]
These data provide multiple strands of evidence that miR-99a/100 inhibition in CB cells did not undergo EMT not de-differentiation, as a basis for radiation resistance. [score:3]
A previous study showed that higher expression of the miR-99 family correlated with radiation sensitivity of prostate cell lines [21]. [score:3]
E. Quantification of nuclear BRCA1 and RAD51 in CB cells simultaneously transfected miR-99a inhibitor and SMARCA5 or SMARCD1 esiRNA. [score:3]
A+ B. Expression profiles of miR-99a (A) and miR-100 (B) in the separated populations: stem cell (SC), cancer stem cell (CSC), transit amplifying (TA) and committed basal (CB) (n=5 Benign prostatic hyperplasia (BPH) and treatment naïve Prostate Cancer (tnCancer), n=3 castration resistant PCa (CRPC). [score:3]
A similar reduction in SMARCA5/SMARCD1 post-radiation nuclear localization was also observed when CB cells were co -transfected with miR-99a inhibitors and esiPARP1 (Figure 4G). [score:3]
E. qRT-PCR analysis of miR-99a and miR-100 expression in total primary cell populations treated with Mifepristone for 72 h (n= 5 PCa). [score:3]
None of these markers showed any changes after inhibition of miR-99a/100 (Figure 5A, 5B, 5C). [score:3]
G. Correlation analysis of miR-99a and miR-100 after pooling the expression data of GSE21036 and GSE36802. [score:3]
In support of our findings, phosphorylation of the damage sensor protein p53, and of the apoptotic markers cleaved caspase 3 and cleaved PARP, both showed a significant decrease in cells exposed to miR-99a/100 inhibition 24 h after irradiation (Figure 3E). [score:3]
The analysis shows a significant correlation between miR-99a and miR-100 expression in PCa patients. [score:3]
Inhibition of PARP ultimately interferes with the miR-99a/100-SMARCA5/SMARCD1 axis and thus DNA repair. [score:3]
In this study, using patient-derived cells, we have shown that inhibition of miR-99a/miR-100 prevents p53 dependent apoptosis in PCa cells after irradiation. [score:3]
Figure 6 A. qRT-PCR analysis of miR-99a and miR-100 expression in CB cells treated with R1881 or dexamethasone (DEX) for 72 h (n= 5 PCa). [score:3]
C. Quantification of nuclear pan-histone 3-acetylation immunofluorescence staining intensity by Velocity Quantitation software in miR-99a and 100 -inhibitor transfected CB cells 30 minutes after exposure to 5-Gy radiation (n=3 PCa). [score:3]
Our results also show that PARP1, whose expression is essential for the miR-99a/100 driven DNA damage response, is an important component of this process. [score:3]
Moreover, suppressed miR-99a/100 levels enable efficient relaxation of damaged chromatin by increasing histone acetylation and subsequently increasing the recruitment of DNA repair proteins, BRCA1 and RAD51. [score:3]
Suppression of miR-99a and 100 promotes DNA repair enhance recruitment of DNA repair proteins. [score:3]
Additionally, miR-99a/100 were also found to be significantly co-expressed in prostate samples (Pearson: 0.07485, p<0.0001) (Figure 1G). [score:3]
To monitor damage and repair of the DNA, the number of γH2AX foci per cell, after irradiation of miR-99a/100 inhibited CB cells were estimated by immunofluorescence. [score:3]
Lower expression of miR-99a and miR-100 is associated with aggressive PCa and a stem cell-like phenotype. [score:3]
Using the same technique, we observed a significant increase in the DNA damage sensors BRCA1 and RAD51 in miR-99a/100- inhibited cells 2-hours after exposure to 5Gy irradiation (Figure 3D). [score:3]
Under all conditions γH2AX peaked at the same level in the first 30 min post-irradiation, but 215 min after irradiation, the cells transfected with miR99a/100 inhibitors showed a 50% decrease in the number of γH2AX foci. [score:3]
Simultaneous inhibition of SMARCA5 and miR99-a, but not of SMARCD1, reduced H3-acetylation suggesting that miR-99a mediated chromatin relaxation is predominantly mediated by SMARCA5 only. [score:3]
A. Quantification of positive nuclear phospho-ATM/ATR substrate and phospho-P53 (s-20) stained CB cells transfected with miR-99a and 100 inhibitor. [score:3]
G. Quantification of nuclear SMARCA5 and SMARCD1 in CB cells simultaneously transfected with miR-99a inhibitor and PARP1 esiRNA. [score:3]
miR-99a/100 inhibition -dependent DNA repair is mediated by SMARCA5 and SMARCD1. [score:3]
D. Colony forming efficiency of miR-99a/100 inhibitor transfected CB cells (n=3 PCa). [score:3]
Suppression of miR-99a/100 promotes recruitment of DNA repair proteins. [score:3]
Inhibition of miR-99a/100 resulted in a growth advantage (Figure 2D), and we observed a significant (~2-fold) increase in colony forming efficiency following exposure to 5 Gy radiation (Figure 2D, 2E). [score:3]
Suppression of miR-99a/100 -induced efficient DNA repair in CB cells is not due to epithelial–mesenchymal transition or de-differentiation. [score:3]
It is indeed possible that EZH2 and miR-99a/100 can collaborate in regulating prostate cancer stem cell functionality and radiation-sensitivity. [score:2]
Cell viability assays revealed that the radiation sensitivity of the tested PCa cell lines (Figure 2A) is higher in cells with low expression of the miR-99 family (Figure 1I). [score:2]
Effects of miR-99a and 100 on DNA repair processes are regulated by SMARCA5 and SMARCD1. [score:2]
Moreover a scratch assay demonstrated that miR-99a/100 inhibited CB cells did not increase their migratory potential (Figure 5E), an attribute of mesenchymal-like cells. [score:2]
These data revealed that miR-99a/100 are regulated by glucocorticoids and influence DNA repair efficiency by modulating SMARCA5 and SMARCD1 in androgen-independent primary PCa cells (Figure 6I), with particular activity within the highly clonogenic stem-like cells. [score:2]
Therefore, miR-99a/100 influences DNA repair via regulation of SMARCA5 and SMARCD1, even in primary PCa cells. [score:2]
miR-99a/100 inhibited CB cells showed significantly higher nuclear SMARCA5 and SMARCD1 accumulation compared with scrambled miRNA transfected cells (Figure 4B). [score:2]
We have shown in multiple near-patient PCa samples that the two miR-99 family members miR-99a/miR-100 play an important role in regulation of post-irradiation DNA damage response (via SMARC proteins) in the rare tumor initiating CSC population. [score:2]
Luciferase 3′UTR-studies using PCa cell lines have shown that SMARCA5 can be regulated by miR-99a/100 and influences proliferation, PSA protein levels and repair of double-strand DNA breaks [21, 30]. [score:2]
Effects of miR-99a/100 on DNA repair processes are regulated by SMARCA5 and SMARCD1. [score:2]
E. Colony forming assay of malignant irradiated CB cells after miR-99a and miR-100 inhibition (n=3 PCa). [score:2]
These data not only implicate GR in resistance to RT in PCa cells, but also highlight the role of GR and miR99a/100 in the development of RT resistant tumors. [score:2]
These molecular and functional readouts revealed that miR-99a/100 regulate SMARCA5 and SMARCD1 in primary PCa cells to enable DNA repair. [score:2]
Using loss of function and rescue experiments, we now demonstrate that SMARCA5 and SMARD1 are the primary mediators of the miR-99a/100 driven pathway. [score:1]
This result agrees with previous findings by Mueller et al, who showed a role for the miR-99 family in DNA repair [21]. [score:1]
miR-99a has been found in the lncRNA host gene MIR99AHG. [score:1]
This study shows, for the first time the role of two members of the miR-99 family (miR-99a and miR-100) in DNA damage repair following radiation in primary PCa cell mo dels, and provides additional functional and mechanistic details about the miR-99a family-DNA repair relationship. [score:1]
C+ D. miR-99a and miR-100 levels in unseparated benign and malignant populations from the GSE21036 (C, benign n=28, malignant n=99, metastasis n=14) and GSE36802 (D, benign n=21, malignant n=21) data sets. [score:1]
These data are consistent with other large-scale sequencing studies, which have also reported a decrease of the miR-99 family in PCa [28– 30]. [score:1]
Furthermore, patients with low levels of miR-99a/miR-100 are more susceptible to biochemical recurrence after treatment. [score:1]
Thus, induction of the members of the miR-99 family represents a switch by which cells subjected to multiple rounds of radiation might be sensitized to RT. [score:1]
Taken together, these data reveal the potential of the miR-99 family as a marker for bad prognosis. [score:1]
Accordingly, nuclear SMARCA5 and SMARCD1 levels were measured in miR-99a/100 inhibited CB populations 5 min after irradiation. [score:1]
E+ F. Survival analysis from GSE21036 of patients with low and high mir-99a (E) and miR-100 (F) levels using the Project Betastasis database (http://www. [score:1]
I. Schematic representation of the hypothesis, which proposes a feedback loop between androgen receptor (AR)-miR99a/100-SMARCD1 and glucocorticoid receptor (GR)-miR99a/100-SMARCD1 in androgen dependent and androgen independent cells. [score:1]
D. Proliferation of malignant irradiated CB cells measured by live cell count after miR-99a and miR-100 inhibition (n=3 PCa). [score:1]
[1 to 20 of 121 sentences]
2
[+] score: 402
Other miRNAs from this paper: hsa-mir-10b, hsa-mir-122, hsa-mir-200c, hsa-mir-99b
In our current study, we found that the expression of phosphorylated 4E-BP1 and S6K1 was significantly reduced after inhibition of mTOR expression by miR-99a mimics in breast cell lines, concurrent with a reduction of cell viability and induction of apoptosis, while re -expression of mTOR could completely overcome the inhibitory effect of miR-99a on expression of mTOR/p-4E-BP1/p-S6K1 signal pathway genes. [score:13]
MiR-99a greatly reduced the expression of mTOR on both mRNA and protein levels, and inhibited the phosphorylated form of the mTOR downstream targets (p-4E-BP1 and p-S6K1), re -expression of mTOR protein overcame the inhibitory effect of miR-99a mimics on the mTOR/p-4E-BP1/p-S6K1 signal pathway and miR-99a antitumor activity. [score:11]
We have established that (i) miR-99a expression was significantly reduced in breast cancer tissues and cells lines; (ii), Ectopic expression of miR-99a greatly decreased breast cancer cell viability, induced apoptosis and inhibited tumorigenicity in nude mice; (iii), consistent with previous studies, mTOR was further confirmed as the direct target of miR-99a. [score:10]
Expression of miR-99a inhibits the growth of prostate cancer cells and reduces the expression of prostate-specific antigen by targeting chromatin-remo deling factors such as SMARCA5, SMARCD1 and the growth regulator kinase mTOR in vivo [12]. [score:10]
Down-regulation of miR-99a highly correlates with up-regulation of mTOR expression in both human breast cancer tissues and cell lines. [score:9]
Our current study has identified several biological functions of miR-99a including reduction miR-99a expression in breast cancer tissues and cell lines, reduction of breast cancer cell viability and induction of apoptosis and inhibition of tumorigenesis in vivo after overexpression of miR-99a, as well as molecular mechanism of miR-99a -mediated inhibitory effect of mTOR in human breast cancer cells. [score:9]
To identify miR-99a target genes, we searched the Targetscan and Pictar databases and found that mTOR was one of the predicted miR-99a targets whose 3′-UTR contained putative miR-99a target sites (Figure 3A). [score:9]
This indicates that miR-99a directly targets the mTOR through its 3′-UTR and, in turn, inhibits its expression. [score:8]
Levels of p-4E-BP1 and p-S6K1 proteins were both markedly decreased after miR-99a mimics transfection in MCF-7 cells, Knockdown of mTOR expression using mTOR siRNA also distinctly reduced levels of p-4E-BP1 and p-S6K1 proteins, however, total 4E-BP1 and S6K1 protein showed no change; The inhibitory effects of miR-99a mimics on p-4E-BP1 and p-S6K1 could be negated by re -expression of mTOR. [score:8]
Previous studies have reported that miR-99a can inhibit mTOR expression by directly targeting its 3′-UTR in numerous human cancers including prostate cancer cells, childhood adrenocortical tumor cells, and c-Src-transformed cells [12], [17], [24]. [score:8]
To further test whether miR-99a -mediated mTOR inhibition confers antitumor activity in breast cancer cells, we first confirmed the biological functions of miR-99a mimics -transfected breast cancer by inhibiting mTOR expression. [score:7]
Several studies have shown reduced or lost miR-99a expression in different human cancers such as ovarian, lung, head and neck and colon cancer [18]– [21], in which miR-99a has been identified as a tumor suppressor, despite one study reported that miR-99a was overexpressed in gastric cancer as an oncogene [22]. [score:7]
Moreover, induction of cell cycle arrest by miR-99a may suppress expression of insulin-like growth factor 1 receptor (IGF-1R) and mammalian target of rapamycin (mTOR) in hepatocellular carcinoma cells [11]. [score:7]
We first showed that expression of miR-99a was able to inhibit expression of mTOR mRNA and protein in MCF-7 cells. [score:7]
Overexpression of miR-99a reduces breast cancer cell viability, induces apoptosis and inhibits tumorigenicity in vitro and in vivo through targeting mTOR/p-4E-BP1/p-S6K1 pathway. [score:7]
Mueller et al showed that expression of the miR-99 family was upregulated in response to radiotherapy of breast cancer cells and reduced tumor cells' ability to repair damaged DNA [23]. [score:6]
The miR-99a expression is down-regulated in both human breast cancer tissues and cell lines. [score:6]
Since 4E-BP1 and S6K1 are two direct downstream molecules of mTOR signaling pathway, we further investigated the expression of total and phosphorylated 4E-BP1 and S6K1 in MCF-7 cells following miR-99a overexpression or mTOR inhibition. [score:6]
Furthermore, re -expression of mTOR in MCF-7 cells could significantly overcome the inhibitory effects of miR-99a mimics on regulation of mTOR/p-4E-BP1/p-S6K1 signal pathway (Figure 6C). [score:6]
Our study has further confirmed that miR-99a is a tumor suppressor gene, which is commonly downregulated in both breast cancer clinic tissues and breast cancer cell lines. [score:6]
This findings support a mo del where miR-99a directly inhibits mTOR expression in breast cancer via binding to mTOR 3′-UTR. [score:6]
Our current data demonstrate that reduced miR-99a expression in breast cancer tissues and cells result in mTOR overexpression, which in turn contributes to breast cancer development. [score:6]
Next, we co -transfected miR-99a mimics and mTOR cDNA plasmid that lacks the 3′-UTR into breast cancer cells to determine whether the ectopic expression of mTOR could reverse the inhibitory effect of miR-99a on breast cancer cells. [score:5]
miR-99a expression also reduces cell proliferation and induces cell apoptosis by targeting estrogen receptor 1(ESR1) in endometrial cancer [13]and IGF-1R in head and neck squamous cell carcinoma cells [14]. [score:5]
0092099.g003 Figure 3 (A) Targetscan prediction of miR-99a targeting of mTOR at the mTOR mRNA 3′-UTR. [score:5]
Overexpression of miR-99a inhibits breast cancer cell xenograft formation. [score:5]
Furthermore, the inhibition of breast cancer cell viability and the acceleration of apoptosis by miR-99a mimics were rescued by restoration of mTOR expression. [score:5]
Overexpression of miR-99a by transient gene transfection inhibited esophageal cancer cell proliferation and induced apoptosis [8]. [score:5]
Together, these results indicate that miR-99a overexpression clearly inhibits the proliferation of human breast cancer cells. [score:5]
The results showed that the inhibition of breast cancer cell proliferation and the acceleration of apoptosis by miR-99a mimics were rescued by restoration of mTOR expression (Figure 5C). [score:5]
Overexpression of miR-99a inhibits breast cancer cell viability and induces apoptosis. [score:5]
To further determine whether miR-99a inhibits mTOR expression in human breast cancer cells, we transfected miR-99a mimics into MCF-7 cells and analyzed mRNA and protein levels by qRT-PCR and immunoblot. [score:5]
We inhibited endogenous mTOR expression to assess whether it can mimic the biological effect of miR-99a. [score:5]
To further confirm that miR-99a inhibits mTOR expression in breast cancer, we analyzed the protein levels of mTOR from ten pairs of breast cancer and normal tissue specimens by immunoblot. [score:5]
In order to resolve this controversial result, our study has further confirmed that miR-99a is tumor suppressor by its dramatic down-regulation in breast cancer tissue samples and cell lines compared to the normal breast tissues. [score:5]
Furthermore, miR-99a expression was statistically inversely correlated with mTOR expression in both breast cancer tissue specimens and cell lines. [score:5]
i. e., mTOR expression in these four breast cancer cell lines were markedly higher than that in breast epithelial cell line, and was associated with reduced miR-99a expression (Figure 4B). [score:5]
The data have shown that the reduction of miR-99a was found in both breast cancer tissues from patients and human breast cancer cell lines, indicating that downregulation of miR-99a is clearly involved in human breast cancer development. [score:5]
The tumor suppressor gene miR-99a is frequently lost or expressed at reduced levels in various human cancers. [score:5]
miR-99a expression plasmid CMV-miR-99a and negative control CMV-NC (nontargeting control sequence) plasmid were purchased from GenePharma (Shanghai, China). [score:5]
For example, miR-99a was found to be down regulated in esophageal squamous cell carcinoma tissues and reduced miR-99a expression was correlated with worse overall patient survival. [score:4]
Our results have established that mTOR was a direct target of miR-99a in breast cancer cells. [score:4]
In our study, we found that knockdown of mTOR expression using mTOR siRNA decreased breast cancer cell viability and induced apoptosis, a similar outcome to that of tumor cells transfected with miR-99a mimics. [score:4]
We then compared mTOR and miR-99a expression in these tissues and found that among these 10 pairs of breast cancer tissues, there was a statistically significant inverse correlation between mTOR and miR-99a expression (Figure 4C). [score:4]
We found that the endogenous levels of both p-4E-BP1 and p-S6K1 proteins were markedly decreased after miR-99a mimics transfection compared to the control cells (Figure 6A), and inhibition of mTOR expression using mTOR siRNA also distinctly reduced levels of p-4E-BP1 and p-S6K1 proteins (Figure 6B). [score:4]
MTOR is a direct target of miR-99a in breast cancer cells. [score:4]
miR-99a regulated expression of mTOR downstream signaling pathway genes p-4E-BP1 and p-S6K1. [score:4]
mTOR is a direct target of miR-99a in MCF-7 breast cancer cell line. [score:4]
This study has further characterized that miR-99a is a tumor suppressor by directly targeting mTOR in human breast cancers. [score:4]
MiR-99a -mediated inhibition of mTOR is involved in tumor suppression of breast cancer cells. [score:4]
To confirm that mTOR is a direct target of miR-99a, we cloned the 3′UTR of mTOR into a reporter plasmid downstream from luciferase and performed reporter assays. [score:3]
Thus, the current study provides a strong support of miR-99 -targeted mTOR/p-4E-BP1/p-S6K1 signaling pathway in breast cancer cells. [score:3]
To determine whether miR-99a is involved in tumor suppression in human breast cancer cells, we assessed the effects of miR-99a's cell viability in breast cancer cells by transfecting with Lipofectamine 2000 only (MOCK), negative control (NC), or miR-99a mimics into MCF-7 and MDA-MB-231 cells. [score:3]
Expression of miR-99a was detected with the All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD), and normalized to U6 snRNA using the 2 [(−ΔΔCt)] method. [score:3]
We have extended these studies and shown that the mTOR mRNA 3′-UTR contains putative miR-99a target sites [11], [12], [17]. [score:3]
Differential expression of miR-99a in human breast cancer tissues and cell lines. [score:3]
0092099.g001 Figure 1(A) qRT-PCR analysis of miR-99a expression in 10 human breast cancer tissues vs. [score:3]
Statistical correlation between the expression levels of miR-99a and mTOR protein in breast cancer tissues and cell lines (A) mTOR protein was analyzed by Western blotting in 10 pairs of breast cancer tissues. [score:3]
The levels of p-4E-BP1 and p-S6K1, two downstream molecules of mTOR signaling pathway, are significantly reduced upon overexpression of miR-99a in human breast cancer cells. [score:3]
In this study, we first assessed miR-99a expression in breast cancer tissue from patients and then from breast cancer cell lines. [score:3]
miR-99a/mTOR might therefore be used as potential therapeutic targets in breast cancer. [score:3]
Although miR-99a is a well-studied tumor suppressor in a variety of human cancers, its function in human breast cancers is not very clear. [score:3]
miR-99a was also found to induce cell cycle arrest at G1 phase and suppress tumorigenicity in renal cell carcinoma [9]. [score:3]
Previous studies have shown that miR-99a was down regulated in several human cancers including esophageal squamous cell carcinoma, hepatocellular carcinoma cells and prostate cancer cells [8], [11], [12], but most studies were performed on different cancer cell lines and no study was conducted directly from patients in clinic. [score:3]
Turcatel et al used mouse mammary gland cells to demonstrate that miR-99a can suppress a complex network of transforming breast epithelial to mesenchymal cells and proliferation and migration of breast cancer cells [10]. [score:3]
Our ex vivo data also showed a statistically significant inverse correlation between expression of mTOR and miR-99a in breast cancer tissues and cell lines. [score:3]
The miR-99a -mediated suppression of mTOR in MCF-7 cells was rescued by transfection of mTOR cDNA plasmid without the 3′-UTR. [score:3]
Moreover, the repression of mTOR expression by miR-99a was rescued by transfection of mTOR cDNA plasmid that lacks the 3′-UTR. [score:3]
Moreover, we also detected miR-99a expression in four breast cancer cell lines (i. e., MCF-7, MDA-MB-231, MDA-MB-435s, and SKBR-3) and a normal human breast epithelial cell line HBL-100. [score:3]
The inhibitory effect of miR-99a mimics on human breast cancer cells. [score:3]
After a 4-week selection period, MDA-MB-231 cell lines with stable expression of miR-99a or control were obtained; these were designated MDA-MB-231-99a and MDA-MB-231-NC, respectively. [score:3]
To assess the inhibitory effect of miR-99a in breast cancer cells, we performed the in vivo tumor xenograft assay using 18 female, 4 to 5-weekold BALB/c nude mice. [score:2]
Analysis of qRT-PCR showed that miR-99a expression was reduced in all 10 cases of human breast cancer tissues compared to the normal tissue counterparts (Figure 1A). [score:2]
However, the open question is that the mechanism of deregulated miR-99a in a variety of human cancers has not been defined in the field based on previous studies as well as ours. [score:2]
The level of miR-99a expression was normalized to U6 and compared to the normal cells. [score:2]
As shown in Figure 1B, miR-99a expression was significantly reduced in human breast cancer cell lines compared to HBL-100 cells. [score:2]
The mice, which were divided into three treatment groups with 6 mice in each group, i. e. MDA-MB-231 cells with CMV-miR-99a, CMV-NC, and MOCK groups (1×10 [6]), were subcutaneously injected in the left flank to establish the tumor xenograft. [score:1]
mTOR plays a critical role in mediating miR-99a dependent biological functions in breast cancer. [score:1]
The next day, 50 nM of mTOR siRNA or miR-99a mimics was transfected into BC cells using Lipofectamine 2000 (Invitrogen, Carlsbad, USA) according to the manufacturer's protocol. [score:1]
The average tumor volume of the CMV-NC group was 1.68 fold higher than that of the CMV-miR-99a group after 30 days post-inoculation (Figure 2E). [score:1]
After transfected with miR-99a mimics, mTOR siRNA, or negative control for 72 h, the cells were incubated in serum-free medium for 24 h for cell synchronization. [score:1]
Xenograft sizes from six representative nude mice from three treatment groups (MDA-MB-231 cells with CMV-miR-99a, CMV-NC and MOCK). [score:1]
Both miR-99a and the related miR-99b can modulate TGF-beta -induced epithelial to mesenchymal transition in normal murine mammary gland cells [10]. [score:1]
For the mTOR cDNA plasmid without 3′-UTR (Addgene, Cambridge, USA) and miR-99a mimics combination experiment, MCF-7 cells were first transfected with miR-99a mimics (50 nM). [score:1]
Cells were transfected with CMV-miR-99a (2 μg) or CMV-NC (2 μg) using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. [score:1]
Taken altogether, these studies demonstrate miR-99a antitumor activity in different human cancers. [score:1]
Briefly, cells were plated in 96-well plates at a density of 1×10 [4] cells/well and then transfected with miR-99a mimics, mTOR siRNA, or scrambled negative control (NC) using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. [score:1]
Together, the data suggests an important role of mTOR as a mediator of the biological effects of miR-99a. [score:1]
miR-99a mimics, mTOR siRNA and scrambled negative control (NC) were chemically synthesized by GenePharma (Shanghai, China). [score:1]
However, to date, there has been no study reporting the role of miR-99a in human breast cancer. [score:1]
The cell viability curve was constructed consecutively for up to 72 h after transfection of MCF-7 and MDA-MB-231 cells with Lipofectamine 2000 only (MOCK), scrambled negative control (NC) and miR-99a mimics. [score:1]
the control group, in a manner similar to those transfected with miR-99a mimics (Figure 5A). [score:1]
However, the precise mechanism of miR-99a antitumor activity remains to be defined. [score:1]
The corresponding mutant constructs were created by mutating the seed regions of the miR-99a -binding sites (5′-UACGGGU -3′ to 5′-AUGCCCA -3′). [score:1]
In contrast, the relative luciferase activity of the mutant mTOR 3′UTR reporter had no significant difference from the control group and failed to respond to miR-99a (Figure 3B). [score:1]
Thus, in the current study, we have assessed the role of miR-99a in breast cancer cells, and then explored the underlying molecular mechanism responsible for miR-99a antitumor activity. [score:1]
The wild-type 3′-UTR fragment of human mTOR mRNA containing the putative miR-99a binding site was amplified by PCR and cloned into the XbaI site of the pGL3-control vector (Promega, USA) which is the downstream of the luciferase reporter gene. [score:1]
The results indicated that mTOR was required for the miR-99a -dependent cell viability and apoptosis effect in breast cancer cells. [score:1]
However, the MCF-7 cells transfected by mTOR cDNA plasmid that lacks 3′-UTR dramatically overcame the repressive effect of miR-99a mimics (Figure 3D). [score:1]
mTOR mediated miR-99a antitumor activity in breast cancer cells. [score:1]
0092099.g006 Figure 6 (A-C) Immunoblot analyses of total and phosphorylated 4E-BP1 and S6K1 from MCF-7 breast cancer cells transfected with miR-99a mimics (A), mTOR siRNA(B), and co-transfection of both miR-99a mimics and mTOR cDNA plasmid without the 3′-UTR(C). [score:1]
We found that tumor growth in the CMV-miR-99a group was significantly slower than that of the control groups (Figure 2D). [score:1]
Future studies will also investigate whether the miR-99a -mediated inhibition of mTOR signaling pathway could be used as a potential therapeutic strategy to effectively control breast cancer in clinic. [score:1]
[1 to 20 of 103 sentences]
3
[+] score: 348
[38] qRT-PCR was performed to determine the relative RNA levels of: (1) miR-99a in 10 cancer tissues (versus normal) to corroborate the array data; (2) miR-99a RNA levels in H1299, H1975 and H1650 NSCLC cell lines (control and transfected with miR-99a); (3) Nanog, Oct3/4, Sox2, Snail and Twist genes in the H1299, H1975 and H1650 NSCLC cell lines expressing miR-99a versus control; (4) Nanog, Oct3/4, Sox2, Snail and Twist genes in H1975 mice tumours formed by miR-99a expression (versus control); (5) Nanog, Oct3/4, Sox2, Snail and Twist genes in 8 cancer tissues: the top 4 with highest miR-99a expression (patients 6, 26, 28 and 48 from series 1) versus the top 4 with the lowest miR-99a expression (patients 14, 18, 36 and 40) from the array (series 1) and (6) miR-99a in 30 cancer tissues to correlate with E2F2 and EMR2 expression. [score:11]
A total of 95 deregulated microRNAs were identified in this second series of 23 patients (48 upregulated and 47 downregulated), of which 29 microRNAs were common with the first series and miR-99a was also confirmed as one of the most downregulated microRNAs (Figure 1a and Supplementary Table 4). [score:11]
[37] We observed that: (1) miR-99a expression inversely correlated with β-catenin expression and (2) E2F2 and EMR2 expression correlated with β-catenin expression in the lung cancer biopsies. [score:9]
This association supports the results obtained from the mice tumours that pointed out that lower expression of E2F2 and EMR2 proteins (due to miR-99a upregulation) favours an epithelial phenotype and downregulation of stemness -associated genes. [score:9]
20, 32, 33 In the current study, we found that all mice tumours formed by miR-99a overexpression showed a fusocellular pattern different from the tumours formed in the control group, supporting a role of miR-99a in EMT inhibition concomitant to a downregulation of stem cell genes. [score:8]
[14] Increased protein expression levels of N-cadherin and decreased E-cadherin expression, as indicators of the EMT, were observed in the mice tumours derived from the control group but not in those originated from miR-99a expression (Figure 5f). [score:7]
The presence of miR-99a was able to inhibit the expression of each wild-type 3′-UTR and the 3′-UTR mutants revealed no effects, indicating that these two proteins are targets of miR-99a (Figure 3c). [score:7]
Of note, lung cancer biopsies with high expression levels of miR-99a showed downregulation of the stem cell genes when compared with biopsies with very low expression. [score:7]
miR-99a suppresses tumourigenicity in vivoTo confirm the tumour-suppressive function of miR-99a in vivo, 1 × 10 [6] miR-99a -expressing H1975 cells and controls were xeno -injected subcutaneously to immunocompromised mice. [score:7]
In order to analyse whether E2F2 or EMR2 expression was able to rescue the suppressive function of miR-99a, coexpression of E2F2 or EMR2 genes was performed concomitantly with miR-99a (Figure 4a). [score:7]
Other EMT-related genes, such as Snail and Twist, were downregulated in the miR-99a -expressing mice tumours and NSCLC cells but not in biopsies (Figures 6a–c). [score:6]
Downregulation of both EMR2 and E2F2 proteins occurred upon expression of miR-99a (Figure 3b and Supplementary Figure 7a). [score:6]
Accordingly, E2F2 but not EMR2 overexpression concomitantly to miR-99a was able to rescue the suppressive function of miR-99a in proliferation of NSCLC cells. [score:5]
In such tumours, miR-99a expression inversely correlated with E2F2 expression. [score:5]
We also found that concomitant expression of E2F2 and EMR2 with miR-99a was able to rescue the inhibitory role of miR-99a on cell migration (Figure 4b). [score:5]
To determine whether E2F2 and/or EMR2 expression was able to inversely correlate with miR-99a expression in patients, RNA was extracted from a group of 30 randomly taken patients out of 119. [score:5]
Overall, a tumour-suppressor function of miR-99a was observed upon expression of miR-99a in all lung cancer cell lines. [score:5]
miR-99a expression targets CSCs. [score:5]
At 72 h after transfection, cells were counted and the cellular lysates were collected for analysis of the protein expression of the selected putative miR-99a targets. [score:5]
Expression of β-catenin inversely correlated with miR-99a expression (Figure 8g). [score:5]
The expression level of E2F2 (but not EMR2) inversely correlated with miR-99a expression (Figure 8). [score:5]
Moreover, changes in protein expression of N-cadherin and E-cadherin were also observed in H1975 cells expressing miR-99a versus control cells (Supplementary Figure 10a). [score:5]
These results support the tumour-suppressor function of miR-99a and its link with the identified targets. [score:5]
[17] We described two novel miR-99a targets, E2F2 and EMR2, representing two oncogenic proteins that could modulate tumour suppression in NSCLCs. [score:5]
To confirm the tumour-suppressive function of miR-99a in vivo, 1 × 10 [6] miR-99a -expressing H1975 cells and controls were xeno -injected subcutaneously to immunocompromised mice. [score:5]
from the qRT-PCR corroborate well the data from the microRNA array for assessing up- or down-regulated miR-99a. [score:4]
The consistency of the downregulation of the stem cell genes (cells, mice tumours and human biopsies) led us to hypothesise that miR-99a could modulate the CSC population. [score:4]
In order to detect cells with a stem cell-like properties, the ‘Side Population’ (SP) discrimination assay has been performed for H1975 cells expressing miR-99a or miR-C. The percentage of the SP detected in control or miR-99a expressing H1975 cells was 2.66% and 1.02%, respectively, suggesting increased stem-like cancer cells (Figure 7a). [score:4]
Downregulation of these proteins by miR-99a provokes apoptosis and cell cycle arrest with a consequent decrease of proliferative capacity. [score:4]
As the CSC-related genes were downregulated in the mice tumours, NSCLC cells and biopsies, we hypothesised that miR-99a might play an important role in acquisition of CSC features in lung tumourigenesis. [score:4]
miR-99a was among of the most downregulated microRNAs (Supplementary Table 2). [score:4]
Proliferation profiles of either stably or transiently miR-99a -expressing cells were similar (Supplementary Figures 4b–d, data not shown). [score:3]
Potential miR-99a targets were predicted and analysed by using publicly available algorithm -based databases, including PicTar (http://pictar. [score:3]
[40] For the stable expression, miR-99a (cloned in miR-V, designated miRV-99a), miR-V and miRV-GFP were included, the latter for checking infection efficiency that in all cases was ~100%. [score:3]
For the miR-99a stable overexpression experiments, premiR-99a was cloned into retroviral vector miR-V that was kindly donated by Dr. [score:3]
Accordingly, a decrease in the number of miR-99a -expressing cells was confirmed by Trypan-blue staining (Supplementary Figure 4e). [score:3]
Bioinformatic search revealed two potential novel targets of miR-99a, EMR2 and E2F2. [score:3]
To validate these proteins as miR-99a targets, the 3′-UTR of each gene was cloned in the pmirGLO vector (Figure 3a). [score:3]
The suppressive function of miR-99a was maintained at physiological levels, as shown by treatment of the above cells with 1:10 and 1:3 diluted miR-99a-viral supernatants (Figure 2 and Supplementary Figures 5 and 6a). [score:3]
[34] Therefore, activation of the EMT can increase CSC number and that miR-99a can inhibit the viability of the CSC population. [score:3]
The levels of miR-99a and target proteins were verified after transfection and just before the injection (Figure 5a, data not shown). [score:3]
In order to verify the results from the array, a total of 10 patients from series 1 were studied for the expression of miR-99a by qRT-PCR (Supplementary Figures 3a and b). [score:3]
For the cell cycle analysis, a fluorescence-activated cell sorting Calibur flow cytometer (FACS Calibur, Becton Dickinson, E0772; BD Biosciences, San Jose, CA, USA) was used to analyse H1299, H1650 and H1975 cells that transiently or stably expressed miR-99a versus negative control. [score:3]
We conclude that the major contributor of the suppressive function of miR-99a in NSCLC cells is E2F2 and the contribution of EMR2 is only partial. [score:3]
To assess the properties of miR-99a, the H1299, H1650 and H1975 cells were transduced with miR-99a mimic (miR-99a) or miR-C (non-target control). [score:3]
Moreover, the effect of an anti-miR-99a was accompanied by an increase of EMR2 and E2F2 protein expressions (Figure 3d and Supplementary Figure 7b). [score:3]
The microscopic examination of tumours revealed a consistent pattern of heterogeneous tumours with fusocellular morphology in the control group in contrast to a more homogeneous epithelial pattern observed in tumours overexpressing miR-99a (Figure 5e). [score:3]
Expression of miR-99a also decreased two times the SP number in H1299 cells (Figure 7b). [score:3]
miR-99a suppresses tumourigenicity by inducing apoptosis and cell cycle arrest. [score:3]
Moreover, miR-99a exerts a tumour-suppressor function not only in CSCs (decreasing their percentage and functionality) but also in parental cells from the lung (decreasing their proliferation capacity). [score:3]
Overall, these data provide compelling evidence of two novel targets for miR-99a. [score:3]
In view of our data, we propose that those lung cancer tumours with high miR-99a levels and corresponding repression of E2F2 and EMR2 would evolve more favourably because of an inhibition of cell proliferation. [score:3]
An increase in apoptosis was detected after miR-99a expression in the three cell lines (Figure 2e). [score:3]
Under these conditions, miR-99a -expressing CSCs formed fewer colonies than those CSCs derived from control cells (Figure 7d). [score:3]
We demonstrate that E2F2 but not EMR2 was able to rescue the suppressive function of miR-99a in H1299, H1650 and H1975 cells (Figure 4a). [score:3]
E2F2 and EMR2 are revealed as two novel miR-99a targets. [score:3]
27, 28 In NSCLC cells, we found that the action of both E2F2 and EMR2 concurred to the suppressor function of miR-99a, thereby supporting a proliferative and pro-oncogenic role for these proteins. [score:3]
Parental cells for each cell line, the control cells (miRV-GFP-infected), and cells that expressed miR-99a (miRV-99a) were grown simultaneously. [score:3]
The miR-99a -expressing cells formed fewer colonies than control cells (Figure 7c). [score:3]
miR-99a suppresses invasion and migration whereas favours adhesion of NSCLC cells. [score:3]
To select the putative miR-99a mRNA targets, we focussed on those detected in more than one miRNA database. [score:3]
To uncover possible mechanisms of the miR-99a -mediated suppression of cell proliferation, cell cycle arrest, apoptosis and senescence were studied. [score:3]
To our knowledge, this is the first study that associates the tumour-suppressor function of miR-99a with E2F2 and EMR2 repression. [score:3]
Moreover, miR-99a overexpression stimulated cell adhesion (Supplementary Figure 8b, data not shown). [score:3]
H1299, H1650 and H1975 cells were transfected with miR-99a versus control and infected with miRV-99a or miRV-GFP and were selected with blasticidin for stable expression. [score:3]
E2F2 and EMR2 overexpression is concomitant to miR-99a. [score:3]
miR-99a suppresses tumourigenicity in vivo. [score:3]
Our results support previous studies reporting a tumour-suppressive function for miR-99a as a general mechanism for other cancer mo dels. [score:3]
Finally, representative lung cancer biopsies were assessed for the SP and miR-99a expression. [score:3]
[40]For the stable expression, miR-99a (cloned in miR-V, designated miRV-99a), miR-V and miRV-GFP were included, the latter for checking infection efficiency that in all cases was ~100%. [score:3]
Concomitant expression of E2F2 or EMR2 with miR-99a restored the effect of sphere formation (Figure 4c). [score:3]
miR-99a -expressing cells were negative for β-galactosidase staining, discarding the possibility of cell senescence (data not shown). [score:3]
Moreover, miR-99a expression sensitised CSCs to the exposure of CDDP but had no effect on the parental H1975 cells (Figure 7f). [score:3]
In particular, CSC sensitisation to CDDP by miR-99a is not only due to the inhibition of E2F2 and/or EMR2 but also due to participation of other proteins. [score:3]
miR-99a expression was verified by qRT-PCR (Figure 2a). [score:3]
This was accompanied by cell cycle arrest in miR-99a -expressing cells as compared with control cells (Figure 2f). [score:2]
A schematic representation of the binding sites of miR-99a with EMR2 and E2F2 is shown (Figure 3a). [score:1]
Tumours formed by miR-99a were smaller than those formed in the control group (Figures 5b–d). [score:1]
Second, NSCLC cells were transfected with miR-99a in nonadherent conditions with a stem cell media. [score:1]
Quantitative real-time PCR was used to determine levels of miR-99a (Hs04231437_s1), miR-205 (ID 000509), Nanog (Hs04399610_g1), Oct3/4 (Hs04260367_gH), Sox2 (Hs01053049_s1), Snail (Hs00161904_m1), Twist (Hs01675818_s1) and housekeeping genes U6 (ID 0001093), TBP (Hs00427620_m1) and IPO8 (Hs00183533_m1) using the Assays-on-Demand Taqman Gene Expression Assays (Applied Biosystems, Foster City, CA, USA) according to the procedure previously described. [score:1]
Conversely, anti-miR-99a was able to reverse proliferative effect of miR-99a (Figure 2d, data not shown). [score:1]
Both the pmirGLO 3′-UTR-E2F2 and pmirGLO 3′-UTR-EMR2 plasmids were transfected in HEK293T cells concomitantly with miR-99a. [score:1]
For the mutant E2F2 miR-99 construct, the seeding sequence was replaced with 5′-GGGAGATATGAATGGTACcaaTG-3′ having recognition site for KpnI restriction enzyme (Figure 3a and Supplementary Table 8). [score:1]
H1975 cells were injected into a total of 16 mice (8 mice were xeno -injected with control microRNA and 8 mice with miR-99a). [score:1]
HEK293T cells were seeded at 1 × 10 [4] cells per well in a 96-well plate and were transfected the following day with Lipofectamine with the following molecules: the synthetic miRNA precursor miR-99a (ID: AM17100; Thermo Fisher Scientific), and negative control miR-C (ID: AM17110; Ambion), Cy3 (ID: AM17020; Thermo Fisher Scientific) and the pmirGLO plasmid (Promega Corporation, Madison, WI, USA) containing the luciferase reporter and also the Renilla gene (control) versus pmirGLO3′-UTR-E2F2 or pmirGLO3′-UTR-EMR2. [score:1]
In order to validate the miR-99a biological effect, the anti-miR-99a was included for comparison (Figures 2g and 8a and Supplementary Figure 9a). [score:1]
H1975 lung cancer cells (1 × 10 [6] cells) were transiently transfected with 100 nM of control microRNA (miR-C, non-silencing control) or miR-99a mimic. [score:1]
Transient transfection of H1299, H1650 and H975 cells using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) or jetPEI (Polyplus) was performed with the synthetic precursors of miR-99a called pre-miR-99a or miR-99a mimic (designated here as miR-99a) (ID: AM17100; (Thermo Fisher Scientific)), anti-miR-99a (ID: 10719; Thermo Fisher Scientific), a Cy3 dye -labelled negative control (ID: AM17020; Thermo Fisher Scientific) or negative control miR-C (ID: AM17110; Thermo Fisher Scientific). [score:1]
miR-99a levels in the mice tumours were able to persist upon few weeks from the initial transient transfection in H1975 cells (Supplementary Figure 11d). [score:1]
This finding highlights the functional plasticity of miR-99a according to the cellular context. [score:1]
H1299, H1650 and H1975 cells were seeded at 2.5 × 10 [5] and 2.0 × 10 [5] and 1.5 cells × 10 [5] per well, respectively, in 6-well plates and transiently transfected with miR-99a or anti-miR-99a to a final concentration of 80 nM with Lipofectamine according to the manufacturer’s instructions. [score:1]
Transduction with miR-99a decreased proliferation of NSCLC cells (Figures 2b and c and Supplementary Figure 4a). [score:1]
miR-99a reduced the migration and invasion in all three lines (Figure 2g, Supplementary Figures 8a and 9a–b, data not shown). [score:1]
For the preparation of the analysis of the SP cells, H1299 and H1975 cells were transduced using Lipofectamine 2000 concomitantly with Cy3 dye -labelled negative control plus miR-99a versus miR-C (1 : 10 ratio) in order to select only transfected cells. [score:1]
Indeed, cells overexpressing miR-99a have less number of CSCs and less self-renewal ability that are known characteristics of CSCs. [score:1]
miR-99a reduces the proliferative capacity of NSCLC cells. [score:1]
Two previous publications described the ability of miR-99a to reduce migration and invasion in bladder and lung cancer cells. [score:1]
Overall, the above results suggest that miR-99a reverses the phenotype of CSCs by decreasing their tumourigenic potential. [score:1]
Particularly, miR-99a could be a potential therapeutic marker in lung cancer. [score:1]
At third, miR-99a -expressing spheroid CSCs, adherent (parental) or control cells were grown in the presence of cisplatin (CDDP) and cell viability was measured at 48 h post treatment. [score:1]
An inverse correlation with miR-99a level was found (Figure 7h and Supplementary Figure 11c). [score:1]
For the mutant EMR2 miR-99 construct the seeding sequence was replaced with 5′-GTTGTTCTCTAGTTCTAaGcttTT-3′ having recognition site for HindIII restriction enzyme (Figure 3a and Supplementary Table 8). [score:1]
First, NSCLC cells that normally grow in standard adherent conditions were transfected with miR-99a and forced to grow in tridimensional cultures (soft agar), allowing to form colonies during 10–15 days. [score:1]
Moreover, cells infected with miR-99a viral construct in a 1 : 10 dilution were also able to increase apoptosis (Supplementary Figure 6b, data not shown). [score:1]
We found that miR-99a -mediated decrease of cell proliferation elicits a different response depending on the cell line. [score:1]
Approximately 500 nt of the genomic DNA sequence that encodes for primary miR-99a and its natural flanking sequences was selected for PCR amplification, according to a previously described procedure. [score:1]
[1 to 20 of 106 sentences]
4
[+] score: 329
In view of our present results showing decreased miR-99a expression in RCC clinical samples correlating with overall survival of RCC patients and the suppression of tumorigenicity upon upregulation of miR-99a in vitro and in vivo, we propose a hypothesis that miR-99a may be an attractive target for prognostic and therapeutic interventions in RCC. [score:10]
Expression of miR-99a has been proved frequently downregulated in various tumors [14- 20], but the mechanisms underlying the downregulation of miR-99a in cancers remain to be unknown. [score:9]
As shown in Figure 6A, compared with NC transfectants, the expression of p-p70S6K and p-4E-BP1 were downregulated in miR-99a-restored 786–0 cells, which suppressed the activation of sequential signaling cascades involved in synthesis of several G1/S transition-related molecules [21, 22]. [score:7]
Furthermore, siRNA -mediated knockdown of mTOR partially phenocopied the effect of miR-99a overexpression, suggesting that the tumor suppressive role of miR-99a may be mediated primarily through mTOR regulation. [score:7]
Compared with nonmalignant immortalized renal cell line HK-2, the expression of miR-99a was significantly downregulated in RCC cell lines 786–0 and OS-RC-2. As consistent with the results in cell lines, detection of miR-99a in RCC tissues also pointed to a dramatic attenuation of miR-99a expression in 72.5% (29/40) of RCC tissues. [score:7]
Collectively, these results demonstrate for the first time, to our knowledge, that deregulation of miR-99a is involved in the etiology of RCC partially via direct targeting mTOR pathway, which suggests that miR-99a may offer an attractive new target for diagnostic and therapeutic intervention in RCC. [score:7]
It has been reported that overexpression of miR-99a inhibits the growth of prostate cancer cells and decreases the expression of prostate-specific antigen (PSA) [19]. [score:7]
Up to date, there are no studies on the mechanisms of miR-99a downregulation in RCC, so illuminating the mechanisms responsible for downregulation of miR-99a in RCC would be our next study in the future. [score:7]
In addition, We detected the expression of mTOR in tumor xenografts after miR-99a injection by Western blot, we found that intratumoral delivery of synthetic miR-99a makedly suppressed mTOR expression compared with control mice (Figure 4B). [score:6]
MicroRNA-99a (miR-99a), a potential tumor suppressor, is downregulated in several human malignancies. [score:6]
We found that miR-99a was remarkably downregulated in RCC and low expression level of miR-99a was correlated with poor survival of RCC patients. [score:6]
These findings indicate that miR-99a is wi dely downregulated in human cancers, suggesting a potential role of miR-99a as a tumor suppressor. [score:6]
In addition, with the help of a bioinformatic analysis, we found that the mammalian target of rapamicin (mTOR), a key promoter of cell growth, was a direct target of miR-99a in RCC cells. [score:6]
We restored miR-99a in 786–0 cells and found that the expression of p-p70S6K, p-4E-BP1, cyclin D1, cyclin D3 and cyclin E are really downregulated, consistent with the previous reports in hepatocellular carcinoma [17]. [score:6]
To explore the mechanisms by which miR-99a regulates the tumorigenicity of RCC, we performed a bioinformatic search (Targetscan, Pictar and MICROCOSM) for putative targets of miR-99a and found 3 [′]UTR of mTOR containing the highly conserved putative miR-99a binding sites (Figure 5A). [score:6]
In addition, we also fond that mammalian target of rapamycin (mTOR) was a direct target of miR-99a in RCC cells. [score:6]
In conclusion, our study demonstrates for the first time that deregulation of miR-99a is involved in the etiology of RCC partially via direct targeting mTOR pathway. [score:5]
Relative miR-99a level was assessed by real-time qRT-PCR and T/N = 0.5 was chosen as the cut-off point for separating miR-99a high -expression tumors (n = 11; T/N > 0.5) from miR-99a low -expression cases (n = 29; T/N < 0.5). [score:5]
The present study was undertaken to examine the expression of miR-99a in RCC cell lines and tissues, assess the impact of miR-99a on RCC cells and RCC xenograft modle, and identify target genes for miR-99a that might mediate their biological effects. [score:5]
Furthermore, siRNA -mediated knockdown of mTOR partially phenocopied miR-99a restoration suggesting that the tumor suppressive role of miR-99a may be mediated primarily through mTOR regulation. [score:5]
To identify the expression of miR-99a in RCC, we firstly performed real-time qRT-PCR using the renal cell line HK-2 and RCC cell lines 786–0 and OS-RC-2 and found that miR-99a expression in RCC cell lines (786–0 and OS-RC-2) was significantly lower than that in HK-2 (Figure 1A). [score:5]
As consistent with the results in cell lines, the expression of miR-99a was remarkably downregulated in RCC tissues (29/40, 72.5%), compared with matched adjacent non-tumor tissues (Figure 1B). [score:5]
The reduced expression of miR-99a in RCC prompted us to identify whether miR-99a functions as a tumor suppressor. [score:5]
However, the migration and invasion of mTOR-knockdowned 786–0 cells were not decreased, which suggests that the regulation of miR-99a on migration and invasion in RCC cells is not likely related to mTOR inhibition. [score:5]
However, the migration and invasion of mTOR- knockdowned 786–0 cells were not decreased compared with NC transfectants (Figure 7D, E), which suggests that the regulation of miR-99a on migration and invasion in RCC cells is not likely related to mTOR inhibition. [score:4]
To further elucidate mechanisms underlying the tumor suppressive effect of miR-99a, we knockdowned mTOR in 786–0 cells and found that the proliferation and colony formation were decreased and the G1-phase population was increased, similar to the phenotype observed upon miR-99a restoration in 786–0 cells. [score:4]
We found that intratumoral delivery of synthetic miR-99a induced a makedly inhibition of mTOR expression compared with control mice. [score:4]
As mentioned above, miR-99a was remarkably downregulated in RCC cell lines (Figure 1A). [score:4]
To further reveal mechanisms underlying this tumor suppressive effect of miR-99a, we knockdowned mTOR in RCC cells. [score:4]
It has been reported that miR-99a is transcribed from the commonly deleted region at 21q21 in human lung cancers [13], and that miR-99a is downregulated in ovarian carcinoma [14], squamous cell carcinoma of the tongue [15], squamous cell lung carcinoma [16], hepatocellular carcinoma [17], bladder cancer [18], prostate cancer [19] and childhood adrenocortical tumors [20]. [score:4]
Notably, dramatic downregulation of miR-99a was observed in 50% (9/18) cases of low stage (pT1 + pT2) and 91% (20/22) cases of high stage (pT3 + pT4) RCC. [score:4]
It has been reported that downregulation of miR-99a is caused by the activation of Src/Ras-related pathways in human tumors [23]. [score:4]
Taken together, we conclude that the tumor suppressive role of miR-99a may be mediated partially through mTOR pathway regulation. [score:4]
In our study, we found that the regulation of miR-99a on migration and invasion in RCC cells is not likely related to mTOR inhibition. [score:4]
With the help of bioinformatics prediction and sequential experimental demonstration, mTOR was identified as a direct target of miR-99a in RCC. [score:4]
miR-99a is downregulated and correlates with overall survival in renal cell carcinoma. [score:4]
There results suggest that the tumor suppressive role of miR-99a may be mediated partially through mTOR pathway regulation. [score:4]
In this study, we observed that miR-99a was remarkably downregulated in RCC cell lines and tissues and correlated with overall survival of RCC patients. [score:4]
To show that miR-99a participated in the regulation of mTOR expression, we restored miR-99a in RCC cells. [score:4]
Downregulation of miR-99a leading to increase of mTOR and p-mTOR results in the phosphorylation of 4E-BP1 and p70S6K, which in turn activates protein synthesis,promotes cell proliferation and cell clonability and allows progression from the G1 to the S phase of the cell cycle. [score:4]
These findings suggest that miR-99a plays a tumor suppressive role and may be a therapeutic intervention in RCC. [score:3]
Restoration of miR-99a induced G1-phase cell cycle arrest in vitro and dramatically suppressed tumorigenicity of RCC in vitro and in vivo. [score:3]
miR-99a suppresses tumorigenicity in vitro. [score:3]
These results indicate that miR-99a expression possibly correlates with pathologic stage of RCC. [score:3]
Then we detected the expression of cyclin D1, cyclin D3 and cyclin E in miR-99a-restored 786–0 cells. [score:3]
mTOR is a target of miR-99a. [score:3]
These observations suggest that miR-99a restoration suppresses the tumorigenicity of RCC cells in vitro. [score:3]
Figure 1 MiR-99a is downregulated in renal cell carcinoma. [score:3]
In addition, restoration of miR-99a dramatically suppresses tumor cell growth in lung cancer [23]. [score:3]
The RCC cell lines 786-O and OS-RC-2 were transfected with miR-99a mimics to restore the expression of miR-99a. [score:3]
Then we analysed miR-99a expression in clinical samples. [score:3]
miR-99a suppresses tumor growth in vivo. [score:3]
In addition, lower miR-99a expression level in RCC tissues significantly correlated with reduced overall survival in RCC patients. [score:3]
As shown in Figure 1C, lower miR-99a expression level in RCC tissues dramatically correlated with decreased overall survival of RCC patients. [score:3]
Restoration of miR-99a dramatically suppressed RCC cells growth, clonability, migration and invasion as well as induced G1-phase cell cycle arrest in vitro. [score:3]
Moreover, intratumoral delivery of miR-99a could inhibit tumor growth in murine xenograft mo dels of human RCC. [score:3]
We found that restoration of miR-99a suppressed cell growth, clonability, migration and invasion and induced G1-phase cell cycle arrest in vitro. [score:3]
Figure 5 MTOR is a target of miR-99a. [score:3]
Recently, Li et al. reported that restoration of miR-99a significantly inhibits hepatocellular carcinoma cell growth in vitro by inducing the G1 phase cell cycle arrest [17]. [score:3]
Our study suggests that miR-99a may offer an attractive new target for diagnostic and therapeutic intervention in RCC. [score:3]
We therefore examined the expression of miR-99a in RCC cell lines and tissues, and assessed the impact of miR-99a on the tumorigenesis of RCC. [score:3]
Figure 4 MiR-99a suppresses tumor growth in vivo. [score:2]
These characteristics of miR-100 and miR-199a-3p are quite similar to those of miR-99a, indicating that mTOR expression might be regulated redundantly by various closely related miRNAs. [score:2]
The enforced expression of miR-99a in RCC cell lines led to a decrease in mTOR protein and also led to a decrease in phospho-mTOR (p-mTOR) protein, compared with NC transfectants (Figure 5C). [score:2]
CCK-8 assay showed that mir-99a restoration was more potent than their NC transfectants in inhibiting the proliferation of RCC cells. [score:2]
To investigate whether downregulation of miR-99a in RCC tissues correlated with overall survival of RCC patients, we performed statistical analysis with Kaplan-Meier method. [score:2]
Figure 7 MTOR knockdown partially phenocopies miR-99a restoration in renal cell carcinoma cells. [score:2]
At the end of the experiment, intratumoral delivery of synthetic miR-99a induced a specific inhibitory response and robustly interfered with tumor growth compared with control mice. [score:2]
Taken together, these findings showed a direct interaction between miR-99a and mTOR mRNA in RCC cell lines. [score:2]
To ascertain the direct miR-99a-mTOR interaction, we created pGL3-WT-mTOR-3 [′]UTR and pGL3-MUT- mTOR-3 [′]UTR plasmids. [score:2]
mTOR knockdown partially phenocopies miR-99a restoration in renal cell carcinoma cells. [score:2]
Figure 2 MiR-99a suppresses tumorigenicity in vitro. [score:2]
Thus, we concentrated on miR-99a in RCC. [score:1]
786-O and OS-RC-2 cells were transfected with miR-99a or NC. [score:1]
A murine xenograft mo del of RCC was used to confirm the effect of miR-99a on tumorigenicity in vivo. [score:1]
786–0 and OS-RC-2 cells were transfected with the miR-99a mimics, mTOR-siRNA or negative control (NC) for 48 hours and then seeded at 2000 cells per well in 96-well plates. [score:1]
Previous studies have reported that miR-99a participated in tumorigenesis of several tumor type,including hepatocellular carcinoma [17], prostate cancer [19], childhood adrenocortical tumors [20] and lung cancer [23]. [score:1]
miR-99a induces G1-phase cell cycle arrest. [score:1]
Moreover, intratumoral delivery of miR-99a was sufficient to trigger in vivo regression of tumor growth in RCC xenograft mo del. [score:1]
However, up to date, there are no studies of miR-99a in RCC. [score:1]
These mice were then treated with 200 pmol miR-99a or NC mimics in 10 μl Lipofectamine 2000 through a local injection of the xenograft tumor at multiple sites. [score:1]
786-O and OS-RC-2 cells were transfected with the miR-99a mimics, mTOR-siRNA or negative control (NC) for 24 hours and then seeded for colony formation in 6-well plates at 200 cells per well. [score:1]
So, there was an inverse correlation between miR-99a levels and mTOR protein. [score:1]
pGL3-MUT-mTOR- 3 [′]UTR was generated from pGL3-WT-mTOR-3 [′]UTR by deleting the binding site for miR-99a “UACGGGU”. [score:1]
786-O and OS-RC-2 cells were transfected with the miR-99a mimics, mTOR-siRNA or negative control (NC), cultivated for 48 hours, and transferred on the top of Non-matrigel-coated/ Matrigel-coated chambers (24-well insert, 8-μm pore size, BD Biosciences, San Jose, USA) in a serum-free RPMI 1640 and the medium containing 30% fetal calf serum was added to the lower chamber as a chemoattractant. [score:1]
Cells at 70%–80% confluence were transfected with miR-99a mimics, mTOR-siRNA or negative control (NC) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. [score:1]
These results indicate that miR-99a may serve as a potential predictor for prognosis of RCC patients. [score:1]
Then, miR-99a or NC mimics was repeatedly administered by intratumoral injections every 3 days for 4 weeks. [score:1]
On the basis of these findings, we propose a hypothetical mo del for the function of the miR-99a–mTOR axis in RCC. [score:1]
The mechanisms underlying miR-99a implicated in the carcinogenesis of RCC is very complicated, and further extensive analysis will be necessary to elucidate the precise mechanisms of miR-99a implicated in the carcinogenesis of RCC. [score:1]
As expected, compared with NC transfectants, mTOR-knockdowned 786–0 cells showed a decrease in the proliferation and colony formation and an increase in the G1-phase population (Figure 7A–C), similar to the phenotype observed upon miR-99a restoration in 786–0 cells. [score:1]
Additionally, we also examined the effect of miR-99a on apoptosis and found that miR-99a restoration could hardly influence apoptosis in RCC cell lines (data not shown). [score:1]
The gene encoding miR-99a was found residing within an intron of C21or f34, C21 or f34 located in chromosome 21q21, the region was commonly deleted in lung cancer [13, 32]. [score:1]
The expression and function of miR-99a, however, have not been investigated in human renal cell carcinoma (RCC) so far. [score:1]
Figure 6 MTOR pathway is involved in miR-99a mediated G1/S Transition. [score:1]
However, in this study, we demonstrate for the first time that miR-99a is implicated in the carcinogenesis of RCC. [score:1]
786–0 and OS-RC-2 cells were transfected with miR-99a or NC. [score:1]
These results demonstrate that mTOR pathway is involved in miR-99a mediated G1/S Transition. [score:1]
Recently, miR-99a was also shown to be co-transcripted with C21 or f34 in hepatocellular carcinoma [17]. [score:1]
These data suggest that miR-99a may be a predictor for prognosis of RCC patients. [score:1]
mTOR pathway is involved in miR-99a mediated G1/S transition. [score:1]
Because the in vitro data demonstrated that miR-99a harbored antitumorigenic properties in RCC, we conducted a proof-of-principle experiment, in which a 786–0 xenograft mo del was used to confirm the effect of miR-99a on tumorigenicity in vivo. [score:1]
However, Li et al. also reported that restoration of miR-99a could hardly influence the metastasis of hepatocellular carcinoma cell lines [17], inconsistent with our findings in RCC. [score:1]
[1 to 20 of 103 sentences]
5
[+] score: 329
As demonstrated in Figure 6C, the mRNA levels of IGF1R and mTOR were significantly decreased in miR-497 or miR-99a over-expressed cells, and the expressions were further down-regulated in the cells co -expressing both two miRNAs. [score:10]
Our study showed that miR-497 and miR-99a, the direct targets of IGF1R and mTOR, were significantly down-regulated in HCC tissues and cell lines, and they repressed certain aspects of tumorigenesis by targeting IGF1R and mTOR. [score:9]
By ectopical expression of miR mimics and/or inhibitors as well as corresponding non -targeting control miRNAs in HCC cell lines, the expression of miR-497 or miR-99a in tumor cells were efficiently manipulated (Supplementary Figure 2). [score:9]
As these two miRNAs were both down-regulated in HCC and inversely correlated with same targets, we speculated that miR-497 and miR-99a might be co-operative on the growth of HCC cells by co -targeting these two genes. [score:8]
Figure 5 (A) Up -expression of miR-99a and miR-497 could significantly inhibit HepG2 and Hep3B cells migration and invasion whereas these effects were reversed when co-transfection with miRNAs inhibitors (presented here was in HepG2 cells). [score:7]
Inhibited DNA repair proteins which were essential for the maintenance of genomic integrity would subsequently suppressing the expression of miR-99a [27]. [score:7]
Taken together, our results suggest that miR-497 and/or miR-99a can work as tumor suppressor in combination synergistically inhibit tumor growth via co -targeting IGF1R and mTOR. [score:7]
In this study, we demonstrated that ectopic expression of miR-99a in HepG2 and Hep3B cell lines and tumor mo dels could suppress cell proliferation, apoptosis, invasive, metastasis and tumor growth by targeting IGF1R and mTOR, which were consistent with the previous observation [21]. [score:7]
Up-regulation of miR-99a and miR-497 inhibited liver cancer cell proliferation, delayed cell cycle progression, and promoted apoptosis in liver cancer cell, which were reversed by up -regulating IGF1R and mTOR. [score:7]
Apparently the synergistic inhibition of miR-497 and miR-99a on tumor growth could be interpreted by their synergistical inhibition on expression of IGF1R and mTOR. [score:7]
Besides, miR-133a, miR-145 and miR-99a were reported to be involved in the initiation and progression of HCC by targeting the expression of IGF1R or mTOR, which shed light on the precise regulation of IGF1R/mTOR signaling in hepatocarcinogenesis [11– 13]. [score:6]
Such inhibition on the tumor growth was synergistically strengthened in miR-497 and miR-99a co -expressing group via synergistically suppressing IGF1R and mTOR, which is consistent with the observation in the in vitro assay. [score:6]
These and our results, together with the high possibility that more miR-497 or miR-99a common targets will be discovered soon, suggest that these two miRNAs share overlapping functions, regulate important signaling pathway-related mRNAs (including IGF1R and mTOR), and thus function as tumor suppressors. [score:6]
These data indicates that up-regulated IGF1R and mTOR were inversely correlated with the decreased expression of miR-497 and miR-99a in HCC. [score:6]
Up-regulation of miR-99a and miR-497 inhibited liver cancer cell migration and invasion. [score:6]
IGF1R and mTOR were highly expressed and inversely correlated with the expression of miR-497 and miR-99a. [score:5]
Figure 4 (A) Ectopic expression of miR-99a and miR-497 suppressed HegG2 and Hep3B cell lines proliferation at 48h and 72h. [score:5]
By targeting both IGF1R and mTOR, miR-497 or miR-99a exerted remarkable tumor suppressive function in vivo and in vitro. [score:5]
As shown in Figure 7A-7C, at 25 days, the tumor volume and weight were markedly decreased in miR-99a or miR-497 over-expressed tumors compared to the control as IGF1R and mTOR were down-regulated in the xenograft tumors (Figure 7D). [score:5]
Figure 6 (A) Co -expression of miR-99a and miR-497 exerted stronger suppression on HegG2 and Hep3B cell proliferation than that of miR-497 or miR-99a alone at 48h and/or 72h. [score:5]
Synergistic effects of miR-497 and miR-99a on inhibiting HCC cell proliferation by co -targeting IGF1R and mTOR. [score:5]
But this inhibitory effect of miR-497 and miR-99a on cell proliferation was entirely abolished by co-transfecting cells with miR inhibitors (Figure 4A-4D) and completely reversed by application of IGF1 (IGF1R ligand) or MHY1485 (mTOR agonist) (Figure 4F). [score:5]
MiR-497 and miR-99a inhibited HCC cell growth in vitro, which were reversed by up -regulating IGF1R and mTORConcerning the significant down-regulation of miR-497 and miR-99a in HCC tissues and cell lines (Figure 2), their functional role in HCC carcinogenesis was investigated. [score:5]
Therefore, miR-497 and miR-99a may play important suppressive effects on tumor growth controlled by IGF1R/mTOR signaling pathway and would be both biological and clinical targets for future HCC research. [score:5]
We found that exogenous expression of miR-497 or miR-99a in HCC cells resulted in markedly suppressed migration and invasion in HepG2 and Hep3B cells through membrane or matri-gel coated membrane (Figure 5A, 5B). [score:5]
Collectively, our results suggested that miR-497 or miR-99a inhibited HCC cell growth and invasion capacities and functioned as tumor suppressors. [score:5]
Figure 2 (A, B) Expression profiling of miRNAs showing that miR-99a and miR-497 were down-regulated in HCC tissues compared with non-cancerous liver tissues. [score:5]
Mutation of miR-497 or miR-99a binding site from the target mRNA 3′-UTR largely abolished the effects of miR-497 and miR-99a mimics. [score:4]
These alterations may help us to understand the down-regulation of miR-497 and miR-99a and thereby contribute to the hepatocellular malignant transformation. [score:4]
Real-time PCR and western blot assay further showed that miR-497 and miR-99a suppressed the expression of IGF1R and mTOR in a synergistic manner. [score:4]
miR-497 and/or miR-99a retarded HCC development in vivoTo further confirm the tumor suppressive function of miR-497 and miR-99a, HepG2 cells were engrafted into nude mice. [score:4]
Among these miRNAs only miR-99a and miR-497 were found to be significantly down-regulated in HCC according to two published microarray -based high throughput assessment (NCBI/GEO/GSE21362, NCBI/GEO/GSE36915, P value < 0.001, Supplementary Figure 1). [score:4]
There is already evidence that mTOR and its upstream activator, IGF1R, are the direct targets of miR-99a in lung cancer, esophageal squamous cell carcinoma, acute lymphoblastic leukaemia as well as HCC [21, 34– 36]. [score:4]
MiR-497 and miR-99a inhibited HCC cell growth in vitro, which were reversed by up -regulating IGF1R and mTOR. [score:4]
From our data, it was indicated that miR-497 and miR-99a were significantly down-regulated in patients with HCC and HCC cell lines. [score:4]
IGF1R and mTOR are direct targets of both miR-99a and miR-497. [score:4]
As illustrated in Figure 4A, up-regulation of miR-497 or miR-99a significantly decreased the growth rate of HepG2 and Hep3B cells. [score:4]
MiR-497 and miR-99a were down-regulated in HCC tissue samples and cell lines. [score:4]
miR-99a and MiR-497 were down-regulated in HCC tissues and cell lines. [score:4]
Both miR-99a and miR-497 were significantly down-regulated in HCC tissues compared to non-tumor tissues. [score:3]
In conclusion, the major finding of our study is that miR-497 and miR-99a synergistically target IGF1R and mTOR, thereby impeding the HCC tumor growth. [score:3]
In GSE21362 and GSE36915, miR-497 and miR-99a were found to be significantly down-regulated in HCC tissues, compared with non-cancerous liver tissue (n=146 and 89, respectively; P<0.001; Figure 2A, 2B). [score:3]
In the present study, we found that the expression of miR-497 and miR-99a were significantly decreased in human HCC tissues and cell lines. [score:3]
IGF1R and mTOR were the target genes of miR-497/miR-99a. [score:3]
MiR-497 and miR-99a suppressed HCC tumor invasiveness. [score:3]
To validate this hypothesis, we co -transfected miR-497 and miR-99a into HepG2 and Hep3B cell lines, and found that these two miRNAs act synergistically on retarding HCC cell proliferation via co -targeting IGF1R and mTOR. [score:3]
And correlation analyses were performed between IHC scores of IGF1R/mTOR and the mRNA levels of miR-99a/miR-497 expression in HCC tissues (n = 30). [score:3]
MiR-99a and miR-497 mimics/inhibitors and negative control molecules were purchased from (Ribo, guangzhou, China). [score:3]
The gene encoding miR-99a was found residing within an intron of C21orf34, which was reported harboring a putative tumor suppressor gene in HCC [21]. [score:3]
The expression level of miR-497 and miR-99a in the two HCC cell lines was significantly lower than that in the L-02 cells (Figure 2D). [score:3]
In Figure 1A, 3′-UTR of IGF1R and mTOR contained a conserved putative target site for both miR-497 and miR-99a, respectively. [score:3]
We also examined the expression of miR-497 and miR-99a in two HCC cell lines (HepG2 and Hep3B) and in one normal liver cell line L-02. [score:3]
Further studies on the suppression of miR-497 and miR-99a should be elucidated in the future. [score:3]
As showed in Figure 6A, HepG2 and Hep3B cells co -expressing miR-497 and miR-99a exhibited a more significant reduction in cell viability than the cells transfected with miR-497 or miR-99a alone (P<0.05; HepG2 cell at 48h and 72h, Hep3B cell at 72h), which is found to be statistically synergistic. [score:3]
P70S6K (miR-497) [25], and FGF family (including FGFR1 and FGFR3, targeted by miR-497 and miR-99a, respectively) [47, 32] are involved in the downstream genes of IFG1R/mTOR pathway. [score:3]
Synergistic effects of miR-497 and miR-99a on retarding HCC cell proliferation, which related with synergistic co -targeting on IGF1R and mTOR. [score:3]
Both miR-497 and miR-99a modulate other oncogenes that may mediate their tumor suppressor function. [score:3]
According to the NCBI, GEO database, we generalized the repressive status of miR-497 and miR-99a in HCC by recapitulating their expressions from the large cohorts of HCC patients (Figure 2A, 2B). [score:3]
Therefore, we thought the inhibitory effects of miR-497/miR-99a on HCC cell growth is through repressing IGF1R/mTOR signalling. [score:3]
The expression level of miR-99a and miR-497 were performed on an ABI 7900 system (Applied Biosystems). [score:3]
As both IGF1R and mTOR are targets of miR-497 and miR-99a, we examined whether these two miRNAs exert much stronger effects on HCC cell proliferation and apoptosis than individuals. [score:3]
These results indicated that expression of miR-497 and miR-99a were significantly decreased in HCC tumor tissues and HCC cell lines. [score:3]
The Pearson Correlation was used to determine the statistical significance of miR-497/miR-99a expression and immunohistochemistry(IHC) scores of IGF1R and mTOR. [score:3]
Further cotransfection of miR-497 and miR-99a exhibited much stronger inhibition on HCC cell proliferation and xenograft tumor growth. [score:3]
Aberrant expression of miR-497 and miR-99a were further validated by qRT-PCR in 30 paired HCC and peri-tumoral tissue samples (Figure 2C). [score:3]
Thus, miR-497 and miR-99a can synergistically functions as tumor suppressors in vivo. [score:3]
MiR-99a and miR-497 repressed the growth of HepG2-engrafted tumors and decreased the expression of IGF1R and mTOR in vivo. [score:3]
To further confirm the tumor suppressive function of miR-497 and miR-99a, HepG2 cells were engrafted into nude mice. [score:3]
To the best of our knowledge, this is the first study to demonstrate the co-operative effect of miR-497 and miR-99a on inhibiting HCC cell growth. [score:3]
The expression of IGF1R and mTOR in HCC cell lines and tissues were inversely correlated with the levels of miR-99a and miR-497. [score:3]
Obviously miR-497 and miR-99a appeared to be suppressed in HCC compared with non-cancerous surrounding tissues. [score:2]
miR-497 and/or miR-99a retarded HCC development in vivo. [score:2]
Concerning the significant down-regulation of miR-497 and miR-99a in HCC tissues and cell lines (Figure 2), their functional role in HCC carcinogenesis was investigated. [score:2]
As shown in Figure 1B, 1C, miR-497 and miR-99a mimics repressed the luciferase activity, respectively. [score:1]
In our study, miR-497 and miR-99a are located on chromosomes 17p13.1 and 21q, respectively. [score:1]
Since miR-497 and miR-99a have synergistic effects on HCC cell proliferation, further examination of whether these two miRNAs have synergistic effects on IGF1R and mTOR need to be carried out. [score:1]
Therefore our study focused on the functional role of miR-99a and miR-497 in HCC. [score:1]
Another microRNA, miR-99a, is involved in some important signaling pathways, such as AKT [31], FGFR [32], and modulate TGF-βpathway induced epithelial to mesenchymal transformation in breast [33]. [score:1]
Two-way ANOVA was used to assess the synergistic effect of miR-497 and miR-99a. [score:1]
The 3’-UTR of IGF1R and mTOR containing the putative binding sites of miR-99a or miR-497 and their corresponding mutated sequences were amplified and verified by DNA sequencing. [score:1]
And these anti-growth effects would be attenuated after co-transfection with antisense miR-99a and miR-497 (miR-99a-in and miR-497-in). [score:1]
To confirm the functional interaction between IGF1R/mTOR and miR-99a/miR-497, we performed luciferase experiment. [score:1]
Therefore, the combination of miR-497 and miR-99a could be superior to each individual miRNA alone in retarding HCC cell growth. [score:1]
Figure 1 (A) Putative binding sequences of IGF1R and mTOR with complementary sites for the seed regions of miR-99a and miR-497, as shown. [score:1]
In this study, we demonstrated that miR-497 and miR-99a from different miRNA clusters and having different seed sequences, act synergistically on tumor cell proliferation and growth. [score:1]
Next we explored the potential relationship between IGF1R/mTOR and miR-497/miR-99a, and found that IGF1R/mTOR and miR-497/miR-99a were significantly negatively correlated (Figure 3C). [score:1]
But the relationship between miR-497 and miR-99a is complex and their co-operative effect on HCC growth requires further research. [score:1]
[1 to 20 of 87 sentences]
6
[+] score: 216
Catto et al. also reported the expression of miR-99a was down-regulated in low-grade bladder cancer patients and also identified a target of miR-99a in bladder cancer progression [15]. [score:8]
Our data indicated that miR-99a might act as a tumor suppressor in bladder cancer and was significantly down-regulated in development of bladder cancer. [score:7]
miR-99a was significantly down-regulated in bladder cancer tissues, and even the lower expression of miR-99a was correlative with the more aggressive phenotypes of bladder cancer. [score:6]
Among the miRNAs which were aberrantly expressed in bladder cancer, miR-99a was reported to be down-regulated in bladder cancer patients by deep sequencing in nine bladder urothelial carcinoma patients [14]. [score:6]
The expression profile of miR-99a in the plasma was consistent with its down-regulation in bladder cancer tissues. [score:6]
The results improved that miR-99a acted as a tumor suppressor in bladder cancer and the down-regulation of miR-99a in bladder tissues would lead to the unlimited cell proliferation. [score:6]
miR-99a was proved to be down-regulated in bladder cancer patients by deep sequencing in nine bladder urothelial carcinoma patients [14], low-grade bladder cancer patients [15] and was also reported to act as a tumor suppressor in several other cancer types. [score:6]
The results suggested that miR-99a could be released from the bladder epithelium to blood and down-regulation of miR-99a in plasma might origin from decreased expression of miR-99a in cancer tissues. [score:6]
We found that miR-99a was significantly down-regulated in bladder cancer tissues and enforced expression of miR-99a repressed the proliferation of bladder cancer cells. [score:6]
Reintroduction of miR-99a into the bladder cancer cells which had lower expression of miR-99a could inhibit the unlimited cell proliferation. [score:5]
Meanwhile, enforced expression of miR-99a can inhibit the cell proliferation of bladder cancer cells. [score:5]
To explore the role of miR-99a in bladder carcinogenesis, we overexpressed miR-99a in the two bladder cancer cell lines HT1376 and J82 in which expression of miR-99a was lower than the other bladder cancer cell lines. [score:5]
These data demonstrated that the down-regulation of miR-99a might be relevant to the genesis and development of bladder cancer. [score:5]
The decreased expression of miR-99a in the plasma of bladder cancer patients suggested that miR-99a could be developed to a potential diagnostic marker which can be combined with other miRNAs’ expression to detect bladder cancer. [score:5]
Enforced expression of miR-99a suppresses bladder cancer cell growth. [score:5]
In summary, we determined the low expression of miR-99a in the cancer tissues and plasma of patients with bladder cancer and also indicated the tumor suppressor role of miR-99a in bladder cancer. [score:5]
Figure 3 Enforced expression of miR-99a inhibits cell proliferation of bladder cancer cells. [score:5]
The statistical analyses for miR-99a expression in clinical samples, correlation of miR-99a expression with patients’ clinicopathological variables were conducted using the Bonferroni multiple-comparison test. [score:5]
We found that the levels of miR-99a in the plasma of bladder cancer was decreased which was consistent with its low level in the cancer tissues although it was unknown how the down-regulation of miR-99a in a relatively small number of tumor cells can affect the plasma miR-99a levels. [score:4]
Down-regulation of miR-99a in oral squamous cell carcinomas also contributes to the growth and survival of oral cancer cells [18]. [score:4]
miR-99a is down-regulated in bladder cancer cells. [score:4]
We think there are two possible explanations for that: 1) The down-regulation of miR-99a in the cancer tissue was significant enough to be able to affect plasma miR-99a levels, meanwhile, the Taqman probe stem-loop real-time PCR was sensitive enough to detect the faint change of miR-99a levels in plasma. [score:4]
Figure 1 miR-99a is significantly down-regulated in bladder cancer cell lines and in bladder cancer tissues. [score:4]
2) The down-regulation of miR-99a in the plasma not only origin from the tumor cells but also from the immunocytes in the tumor microenvironment which needs to be improved further. [score:4]
miR-99a is also down-regulated in the plasma of patients with bladder cancer. [score:4]
Successful overexpression of miR-99a upon transfection in the two bladder cancer cell lines was confirmed by q-PCR. [score:3]
As shown in Figure  3A and 3D, miR-99a was overexpressed about 20 folds and 18 folds than the scramble control or untreated cells in HT1376 and J82 cells respectively. [score:3]
The results also showed that the average expression of miR-99a in bladder cancer samples was significantly lower than that in the adjacent non-neoplastic tissues (p < 0.001) (Figure  1D). [score:3]
The correlation of lower levels of miR-99a with the more aggressive phenotype of bladder cancer strongly indicated that miR-99a played important roles in bladder carcinogenesis as a tumor suppressor. [score:3]
The decreased expression of miR-99a in the plasma and cancer tissues of bladder cancer patients supported that miR-99a can be developed as a new diagnostic marker for bladder cancer detection. [score:3]
For example, miR-99a could promote apoptosis by targeting mTOR in human esophageal squamous cell carcinoma [16]. [score:3]
The expression level of miR-99a in HU609 and HCV29 was significantly higher than that in the three bladder cancer cell lines (T24, HT1376, and J82) and was non-significantly but observably higher than the levels in the other two bladder cancer cell lines (TCCSUP and RT4) (Figure  1A). [score:3]
Different to these reports, we investigated miR-99a expression in tumor tissues and the adjacent non-neoplastic tissues which were derived from a common patient instead of different individuals to exclude the differences of miR-99a expression in different individuals. [score:3]
To explore the diagnostic potential of miR-99a in bladder cancer, we detected the expression of miR-99a in the plasma of 50 patients with bladder cancer and 50 healthy individuals. [score:3]
The suppression of miR-99a on cell proliferation of HT1376 cells was a little stronger than that on J82 cells. [score:3]
In addition, miR-99a induces G1-phase cell cycle arrest and suppresses tumorigenicity in renal cell carcinoma [17]. [score:3]
Figure 4 Expression of miR-99a in the plasma of patients with bladder cancer. [score:3]
Low-level expression of miR-99a is associated with aggressive phenotypes of bladder cancer. [score:3]
The data also demonstrated that the expression level of miR-99a had no correlation with age, gender and histological type. [score:3]
However, the expression pattern of miR-99a in large numbers of bladder cancer patients and its roles in bladder cancer are unknown. [score:3]
The roles of miR-99a in regulating bladder cancer cell migration, invasion and apoptosis and the detailed mechanism will be our further directions. [score:3]
We firstly examined the expression of mature miR-99a in five human bladder cancer cell lines (J82, HT1376, RT4, T24 and TCCSUP) and immortalized human bladder epithelium (HCV29 and HU609) cells. [score:3]
The results showed that miR-99a could increase the fraction of cells in G1 phases in HT1376 and J82 cells which suggested that miR-99a might inhibit bladder cancer cell growth through arresting the G1/S transition (Figure  3C, 3F). [score:3]
The low-level expression of miR-99a in the plasma of bladder cancer patients was also significantly associated with a more aggressive tumor phenotype (p < 0.05, grade 1, 2 vs. [score:3]
Collectively, the data indicated that miR-99a functioned as a tumor suppressor in bladder cancer. [score:3]
miR-99a is down-regulated in bladder cancer tissues compared with the corresponding adjacent non- neoplastic tissues. [score:3]
In addition, we detected miR-99a expression in more clinical samples and also in the plasma of bladder cancer patients. [score:3]
The clinicopathological features of bladder cancer patients were summarized in Table  2. Correlation analysis showed that low-level expression of miR-99a in bladder cancer was significantly associated with a more extensive muscle invasion (p < 0.05, stage Ta, 1 vs. [score:3]
There were 20/100 (20%) of cases which had increased levels of miR-99a in bladder cancer tissues compared with the adjacent non-neoplastic tissues, 27/100 (27%) of cases in whom the expression of miR-99a was unchanged in bladder cancer tissues when the cutoff was set up as 1.5. [score:2]
Collectively, the data indicated that miR-99a was significantly attenuated in tumor tissues compared with adjacent normal tissues and might act as a tumor suppressor in bladder cancer. [score:2]
As demonstrated by CCK-8 growth assays at 0, 12, 24, 48, 72, 96 hours after mimic transfection, overexpression of miR-99a reduced cell proliferation in both the two cell lines, whereas the scramble control had no effect on cell proliferation compared with the untreated cells (Figure  3B, E). [score:1]
miR-99a mimics and scramble control mimics were obtained from Dharmacon (Austin, TX, USA) and transfected with DharmFECT1 (Dharmacon, Austin, TX, USA) in HT1376 and J82 cells at a final concentration of 50 nM. [score:1]
To further investigate the correlation between the expression of miR-99a and the clinicopathological characteristics, the relative expression of miR-99a in 100 pairs of bladder cancer tissues and adjacent normal tissues was statistically analyzed. [score:1]
Furthermore, investigation of the expression of miR-99a in plasma of bladder cancer patients showed that miR-99a was also decreased in plasma of bladder cancer patients. [score:1]
Furthermore, investigation of the expression of miR-99a in the plasma of bladder cancer patients showed that miR-99a was also decreased in plasma of bladder cancer patients which strongly supported miR-99a as the potential diagnostic marker of bladder cancer. [score:1]
Our data provided the potential diagnostic and therapeutic roles of miR-99a in bladder cancer. [score:1]
To further analyze the expression of miR-99a in patients with bladder cancer, we measured the levels of miR-99a in 100 pairs of bladder cancer tissues (C) and the adjacent non-neoplastic tissues (N). [score:1]
The results strongly supported miR-99a as the potential diagnostic marker of bladder cancer. [score:1]
In this study, we used Taqman probe stem-loop real-time PCR to accurately measure the levels of miR-99a in 100 pairs of bladder cancer tissues and the adjacent non-neoplastic tissues to exclude the differences of miR-99a expression in different individuals. [score:1]
To analyze the expression of miR-99a in bladder cancer, q-PCR using Taqman probes was conducted to measure the levels of miR-99a. [score:1]
We also checked the cell cycle distribution in HT1376 and J82 cells transfected with miR-99a mimics. [score:1]
Moreover, the lower level of miR-99a was correlative with more aggressive phenotype of bladder cancer. [score:1]
The data demonstrated that the average level of miR-99a in the bladder cancer patients was significantly lower than that in the healthy individuals (Figure  4A). [score:1]
[1 to 20 of 63 sentences]
7
[+] score: 209
Our study demonstrated that insulin significantly inhibited miR-99a expression and induced mTOR expression, while forced expression of miR-99a was sufficient to inhibit insulin -induced mTOR expression. [score:13]
Consistent with a recent study showing that miR-99a directly targets and regulates mTOR in childhood adrenocortical tumors [41], we found that forced expression of miR-99a suppressed luciferase activity of the wild type, but not the mutant mTOR reporter (Fig. 2A) and mTOR expression at protein level (Fig. 2B). [score:11]
Insulin inhibits the expression of miR-99a, then induces miR-99a direct target mTOR which in turn increases PKM2 and HIF-1α expression for regulating glucose consumption. [score:11]
0064924.g005 Figure 5 Insulin inhibits the expression of miR-99a, then induces miR-99a direct target mTOR which in turn increases PKM2 and HIF-1α expression for regulating glucose consumption. [score:11]
In order to study whether mTOR is required for PKM2 in regulating insulin-inducing glucose consumption, we found that inhibition of mTOR by miR-99a overexpression significantly suppressed the downstream molecules HIF-1α and PKM2 expression under the insulin treatment (Figs. 3A and 3B). [score:10]
In summary, our study demonstrates that insulin regulates cell glycolysis via inhibition of miR-99a expression in liver cells, and miR-99a/mTOR/HIF-1 is important in insulin-regulated PKM2 expression and glucose consumption (Fig. 5). [score:9]
These results suggest that insulin may down-regulate miR-99a, up-regulate mTOR, HIF-1α, PKM2 expression and promoteglycolytic activities. [score:9]
Insulin Inhibited miR-99a Expression, but Induced Glucose Consumption and Lactate Production, and Increased the Expression Levels of mTOR, Phosphorylated mTOR (p-mTOR), HIF-1α and PKM2 in HepG2 and HL7702 Cells. [score:7]
As we expected, miR-99a overexpression inhibited insulin -induced total mTOR and p-mTOR expression levels (Figs. 2C and S1). [score:7]
Overexpression of miR-99a or rapamycin treatment inhibited insulin -induced PKM2 and HIF-1α expression, and glucose consumption and lactate production. [score:7]
In agreement with the mTOR suppression, miR-99a overexpression also inhibited insulin -induced glucose consumption (Fig. 2D) and lactate production by 30–40% and 30–35%, respectively in HepG2 and HL7702 cells (Fig. 2E). [score:7]
Overexpression of miR-99a or Rapamycin Treatment Inhibited Insulin -induced PKM2 and HIF-1α Expression, and Glucose Consumption and Lactate Production. [score:7]
Figure S1 Insulin induced phosphorylated mTOR (p-mTOR) expression levels, while overexpression of miR-99a and rapamycin treatment inhibited insulin -induced p-mTOR levels. [score:7]
Insulin inhibited miR-99a expression, but induced glucose consumption and lactate production, and increased the expression of mTOR, HIF-1α and PKM2 in HepG2 and HL7702 cells. [score:7]
In order to test whether certain miRNA(s) could affect insulin -mediated glucose metabolism, we tested the potential miRNAs that target mTOR and interestingly found that miR-99a was downregulated by 2-fold in both HepG2 and HL7702 cells after insulin treatment (Fig. 1A). [score:6]
These results indicate that miR-99a is an important regulator in insulin-regulated glycolytic activities through directly targeting mTOR. [score:6]
In this study, we showed that HIF-1α is repressed by miR-99a overexpression through inhibiting mTOR and it is involved in glucose consumption in response to insulin treatment. [score:5]
In esophageal squamous cell carcinoma, miR-99a was significantly decreased, and forced expression of miR-99a inhibited cell proliferation by inducing apoptosis [51]. [score:5]
We tested the effect of insulin on the known and unknown miRNAs that target mTOR and found out that miR-99a were regulated by insulin. [score:4]
To determine whether mTOR is a direct target of miR-99a, the 3′-UTR region of mTOR was cloned into pMIR-REPORT miRNA reporter vector. [score:4]
In this study, we also showed that insulin induced PKM2 expression and glucose consumption and lactate production, which was regulated by miR-99a/mTOR. [score:4]
These results demonstrate that insulin induces glucose consumption and lactate production through mTOR/PKM2 pathway, which can be blocked by miR-99a or mTOR inhibitor. [score:3]
Insulin induced mTOR expression, glucose consumption and lactate production via miR-99a. [score:3]
In this study, we plan to determine 1) whether insulin regulates mTOR through miR-99a; 2) whether insulin regulates glycolytic activities via miR-99a/mTOR; 3) what is the downstream effectors of mTOR for mediating insulin -induced glycolytic activities. [score:3]
Insulin Induced mTOR Expression Levels, Glucose Consumption and Lactate Production via miR-99a. [score:3]
In the present study, we found that miR-99a/mTOR/PKM2 pathway is involved in insulin -induced glucose metabolism, and mTOR and HIF-1α are necessary for insulin -induced PKM2 expression and glucose consumption. [score:3]
We found a negative correlation between miR-99a and mTOR expression levels under the insulin treatment. [score:3]
0064924.g001 Figure 1 HepG2 and HL7702 cells were starved in serum-free medium for 18 h, and then treated with insulin (200 nM) for 6 h. (A) Cells were collected and subjected to miR-99a and U6 expression by qRT-PCR. [score:3]
HepG2 and HL7702 cells were starved in serum-free medium for 18 h, and then treated with insulin (200 nM) for 6 h. (A) Cells were collected and subjected to miR-99a and U6 expression by qRT-PCR. [score:3]
Relative miR-99a expression levels were normalized to U6. [score:3]
The relative expressions of miR-99a were normalized to the levels of U6 and analyzed via the comparative cycle threshold method (2 [−ΔΔCT]). [score:3]
These results are consistent with our observation that mTOR was inhibited by miR-99a in hepatocellular carcinoma cells (HCC). [score:3]
This result suggests that PKM2 is a downstream molecule of miR-99a via targeting mTOR, and is involved in insulin -induced glucose metabolism. [score:3]
0064924.g003 Figure 3(A)HepG2 and HL7702 cells were transfected with miR-99a and miR-SCR, and treated as in Fig. 2. The expression levels of HIF-1α, PKM2 and β-actin were analyzed by immunoblotting. [score:3]
To further study whether insulin stimulates glucose consumption via regulating miR-99a and mTOR, HepG2 and HL7702 cells were transfected with pre-miR-99a and negative control of miRNA precursor (miR-SCR). [score:2]
Up to now, it is unclear about the role of miR-99a in insulin-regulated glycolysis. [score:2]
We hypothesize that insulin regulates glucose consumption through mTOR/PKM2 pathway via miR-99a. [score:2]
For the mTOR mutagenesis, the sequences complementary to the binding site of miR-99a in the 3′-UTR (UACGGGU) was replaced by AUGCCCA, respectively [35]. [score:1]
The results, for the first time, reveal the important role of miR-99a in glycolysis under insulin treatment. [score:1]
0064924.g002 Figure 2(A) The luciferase reporters containing the wild type and mutant 3′-UTR of mTOR at predicted miR-99a binding site were constructed and verified by sequencing. [score:1]
Hsa-miR-99a or hsa-miR-SCR mimics were transfected into HepG2 and HL7702 cells using lipofectamine reagent. [score:1]
After cultured for 24 hours, cells were co -transfected with wild-type or mutant mTOR 3′-UTR reporter plasmid and pRL-TK plasmid (as control), or transfected with pre-miR-99a and miR-scrambled control precursors (miR-SCR). [score:1]
In addition, miR-99a enhanced the efficacy of photofrin based photodynamic in human glioblastoma [50]. [score:1]
The final concentrations of hsa-miR-99a or hsa-miR-SCR mimics for the transfection were 40 nM. [score:1]
[1 to 20 of 44 sentences]
8
[+] score: 152
Here, combination of photofrin based PDT and miR-99a overexpression very effectively down regulated expression of FGFR3, which might directly or indirectly inhibit expression of PI3K and Akt, with an increase in expression of p53. [score:14]
Recent studies showed that miR-99 family was upregulated following DNA damage and miR-99 expression correlated well with radiation sensitivity due to down regulation of SNF2H, a miR-99 family target [35]. [score:9]
Our results also showed that photofrin based PDT followed by miR-99a overexpression could directly or indirectly inhibit fibroblast growth factor receptor 3 (FGFR3) and PI3K/Akt signaling mechanisms to trigger the p53 -mediated caspase -dependent pathway of apoptosis in the p53 wild-type glioblastoma cells both in vitro and in vivo. [score:7]
Upregulation of miR-99a occurred to some extent in both cell lines following photofrin based PDT when compared with the untreated control cells, but upregulation of miR-99a reached a maximum level in the cells that were subjected to combination of photofrin based PDT and miR-99a transfection. [score:6]
To determine the possible signaling mechanisms for anti-proliferative and pro-apoptotic activity of photofrin based PDT and miR-99a overexpression, we performed Western blotting and detected alterations in the expression of the regulatory factors for cell growth and apoptosis in both cell lines (Fig. 6c). [score:6]
Photofrin based PDT and miR-99a overexpression very efficiently suppressed the levels of FGFR3, PI3K, and Akt to promote p53 -mediated mitochondrial caspase -dependent apoptosis. [score:5]
These results clearly suggested that miR-99a could act as a tumor suppressor and an increase in level of expression of miR-99a could further increase amounts of apoptosis in glioblastoma cell lines. [score:5]
Anti-miR-99a transfection inhibited the photofrin based PDT enhancement of miR-99a expression in both glioblastoma cell lines. [score:5]
We have performed real-time qRT-PCR to examine the levels of expression of the tumor suppressor miR-99a in photofrin treated glioblastoma U87MG and U118MG cells after irradiation, without or with miR-99a transfection (Fig. 7). [score:5]
After 4 h incubation, cells were transfected with 50 nM anti-miR-99a mimic or miR-99a mimic and incubated for another 24 h. Total RNA was extracted and cDNA was synthesized using gene specific primers, and real-time qRT-PCR analysis was performed for relative expression of miR-99a after normalizing with expression of U6 RNA (control) in glioblastoma U87MG and U118MG cells. [score:4]
A recent study showed that the upregulation of the miR-99 family following radiation decreased the efficiency of repair factor recruitment and the rate of DNA repair after a second exposure to radiation [35]. [score:4]
The induction of miR-99a expression represents a switch by which cells subjected to multiple rounds of radiation are directed away from continuing to repair their DNA. [score:4]
Efficacy of Photofrin Based PDT and miR-99a Overexpression for Tumor Regression. [score:3]
Photofrin based PDT followed by transfection of miR-99a mimic could significantly increase induction of apoptosis due to dramatic miR-99a overexpression. [score:3]
Real-time qRT-PCR analyses of miR-99a expression in U87MG and U118MG cells after photofrin based PDT and miR transfection. [score:3]
Photofrin Based PDT followed by Ectopic Overexpression of miR-99a Increased Apoptotic Death. [score:3]
We observed increases in expression of miR-99a in glioblastoma cells after photofrin based PDT. [score:3]
In essence, our current findings clearly demonstrated that the combination of photofrin based PDT and miR-99a overexpression could serve as a new therapeutic strategy for an effective treatment of human glioblastomas harvoring p53 wild-type. [score:3]
Further, our in vivo studies showed that combination of photofrin based PDT and miR-99a overexpression very effectively reduced the growth of both U87MG and U118MG xenografts in athymic nude mice (Fig. 8a, 8b, 8c). [score:3]
Determination of Levels of Expression of miR-99a by Real-time qRT-PCR. [score:3]
Down regulation of miR-99a has been reported in several human cancers [34], suggesting the important role of low level of miR-99a in cancer development. [score:3]
We studied the effects of miR-99a overexpression that enhanced the efficacy of photofrin based PDT for induction of apoptosis in glioblastoma cell lines. [score:3]
The expression of miR-99a relative to U6 RNA (control) was determined using the 2 [−ΔCT] method [41]. [score:3]
The results of this study revealed the molecular basis for the effectiveness of combination of photofrin based PDT and miR-99a transfection for inhibiting growth of the p53 wild-type glioblastoma cells in vitro and in vivo. [score:3]
Following treatments, H&E staining of tumor sections showed that control tumors maintained characteristic growth, photofrin based PDT or miR-99a overexpression alone induced cell death to some extent, but combination of photofrin based PDT and miR-99a overexpression dramatically increased cell death in both U87MG and U118MG xenograft mo dels (Fig. 8d). [score:3]
The efficacy of combination of photofrin based PDT and miR-99a overexpression in increasing apoptosis in human glioblastoma U87MG and U118MG cell lines was analyzed by flow cytometry and Western blotting (Fig. 6). [score:3]
Photofrin based PDT could increase miR-99a expression to some extent in the p53 wild-type glioblastoma cells. [score:3]
The expression of miR-99a precursor was determined using real-time qRT-PCR method [40] with some modifications. [score:3]
So, our results from xenograft mo dels further confirmed that combination of photofrin based PDT and miR-99a transfection inhibited FGFR3 and PI3K/Akt signaling pathways to promote p53 -mediated mitochondrial caspase -dependent apoptosis in human glioblastomas in vivo. [score:3]
Augmentation of efficacy of photofrin based PDT by miR-99a overexpression for induction of apoptosis in U87MG and U118MG cells. [score:3]
Quantification of miR-99a Expression after Photofrin Based PDT or/and miR-99a Transfection. [score:3]
However, the role of miR-99a in glioblastoma development still remains unknown. [score:2]
As observed from flow cytometric analyses, photofrin based PDT alone could induce some apoptosis, which appeared to be significantly increased with combination of photofrin based PDT and miR-99a transfection (Fig. 6a, 6b). [score:1]
Histopathological Changes after Photofrin Based PDT and miR-99a Treatments. [score:1]
Transfection of U87MG and U118MG Cells with miR-99a Mimic. [score:1]
We also kept appropriate control (no photofrin and irradiation) cells and anti-miR-99a mimic and miR-99a mimic transfected cells for relative efficacy studies. [score:1]
After photofrin based PDT or/and miR-99a administration as described above, protein samples were isolated from the gliobalstoma U87MG and U118MG cells and xenografts. [score:1]
Significant difference between untreated control (CTL) and photofrin based PDT or miR-99a transfection was indicated by * P<0.05 or ** P<0.01. [score:1]
After photofrin based PDT and miR-99a transfection, the anti-cancer effects were analyzed at the cellular and molecular (DNA, RNA, and protein) levels. [score:1]
Following 4 h incubation, cells were transfected with 50 nM pre-miR-99a mimic and incubated for another 24 h. (a) Cells were collected for estimation of apoptosis by Annexin V-FITC/PI double staining and flow cytometry. [score:1]
Here, we investigated whether miR-99a overexpression could significantly enhance the therapeutic efficacy of photofrin based PDT. [score:1]
An equal volume of either anti-miR-99a or miR-99a and atelocollagen [44] (0.1% in PBS, pH 7.4) were mixed for 1 h at 4°C. [score:1]
This photochemical reaction may help the miR-99a transfection process. [score:1]
We also investigated the important molecular mechanisms for the anti-cancer effects of the combination of photofrin based PDT and miR-99a overexpression in human glioblastoma cells in culture and xenograft mo dels. [score:1]
Finally, anti-miR-99a or miR-99a (50 µg) with 0.05% atelocollagen in 200 µl was injected (via tail vein) into each mouse on 14 [th], 17 [th], and 20 [th] days. [score:1]
After each desired treatment, irradiation, and miR-99a transfection, total RNA was extracted from 3×10 [6] cells using TRIZOL according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). [score:1]
We observed induction of more apoptosis when miR-99a transfection was carried out using Lipofectamine after irradiation. [score:1]
The most important outcome of this investigation is the establishment of molecular basis of the efficacy of the combination of photofrin based PDT and miR-99a overexpression in controlling the growth of human glioblastoma cells (p53 wild-type) invitro and in vivo. [score:1]
After 4 h, cells were irradiated (1 J/cm [2]) and incubated for another 4 h. Then, the cells were transfected with miR-99a oligomeric RNA at 50 nM final concentration using 20 µl Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) and Opti-MEM medium following manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). [score:1]
The tumor-bearing mice were categorized into five separate experimental groups (control, anti-miR-99a, miR-99a, photofrin, and photofrin+miR-99a). [score:1]
Then, the mixture of miR-99a mimic (50 µg) and 0.05% atelocollagen in 200 µl was injected (via tail vein) into each mouse on 14 [th], 17 [th], and 20 [th] days. [score:1]
[1 to 20 of 51 sentences]
9
[+] score: 143
Figure 5 ANRIL is required to target PRC2 occupancy and activity to epigenetically regulate the expression of miR-99a/miR-449a in Trans(A) qRT-PCR was performed to detect miRNAs expression after ANRIL knockdown. [score:9]
Then our results showed that ANRIL knockdown could significantly upregulate the expression of miR-99a/miR-449a both in SGC-7901 and BGC-823 cell lines in PRC2 -dependent manner (Figure 5A and 5C). [score:7]
As shown in Figure 5A, knockdown of ANRIL could significantly upregulate the expression of miR-99a/miR-449a both in SGC-7901 and BGC-823 cell lines. [score:7]
Figure 6 ANRIL could control target genes of miR-99a/miR-449a, thus regulating gastric cancer cell proliferation(A) The level of miR-99a and miR-449a was downregulated in 30 pairs GC tissues. [score:7]
ANRIL is required to target PRC2 occupancy and activity to epigenetically regulate the expression of miR-99a/miR-449a in TransTo further study the mechanism of its regulation of gastric cancer cell proliferation, firstly, according to previous studies [19, 22], we validated that ANRIL whether can bind PRC2 in gastric cancer cells. [score:7]
In addition, miR-99a and miR-449a were both down-regulated in GC and further analysis revealed that expression of ANRIL is inversely correlated with miR-99a/miR-449a level in GC tissues (Figure 6A and 6B). [score:6]
ANRIL is required to target PRC2 occupancy and activity to epigenetically regulate the expression of miR-99a/miR-449a in Trans. [score:6]
ANRIL is required to target PRC2 occupancy and activity to epigenetically regulate the expression of miR-99a/miR-449a in Trans. [score:6]
Importantly, knockdown of ANRIL and EZH2 could control the well described target genes of miR-99a and miR-449a, mTOR [27- 29] and CDK6 [30- 32], also including the important target gene of CDK6 kinases, E2F1, a pivotal role in controlling cell cycle progression(Figure 6C and 6D)[35]. [score:6]
Further analysis revealed that ANRIL expression was inversely correlated with miR-99a/miR-449a expression in 30 pairs of gastric cancer tissues (Figure 6B). [score:5]
To validate whether miR-99a/miR-449a could also inhibit gastric cancer cell proliferation, we enforced their expression in SGC-7901 cells with respective miRNAs mimics. [score:5]
Together, in addition through the regulation of p15 [INK4B] and p16 [INK4A] in Cis, ANRIL could also regulate the expression of miR-99a/miR-449a in Trans, thus controlling mTOR and CDK6/E2F1 pathway, which may in part account for ANRIL -mediated cell growth promotion. [score:5]
Co-transfection (miR-99a/miR-449a inhibitors and si- ANRIL) could partially abrogate miR-99a/miR-449a inhibitors caused mTOR/CDK6/E2F1 stimulation (Figure 6F). [score:5]
In an attempt to understand the biological role of miR-99a/miR-449a in GC, we enforce miR-99a/miR-449a expression by using mimics and found apparent cell proliferation inhibition through inducing obvious G1–G0 phases arrest and apoptosis (Figure 6E). [score:5]
Furthermore, western blot analysis showed that the expression of mTOR and CDK6 in SGC-7901 cells transfected with miR-99a/miR-449a mimics were indeed downregulated compared with cells transfected with negative control (Figure S2B). [score:5]
ANRIL could control target genes of miR-99a/miR-449a, thus regulating gastric cancer cell proliferation. [score:4]
These data indicate that ANRIL could epigenetically modulate the expression of miR-99a/miR-449a by binding to PRC2, thus regulating mTOR and CDK6 pathway, thereby controlling gastric cancer cell proliferation. [score:4]
ANRIL could indeed control target genes of miR-99a/miR-449a, thus regulating gastric cancer cell proliferationTo investigate the roles of miR-99a/miR-449a in gastric cancer, we performed qRT-PCR analysis and found that miR-99a/miR-449a expression was significantly decreased in 30 pairs of gastric cancer tissues (Figure 6A). [score:4]
MiR-99a and miR-449a are both downregulated in a variety of tumors and indicate a poor prognosis [46, 47]. [score:4]
ANRIL could indeed control target genes of miR-99a/miR-449a, thus regulating gastric cancer cell proliferation. [score:4]
Besides, ANRIL could also silence the expression of miR-99a, thus releasing mTOR, promoting gastric cancer cell proliferation (Figure S3). [score:3]
In addition, we demonstrated that ANRIL could epigenetically silence miR-99a/miR-449a by binding to PRC2, thus regulating mTOR and CDK6/E2F1 pathway, which could in part account for ANRIL -mediated cell growth regulation. [score:3]
Next, we determined the PRC2 complex was bound to the promoter region of miR-99a/miR-449a, and whether ANRIL was required for targeting PRC2 occupancy and activity of promoters of miR-99a/miR-449a. [score:3]
qRT-PCR was performed to detect the average expression of ANRIL/miR-99a/miR-449a in xenograft tumors (n=7). [score:3]
As shown in Figure S2A, SGC-7901 cells were effectively transfected with miR-99a/miR-449a mimics/ inhibitors. [score:3]
These results suggested that ANRIL could epigenetically modulate the expression of miR-99a/miR-449a by binding to PRC2. [score:3]
Then we examined the well-described target genes of miR-99a/miR-449a, mTOR [27- 29] and CDK6 [30- 32]. [score:3]
In addition, flow cytometric analysis indicated that the overexpression of miR-99a/miR-449a in SGC-7901 cells could induce obvious G1–G0 phases arrest compared with cells transfected with miR-NC and could also induce apoptosis (Figure 6E). [score:2]
To further confirm the regulation between ANRIL and miR-99a/miR-449a, we performed rescue experiments. [score:2]
In addition, knockdown ANRIL could also lead to the loss of SUZ12 binding of miR-99a/miR-449a promoters (Figure S1D). [score:2]
Knockdown ANRIL resulted in the loss of EZH2 binding and H3K27 trimethylation occupancy of miR-99a/miR-449a locus. [score:2]
Importantly, the average level of miR-99a/miR-449a was higher in sh ANRIL group (Figure 8C). [score:1]
Next, MTT and trypan blue assay revealed that the cells transfected with miR-99a or miR-449a had a significant growth inhibition when compared with cells transfected with miR-NC (Figure 6E). [score:1]
To investigate the roles of miR-99a/miR-449a in gastric cancer, we performed qRT-PCR analysis and found that miR-99a/miR-449a expression was significantly decreased in 30 pairs of gastric cancer tissues (Figure 6A). [score:1]
[1 to 20 of 34 sentences]
10
[+] score: 119
miR-99a suppresses tumorigenicity by inducing G [1]-phase cell cycle arrest in vitroThe downregulation of miR-99a in NSCLC adenocarcinoma cell lines prompted the identification of its activity as a tumor suppressor. [score:8]
To further reveal the mechanisms underlying this tumor suppressor effect of miR-99a, IGF-1R, a target mRNA of miR-99a, was knocked-down in NSCLC cells. [score:6]
These results revealed that the expression of miR-99a was downregulated in NSCLC adenocarcinoma tissues and cell lines, indicating an involvement in NSCLC carcinogenesis. [score:6]
The downregulation of miR-99a in NSCLC adenocarcinoma cell lines prompted the identification of its activity as a tumor suppressor. [score:6]
Thus, the upregulation of miR-99a was able to induce growth inhibition by blocking the cell cycle at the G [1] phase. [score:6]
miR-99a induces G [1]-phase cell cycle arrest and suppresses tumorigenicity, functioning as a tumor suppressor in RCC. [score:5]
A corresponding decrease in the levels of E-cadherin and γ-catenin, and an increase of N-cadherin was also observed, which was similar to the effects of miR-99a overexpression, indicating that overexpression of miR-99a alters the epithelial phenotype of the cell in an IGF-1R -dependent manner. [score:5]
The data revealed that miR-99a is significantly downregulated in NSCLC adenocarcinoma cells and it can be hypothesized that miR-99a may play a key role in NSCLC development and progression by modulating IGF-1R signaling. [score:5]
First, it was demonstrated that the overexpression of miR-99a in A549 and H1299 cells, two adenocarcinoma cell lines, led to a significant inhibition of cell proliferation, colony formation, migration and invasion. [score:5]
Collectively, it was concluded that the tumor suppressor role of miR-99a is associated with IGF-1R pathway regulation. [score:4]
The present study hypothesized that miR-99a -mediated downregulation of IGF-1R induced an EMT-like phenotype. [score:4]
The identification of the downregulation of miR-99a in NSCLC adenocarcinoma highlights the possibility of therapeutic applications for miR-99a in cancer. [score:4]
miR-99a is significantly downregulated in human NSCLC tissues. [score:4]
miR-99a has been reported to be downregulated in squamous cell lung carcinoma (19). [score:4]
IGF-1R mRNA is an identified miR-99a target that is known to be involved in the pathogenesis of psoriasis (29, 30). [score:3]
This indicates that low expression of miR-99a may be involved in NSCLC carcinogenesis. [score:3]
Of the 15 tested lung cancer tissues, the expression level of miR-99a demonstrated no difference between ages, genders or metastasis status. [score:3]
The expression of miR-99a was low in 13 out of 15 NSCLC tissues, although no correlation was observed between the reduction in miR-99a expression and the clinical characteristics of NSCLC in the 15 pairs of tissues. [score:3]
miR-99a suppresses tumorigenicity by inducing G [1]-phase cell cycle arrest in vitro. [score:3]
To further assess the biological role of miR-99a in adenocarcinoma cell lines, its expression level was detected in A549 and H1299 cells. [score:3]
In the present study, it was found that miR-99a was significantly downregulated in NSCLC adenocarcinoma tissues and cell lines, which was consistent with previous findings that miR-99a is reduced in several human tumors and cancer cell lines compared with normal adjacent lung tissues and normal cell lines (19). [score:3]
In the present study, the expression of miR-99a in adenocarcinoma tissues was examined, and the impact of miR-99a on A549 and H1299 NSCLC cells was assessed. [score:3]
MiR-99a suppresses the migration and invasion of NSCLC cell lines in vitro. [score:2]
As shown in Fig. 1A, the miR-99a expression levels were all significantly reduced by 2.1–25 times in 86.7% (13/15) of NSCLC tumor tissues compared with the corresponding adjacent normal lung tissues. [score:2]
MiR-99a inhibited EMT by decreasing the IGF-1R level. [score:2]
Proliferation and colony formation results revealed that knockdown of IGF-1R decreases proliferation (Fig. 4B) and colony formation (Fig. 4C), similar to the phenotype observed upon miR-99a restoration in the A549 and H1299 cells. [score:2]
miR-99a, which is transcribed from the 21q21 region, has been reported to be deregulated in renal cell carcinoma (RCC) (18). [score:2]
In addition, it was demonstrated that miR-99a expression is elevated in NSCLC cell lines compared with the HBE normal human bronchial epithelial cell line, with the exception of A549 and H1299, and these findings also indicate the role of miR-99a in NSCLC adenocarcinoma carcinogenesis. [score:2]
In the present study, a stem-loop RT-quantitative PCR assay was performed to determine the expression of miR-99a in 15 pairs of matched NSCLC and normal adjacent lung tissues. [score:2]
In total, ~5×10 [3] cells from each group, mock A549 (A549-miR-99a), stably transfected A549 (A549-miR-NC), mock H1299 (H1299-miR-99a) and stably transfected H1299 (H1299-miR-NC) cells, were placed in a six-well plate containing RPMI-1640 medium supplemented with 10% FBS for three weeks. [score:1]
It has also been reported that, in NSCLC, the miR-99a gene locates to a homozygous deletion region, indicating that miR-99a may play a crucial role in tumorigenesis and cancer progression (5). [score:1]
Additionally, the effect of miR-99a on apoptosis was also detected and it was found that exogenous miR-99a did not influence apoptosis (data not shown). [score:1]
In conclusion, the present study identified miR-99a as an effector of the IGF-1R pathway during EMT in NSCLC cells. [score:1]
Stable transfection of pMSCV-miR-99a resulted in mock A549 (A549-miR-99a) and mock H1299 (H1299-miR-99a The 2′-O-methyl oligonucleotides were chemically synthesized by LifeTechnologies (Guangzhou, Guangdong, China). [score:1]
The oligonucleotide sequences were as follows: miR-99a mimic forward, 5′-AACCCGUAGAUCCGA UCUUGUG-3′ and reverse, 5′-CAAGAUCGGAUCUACGGG UUUU-3′; miR -negative control (miR-NC) forward, 5′-UUC UCCGAACGUGUCACGUTT-3′ and reverse, 5′-ACGUGAC ACGUUCGGAGAATT-3′. [score:1]
The plasmids pMSCV-miR-99a and pMSCV-miR-NC were kindly provided by Dr R Agami (Faculty of Science, Ain Shams University, Cairo, Egypt) (20). [score:1]
As expected, the A549-miR-99a and H1299-miR-99a cells underwent a morphological change of cells to an elongated shape and exhibited a reduction in migration (Fig. 3A and B). [score:1]
The A549 (5×10 [5]) and H1299 (3×10 [5]) cells were seeded 24 h prior to 48-h transfection with the miR-99a mimic or miR-NC, respectively. [score:1]
[1 to 20 of 38 sentences]
11
[+] score: 118
It was also shown that decreased miR-99a expression in RCC clinical samples correlates with the overall survival rate of RCC patients and the suppression of tumorigenicity upon upregulation of miR-99a in vitro and in vivo (11). [score:8]
In RCC, it was demonstrated that deregulation of miR-99a is involved in the etiology of RCC partially via direct targeting of the mammalian target of rapamycin (mTOR) pathway. [score:7]
In HCC, miR-99a expression has been found to correlate with HCC patients’ survival rate, and miR-99a restoration suppresses HCC growth by targeting insulin-like growth factor 1 and mTOR (14). [score:7]
Therefore, upregulating miR-99a or providing analogous pharmaceutical compounds exogenously should be effective cancer therapies for tumors resulting from the activation or overexpression of these oncogenes. [score:6]
As expected, upregulation of miR-99a significantly inhibited cell proliferation (Fig. 1). [score:6]
As shown in Fig. 3, FGFR3 was significantly downregulated in the bladder cancer T24 and EJ cell lines subsequent to overexpression of miR-99a (P<0.05). [score:6]
The results of the present study indicated that miR-99a suppressed bladder cancer cell proliferation, migration and invasion by the downregulation of FGFR3. [score:6]
FGFR3 is downregulated following overexpression of miR-99a in T24 and EJ cells. [score:6]
Expression of miR-99a has been indicated to be frequently downregulated in various tumors, including squamous cell carcinoma of the tongue, lung cancer, renal cell carcinoma (RCC), HCC, ovarian carcinoma, bladder cancer, childhood adrenocortical tumors and prostate cancer (14). [score:6]
These findings indicate that miR-99a is wi dely downregulated in human cancers, suggesting a potential role of miR-99a as a tumor suppressor. [score:6]
In order to determine whether miR-99a targets the FGFR3 3′-UTR, TargetScan 5.2 and PicTar were used to assess the complementarity of miR-99a to the FGFR3 3′-UTR. [score:5]
As shown in Fig. 4B, overexpression of miR-99a could suppress the FGFR3 3′UTR-luciferase activity by 39% in T24 cells and 46% in EJ cells (P<0.05). [score:5]
Above all, FGFR3 may be a direct target of miR-99a in vitro. [score:4]
FGFR3 is a direct target gene of miR-99a in bladder cancer. [score:4]
The identification of candidate target genes of miR-99a may provide an understanding of potential carcinogenic mechanisms in bladder cancer. [score:3]
In the present study, it was identified that miR-99a may function as a tumor suppressor through repression of FGFR3 in bladder cancer. [score:3]
miR-99a suppresses cell migration and invasion in bladder cancer T24 and EJ cells. [score:3]
miR-99a suppresses cell proliferation in bladder cancer T24 and EJ cells. [score:3]
In summary, to the best of our knowledge, the present study was the first to show that miR-99a regulates FGFR3 and contributes to cell proliferation, migration and invasion in bladder cancer. [score:2]
Our findings indicated that miR-99a may have a potential therapeutic role by regulating oncogenes in bladder cancer patients. [score:2]
The MTT assays revealed that subsequent to 144 h of treatment, the suppression rate of miR-99a reached 34.31±4.5% in T24 cells and 28.01±4.1% in EJ cells. [score:2]
The expression of miR-99a has been investigated in a number of human cancers. [score:1]
Western blot analysis was performed to analyze whether FGFR3 was decreased following transfection of the miR-99a mimics in the bladder cancer cell lines, T24 and EJ. [score:1]
Future studies are required to address whether the potential of miR-99a may be fully realized in cancer treatment. [score:1]
was performed to analyze whether FGFR3 was decreased following transfection of the miR-99a mimics in the bladder cancer cell lines, T24 and EJ. [score:1]
Mature miR-99a mimics and NC were designed and synthesized by GenePharma (Shanghai, China). [score:1]
miR-99a transfection resulted in decreased cell viability, and reduced migration and invasion in bladder cancer cells. [score:1]
The results indicated that miR-99a may play a significant role in bladder cancer T24 and EJ cells. [score:1]
However, to date, there are no studies of miR-99a in bladder cancer, thus, we focused on this. [score:1]
Transfection of miR-99a mimics, scrambled control (NC) and luciferase reporter plasmid. [score:1]
These results indicated that miR-99a reduced the migration and invasion in bladder cancer T24 and EJ cells. [score:1]
It was shown that FGFR3 mRNA contained an miR-99a seven-nucleotide seed match at position 537–544 of the FGFR3 3′-UTR (Fig. 4A). [score:1]
If so, miRNA-99a may be beneficial for the treatment of bladder cancer. [score:1]
The cells were plated in a 12-well plate at ~90% confluence and transfected with 0.5 μg reporter plasmid, 40 nmol miR-99a mimics or their negative control by Lipofectamine 2000. [score:1]
The transfected cells (miR-99a mimics and NC) growing in the log phase were treated with trypsin and re-suspended as single-cell solutions. [score:1]
It has been reported that miR-99a is transcribed from the commonly deleted region at 21q21 in human lung cancers (13). [score:1]
de/) in order to assess the complementarity of miR-99a to the FGFR3 3′-UTR. [score:1]
The cells were transfected with miR-99a mimics or NC and were seeded in 96-well plates at a density of 3,000 cells per well. [score:1]
These results indicated that miR-99a reduced the protein level of FGFR3 in the bladder cancer cells. [score:1]
[1 to 20 of 39 sentences]
12
[+] score: 101
Mir-99a (per unit of relative mir-99a expression increase OR = 6.053 95% CI: 1.897–19.314 p = 0.0024) IFI35 (per unit of relative IFI35 expression increase OR = 0.069 95% CI:0.013–0.361 p = 0.0015) and HCV genotype 1 (vs. [score:5]
Previous reports described hepatic expression of mir-99a, mir-23a and mir-181a suggesting processing of the pre-Mir and co -expression of mir-181a* [31– 33]. [score:5]
5A- ORs are presented for the 3 variables of the signature: mir-99a, IFI35 and HCV genotype 1. 5B- Receiver Operator Curves for prediction of viral response of the signature (AUC 0.876) (genotype 1, IFI35 and mir-99a expression) based on IFI35 expression (AUC 0.777) and mir-99a (AUC 0.688). [score:5]
Down-regulation of hepatic mir-99a in patients with advanced fibrosis. [score:4]
Identification of a 3 miRNAs signature (mir-99a, mir-23a and mir-181a*) predictor of SVR and selective analysis of miRNAs expression in NRs and SVRs. [score:3]
Surprisingly, in our cohort, the expression of mir-99a is reduced in F2-F4 vs. [score:3]
The combination of mir-99a, IFI35 expression and HCV genotype was a higher predictive factor, at baseline, than IFNL3 polymorphism (Fig. 5). [score:3]
Therefore, the expression of mir-99a alone or both mir-23a, mir-99a and mir-181a* has to be assessed in the liver, to provide enough information to predict SVR. [score:3]
We identified a signature combining the hepatic expression 3 miRNAs (mir-23a, mir-99a and mir-181a*) to predict SVR (AUC: 0.7346) (Fig. 2A). [score:3]
The major novelty of our work consists in the identification of 4 miRNAs (mir-23a, mir-99a, mir-181a*, and mir-217) differentially expressed between NRs and SVRs. [score:3]
The multivariate analysis of all clinical and biological data, miRNAs and mRNAs expression and IFNL3 SNPs, allowed us to build a signature (IFI35, mir-99a and HCV genotype) which is associated with a high predictive positive value (86.54%), sensibility (80%) and specificity (80.4%). [score:3]
Moreover, restoration of mir-99a, in vitro, dramatically suppressed HCC cell growth by inducing G1 phase cell cycle arrest [31]. [score:3]
The assessment of the hepatic expression of mir-99a and IFI35 may help to discriminate patients with low chance to respond to PEG-IFN plus ribavirin. [score:3]
HCV genotype 1 infected patients with low level of IFI35 and high level of mir-99a (h for high, > mean mir-99a expression) showed high SVR rates. [score:3]
Moreover, the expression of mir-23a, mir-99a and mir-122 were not correlated in serum and liver samples (Table 3). [score:3]
None of mir-23a, mir-99a and mir-122 was differentially expressed between SVRs and NRs (Fig. 3A). [score:3]
Only few putative mRNAs targets of mir-23a, mir-217, mir-99a and mir-181a* have been described, so far. [score:3]
The histograms represent the mean expression of mir-99a/SNORD44 within the groups of patients with the different stages of fibrosis according to metavir score (F1 to F4), normalized to mir-99a within the group of normal patients. [score:3]
Since EMT is involved during liver fibrogenesis, the expression of mir-99a may increase during fibrosis. [score:3]
Interestingly, Mir-217 has been described as an oncogene [35] and a reduction of mir-99a expression has been reported in HCC tissues [31]. [score:3]
The EMT, in the liver may not induce a reduction of mir-99a expression. [score:3]
In patients infected with genotype 1 both IFI35 and mir-99a expression were important to predict SVR. [score:3]
Interestingly, serum mir-99a was down-regulated in patients with HCV compared to normal controls and patients with chronic hepatitis B [40]. [score:3]
Mir-99a, mir-181a* and mir-23a were down-regulated in NRs whereas mir-217 was accumulated in NRs compared to SVRs. [score:3]
The expression of mir-23a, mir-99a and mir-181a* was increased in SVRs compared to NRs. [score:2]
In the serum, the level of expression of mir-23a and mir-99a were low compared to the one of mir-122 (Fig. 3A). [score:2]
The level of expression of mir-23a and mir-99a were low compared to mir-122 (Fig. 3A). [score:2]
S1B- the level of expression of mir-99a was compared in patients with mild ad moderate fibrosis (F1-F2, n = 71) and those with with advanced fibrosis and cirrhoris (F3-F4, n = 35). [score:2]
S1A- The level of expression of mir-99a was compared between patients with mild fibrosis (F1, n = 35) and those with moderate fibrosis to cirrhosis (F2-F4, n = 71). [score:2]
S1 Fig Total RNAs was extracted and analyzed for mir-99a content by RT q-PCR. [score:1]
Further analysis showed that only mir-99a was an independent predictor of SVR and mir-99a was integrated in the signature to predict SVR, with a p-Value of 0.0051 in multivariate analysis. [score:1]
The reduction of mir-99a in NRs and at later stages of fibrosis may indicate that these two groups of patients have a higher risk to develop HCC. [score:1]
Total RNAs was extracted and analyzed for mir-99a content by RT q-PCR. [score:1]
For the identification of mir-99a, in the screen group, we use of a validation procedure on an independent sample prevented inflation of type I error and false discovery rate. [score:1]
This discrepancy may explain the low level of serum mir-99a detected in our cohort. [score:1]
However, further analysis will be needed to confirm the role of mir-99a in the prediction of SVR. [score:1]
The AUC of the mo del consisting in the combination of mir-99a, mir-181a* and mir-23a was 0.7346 (Fig. 2A). [score:1]
3A- Mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 were detected by RT-q-PCR in 68 serums (NR = 26, RR = 10, RR = 32). [score:1]
Overall the variables included in the multivariate analysis only mir-99a, IFI35 and HCV genotype 1 were independent predictors of SVR (p = 0.0051 p = 0.0011 and p = 0.0059 respectively Wald test) (Fig. 5B). [score:1]
The expression of mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 was investigated, in 68 serum samples available (NR = 26, RR = 10, RR = 32) (Fig. 3). [score:1]
0121395.g003 Fig 33A- Mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 were detected by RT-q-PCR in 68 serums (NR = 26, RR = 10, RR = 32). [score:1]
[1 to 20 of 41 sentences]
13
[+] score: 36
, High Wycombe, UK) analysis of 1733 human microRNAs and validation by qRT-PCR showed microRNA-21, microRNA-99a, microRNA-100, microRNA-125b, microRNA-138, microRNA-147b, microRNA-148a, microRNA-210, microRNA-376a, and microRNA-455-3p to be significantly upregulated, whereas microRNA-31-star, microRNA-330-3p, microRNA-330-5p, microRNA-378d, microRNA-422a, and microRNA-486-5p were significantly downregulated. [score:7]
MicroRNA-21 (p = 4.3817E-07), microRNA-31 (p = 0.0003), microRNA-99a (p = 0.0406), microRNA-100 (p = 4.0492E-08), microRNA-125b (p = 0.0001), microRNA-138 (p = 0.0301), microRNA-147b (p = 0.0028), and microRNA-210 expression (p = 0.0044) were significantly upregulated in PDAC stage II vs. [score:6]
Interestingly, co-overexpression of miR-125b, miR-99a, and miR-100 was reported in different cancers suggests possible co-regulation of these miRs in chemoresistant PDAC as well [30, 31]. [score:4]
Poor response to chemotherapy was significantly correlated to overexpression of microRNA-21 (p = 0.029), microRNA-99a (p = 0.037), microRNA-100 (p = 0.028), and microRNA-210 (p = 0.021) in tissue samples of PDAC patients UICC stage II. [score:3]
p < 0.05 indicates significance Kaplan-Meier survival analysis revealed significantly improved overall survival and recurrence-free survival rates in PDAC patients with low expression of microRNA-21 (cutoff 4.7; p = 0.0181; p = 0.0149), microRNA-99a (cutoff 2.5; p = 0.0325; p = 0.1711), microRNA-100 (cutoff 5.0; p = 0.0004; p = 0.0111), microRNA-125b (cutoff 1.6; p = 0.0491; p = 0.0373), and microRNA-210 (cutoff 4.6; p = 0.0161; p = 0.0116) in the adjuvant setting (Fig.   4). [score:3]
Fig. 3The 2 [-ΔΔCt] expression level of microRNA-21 (a), microRNA-99a (b), microRNA-100 (c), and microRNA-210 (d) in PDAC UICC stage II with good and bad response. [score:3]
After normalization to benign noninflammatory controls (n = 13) by the ΔΔCt method, poor adjuvant gemcitabine mono-chemotherapy response was significantly related to overexpression of microRNA-21 (p = 0.0366), microRNA-99a (p = 0.0163), microRNA-100 (p = 0.0157), and microRNA-210 (p = 0.0252) (Fig.   3). [score:3]
p < 0.05 indicates significanceKaplan-Meier survival analysis revealed significantly improved overall survival and recurrence-free survival rates in PDAC patients with low expression of microRNA-21 (cutoff 4.7; p = 0.0181; p = 0.0149), microRNA-99a (cutoff 2.5; p = 0.0325; p = 0.1711), microRNA-100 (cutoff 5.0; p = 0.0004; p = 0.0111), microRNA-125b (cutoff 1.6; p = 0.0491; p = 0.0373), and microRNA-210 (cutoff 4.6; p = 0.0161; p = 0.0116) in the adjuvant setting (Fig.   4). [score:3]
microRNA-99a and microRNA-100, two members of the microRNA-99 family, were found to be overexpressed in PDAC tissue compared with normal pancreatic tissue and chronic pancreatitis [25]. [score:2]
Fig. 4Prognostic impact of microRNA-21 (a, b), microRNA-99a (c, d), microRNA-100 (e, f), microRNA-125b (g, h), and microRNA-210 (i, j) on overall survival (right column) and recurrence-free survival (left column) in PDAC UICC stage II patients. [score:1]
Univariate Cox regression overall and recurrence-free survival analyses identified microRNA-21 (p = 0.0231; p = 0.0211), microRNA-99a (p = 0.0393; p = 0.1864), microRNA-100 (p = 0.0013; p = 0.0163), microRNA-125b (p = 0.0578; p = 0.0472), and microRNA-210 (p = 0.0211; p = 0.0168) as unfavorable prognostic factors in resected and adjuvant -treated PDAC UICC stage II patients (Table  5). [score:1]
[1 to 20 of 11 sentences]
14
[+] score: 30
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30aA notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
The megaloop contains, among other features, a conserved pair of target sites for miR-320a and miR-182 (Fig.  4b) and a conserved triplet of target sites for miR-378, miR-99a and miR-30a (Fig.  4c). [score:5]
The miR-99a and miR-30a target sites are found in the Latimeria sequence and can therefore be inferred to have been present in the last common ancestor of tetrapods and lobe-finned fishes. [score:3]
[1 to 20 of 4 sentences]
15
[+] score: 28
RT-PCR validation of mostly dysregulated miRs confirmed that miR-138, miR-147b, miR-148a, miR-99a, miR-455-3p and miR-125b were significantly upregulated and miR-31-star, miR-422a, miR-330-3p, mir-330-5p and miR-378d were downregulated in PANC-1-GR cell clones vs. [score:8]
MiR-screening revealed significantly upregulated (miR-21, miR-99a, miR-100, miR-125b, miR-138, miR-210) and downregulated miRs (miR-31*, miR-330, miR-378) in chemoresistant PDAC (p<0.05). [score:7]
In MIA-PaCa-2-GR cell clones miR-125b, miR-210, miR-21, miR-100, miR-148a, miR-99a and miR-455-3p were significantly upregulated, whereas miR-330-3p, miR-330-5p, miR-486-5p, miR-422a and miR-31-star were significantly downregulated (Fig 6B). [score:7]
The cell division cycle 25 homolog A (CDC25A), required for progression from G1 to S phase of the cell cycle by activating cyclin -dependent kinases (CDK), is highly predicted to be targeted by miR-21, miR-99a, miR-100, and miR-125b [56]. [score:3]
MiR-99a and miR-100, two members of the miR-99 family, were found by Bloomston et al. to be overexpressed in PDAC tissue compared with normal pancreatic tissue and chronic pancreatitis [17]. [score:2]
Some of these miRs, such as miR-21, miR-99a, miR-100, and miR-210 are already known as potential oncogenes (oncomiRs) in PDAC. [score:1]
[1 to 20 of 6 sentences]
16
[+] score: 27
So, we selected the union of the target genes of hsa-miR-141 and hsa-miR-200b for tumor-preferring miRNAs, and the union of the target genes of hsa-miR-22, hsa-miR-125b, and hsa-miR-99a for normal-preferring miRNAs. [score:5]
The target genes are labeled in red The enriched pathway of the target gene union of hsa-miR-22, hsa-miR-125b, and hsa-miR-99a (normal-preferring). [score:5]
Oneyama et al. [55] reported that overexpression of miR-99a led to the suppression c-Src-transformed cell growth, by controlling the mTOR/FGFR3 pathway in various human cancers. [score:5]
The target genes are labeled in red Click here for file The enriched pathway of the target gene union of hsa-miR-22, hsa-miR-125b, and hsa-miR-99a (normal-preferring). [score:5]
The target genes of hsa-miR-22, hsa-miR-125b, and hsa-miR-99a were significantly enriched in the MAPK pathway (p = 2.4E-6). [score:3]
In epithelial NMUMG cells, however, miR-99a promoted proliferation and migration by regulating TGF-β -induced breast EMT [56]. [score:2]
However, miR-99a plays opposite roles in the regulation of cancer progression. [score:2]
[1 to 20 of 7 sentences]
17
[+] score: 27
Of note, miR-185, miR-139-5p, miR-484, and miR-130b were down-regulated in obese without DM-2 when compared to non-obese subjects while the expression of miR-99a, miR-1229, miR-125b, miR-221 and miR-199a-5p was up-regulated [Figure 4A and Table S2]. [score:8]
Of note there, miR-10a, miR-34a, miR-100 (in both pre-adipocytes and mature adipocytes), miR-210 and miR-99a (only in mature adipocytes) were up-regulated in cell lines from obese subjects (Table 1) and correlated with BMI [Table S3] while miR-221 (in both pre-adipocytes and adipocytes), miR-210 (in pre-adipocytes) and miR-125b (in adipocytes) were significantly down-regulated (Table 1). [score:7]
1) Differential miRNA Expression between Lean and Obese Cell Lines before and after In Vitro Differentiation and during Adipogenesis MiR-10a (in both pre-adipocytes and mature adipocytes), miR-34a, miR-100, miR-30a (only in pre-adipocytes), miR-99a and miR-210 (only in mature adipocytes) were up-regulated in cells and subcutaneous fat depots from obese when compared to those obtained from lean individuals. [score:5]
22 hsa-miR-224 1.43 hsa-miR-26a −1.26 hsa-miR-29a −1.21 hsa-miR-376c 1.26 hsa-miR-424 −1.35 hsa-miR-455-3p 1.48 hsa-miR-99a † 1.21 Italic: down-regulated in fat cells from obese. [score:4]
MiR-10a (in both pre-adipocytes and mature adipocytes), miR-34a, miR-100, miR-30a (only in pre-adipocytes), miR-99a and miR-210 (only in mature adipocytes) were up-regulated in cells and subcutaneous fat depots from obese when compared to those obtained from lean individuals. [score:3]
[1 to 20 of 5 sentences]
18
[+] score: 26
GALC and S100B gene expression was significantly upregulated after transfection of hsa-miR-99a mimics, suggesting a role in promoting differentiation of hNSC into glial restricted progenitors and oligodendrocyte progenitor cells. [score:6]
The upregulated miRNAs: hsa-miR-146b-5p, hsa-miR-23b, and hsa-miR-99a were selected, and their mimics were transfected into hNSCs to validate their correlation with differentiation of progenitors into neurons or glia. [score:4]
Hsa-miR-146b-5p, hsa-miR-99a-5p, and the hsa-let-7 family (hsa-let-7c, and 7b), and hsa-miR-23b were identified as significantly upregulated in both 2D and 3D differentiated samples (Figure  3, Table  1). [score:4]
In contrast significant increases in gene expression of the oligodendrocyte precursor marker GALC and the astrocytic glial marker S100B were solely induced by hsa-miR-99a, whereas the neuronal precursor marker TUBB3 was solely induced by hsa-miR-146b-5p (Figure  4B). [score:3]
Interestingly, hsa-miR-99a and hsa-miR-146b-5p, reported to be related to the immune system and cancer inhibition [39, 40], have not yet been correlated with neuronal or glial differentiation. [score:3]
B) QRT-PCR molecular analysis for neuronal (TUBB3, DCX, and MAP2) and glial (GALC, GFAP, and S100B) markers of 146b-5p, hsa-miR-23b, hsa-miR-99a mimic transfected hNSCs and expressed as fold change compared with GFP transfected hNSCs (control). [score:2]
The miRNA mimic analysis of hsa-miR-146b-5p and hsa-miR-99a confirmed induction of lineage-committed progenitors. [score:1]
Each of three miRNA mimics (5 n M; Qiagen), hsa-miR-146b-5p, UGAGAACUGAAUUCCAUAGGCU, hsa-miR-23b, AUCACAUUGCCAGGGAUUACC, and hsa-miR-99a, AACCCGUAGAUCCGAUCUUGUG was combined with HiPerFect (Qiagen) according to manufacturer’s instructions. [score:1]
Hsa-miR-99a, hsa-miR-146b-5p, and hsa-miR-23b mimics were transfected into hNSCs. [score:1]
Taken together, hsa-miR-99a and hsa-miR-146b-5p appear to be involved in early-stage commitment of glial and neuronal precursors, respectively. [score:1]
[1 to 20 of 10 sentences]
19
[+] score: 26
Previously, we identified several tumor-suppressive miRNAs that are repressed in c-Src–transformed cells: miR-99a targets mTOR to suppress tumor progression, and miR-542-3p targets ILK to suppress tumor malignancy [32, 38]. [score:11]
miR-99a–mediated mTOR upregulation collaborates with miR-424/503–mediated Rictor upregulation to promote mTORC2 activation. [score:7]
Recently, we showed that miR-99a, which is downregulated by the activation of Src-related oncogenic pathways, controls mTOR expression in various human cancers. [score:6]
This novel regulatory role of miR-99a suggests a missing link between Src and mTOR in cancer progression [32]. [score:2]
[1 to 20 of 4 sentences]
20
[+] score: 25
Out of 11 miRs, 3 miRs were reliably detected and significantly up-regulated: miR-21, miR-92a, and miR-99a while the expression of miR-1, miR-22, and let-7f was down-regulated (Fig.   1). [score:9]
The present study is the first to describe significantly upregulation of miR-99a in human coronary atherosclerotic plaques versus IMA (p < 0.005, fold changes 3.8). [score:4]
Yang Z Han Y Cheng K Zhang G Wang X miR-99a directly targets the mTOR signalling pathway in breast cancer side population cellsCell Prolif. [score:4]
Under the 32 identified miR-99a target genes (see Supplementary Table  S3) two are related to atherosclerosis: TRAF7 modulates activity of NF-κB transcription factor, and may thus contribute to pro-atherogenic inflammatory stimulation [42]. [score:3]
We focused on targets predicted by at least two prediction data bases and containing a miR-92-8mer or miR-99-8mer seed match in the respective 3′UTR region 7, 20. [score:3]
More research is still needed to verify the pharmacological and diagnostic potential of miR-99a in vascular endothelial cells as well as in atherosclerosis. [score:1]
Feliciano A miR-99a reveals two novel oncogenic proteins E2F2 and EMR2 and represses stemness in lung cancerCell Death Dis. [score:1]
[1 to 20 of 7 sentences]
21
[+] score: 25
Two of the upregulated miRNAs (miR-222-3p, miR-138-5p) and two of the downregulated miRNAs (miR-125b-5p, miR-99a-5p) were confirmed to be significantly differentially expressed between iDCs and 27DCs (Figure 3). [score:9]
Among them, 12 miRNAs (let-7e-5p, miR-151a-3p, miR-21-5p/-3p, miR-221-5p/-3p, miR-222-3p, miR-424-3p, miR-450a-5p, miR-450b-5p, miR-503-5p, and miR-99b-5p) were up-regulated by IL-27 and two miRNAs (miR-99a-5p and miR-125b-5p) were down-regulated. [score:7]
Interestingly, the relatively highly expressed miRNAs (miR-21-5p, miR-21-3p, miR-221-3p, miR-222-3p, let-7e-5p, miR-99a-5p, and let-7c-5p) targeted Human herpesvirus and other viruses. [score:5]
Among them, four miRNAs (miR-125b-5p, miR-138-5p, miR-222-3p, and miR-99a-5p), which potentially target genes involved in ErbB, Wnt, TGF-β, MAPK, and PI3K signaling pathways, were validated by RT-qPCR. [score:3]
Four of these were confirmed by RT-qPCR (miR-99a-5p, miR-222-3p, miR-138-5p, and miR-125b-5p). [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 24
Both miR-99a and miR-100 are among the most downregulated miRNAs in adrenocortical tumours (ACT), which have been identified to be regulators of IGF-R expression by acting on a target site in the 3′-UTR of its mRNA [143]. [score:9]
Finally, miR-99a expression and mTOR were found to be inversely correlated in human HCC and restored miR-99a expression inhibited cell growth both in vivo and in vitro [147]. [score:7]
In hepatocellular carcinoma (HCC), miR-99a is inhibited, and restoring its expression suppresses cell growth in vitro by activating G1 phase cell cycle arrest [147]. [score:7]
In vivo, miR-99a mimics reduced tumour growth and reduced the α-fetoprotein level [147]. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 23
C) MicroRNA-100-5p and miR-99a-5p whose expression levels negatively correlate with stemness, were significantly downregulated after 6–7 days of simulated microgravity in neonatal CPCs (n = 3, p<0.05). [score:6]
Two of the 15 significantly altered microRNAs, microRNA-99a-5p and microRNA-100-5p which were significantly down-regulated in response to simulated microgravity (1.9 fold decrease, p = 0.04 and 2.4 fold decrease, p = 0.03 respectively, Fig 4C) play a critical role in dedifferentiation [32]. [score:4]
In animals with superior regenerative ability, such as zebrafish, microRNA-99a and miR-100 are strongly downregulated at the initiation of regeneration and result in dedifferentiation of existing cardiomyocytes [32]. [score:4]
D) Expression of microRNA-99a-5p and miR-100-5p were unchanged in adult CPCs after simulated microgravity (n = 3, run in triplicate). [score:3]
MicroRNA-99a and miR-100 transcripts are undetectable in undifferentiated embryonic stem cells, but the level of expression increases with cell differentiation [46]. [score:3]
Adult CPCs did not demonstrate a significant difference in the expression of microRNA-99a-5p (1.1 fold decrease, p = 0.16) and microRNA-100-5p (1.1 fold decrease, p = 0.21) before and after exposure to simulated microgravity (Fig 4D). [score:3]
[1 to 20 of 6 sentences]
24
[+] score: 22
These were hsa-miR-512-3p/-515/-517/-518/-525 (up to 8.1-fold up-regulated) and hsa-miR-99a/-100/-145 (up to 10-fold down-regulated). [score:7]
Moreover, we describe for the first time an association of the up-regulation of micro -RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors. [score:7]
According to our analysis, further micro -RNA species appeared either about 8-fold up-regulated (hsa-miR-512-3p/-515/-517/-518/-525) or about 10-fold down-regulated (hsa-miR-99a/-100/-145) in both NTERA-2-R/NTERA-2 and NCCIT-R/NCCIT cell line pairs. [score:7]
Moreover, new micro -RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 or hsa-miR-99a/-100/-145, also potentially involved in cisplatin resistance, could be identified in the germ cell tumor cell lines studied here. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 21
As the expressions of miR-27a and miR-99a decreased during hepatic differentiation the expression of LDLR expression increased, suggesting that these miRNAs regulate LDLR expression. [score:10]
As shown in Table S2 LDLR was identified as a direct target of miR-27a and miR-99a. [score:4]
In contrast, miR-99a had no effect on the expression of LDLR (data not shown). [score:3]
In addition, differential expression of miR-27a and miR-99a was detected in AT-hMSCs and DHCs. [score:3]
We next investigated which of the miRNAs directly regulates LDLR by transfecting DHCs with mimics of miR-27a and miR-99a and then staining them with Dil-LDL. [score:1]
[1 to 20 of 5 sentences]
26
[+] score: 20
Insulin can inhibit the expression of miR-99a, and then induce the expression of miR-99a direct target mTOR, which in turn increases PKM2 and HIF-1α expression for regulating glucose consumption and lactate production. [score:13]
Meanwhile, the expression levels or activities of p53 and HIF-1 are also under the direct or indirect control of several microRNAs, such as miR-183, miR-28-5p, and miR-99a, through the acetylation and deacetylation modification. [score:5]
These findings reveal the role of insulin in regulating glycolytic activities via miR-99a/mTOR/HIF-1α pathway and indicate the intimate relationship between cancer glucose metabolism and diabetes [88]. [score:2]
[1 to 20 of 3 sentences]
27
[+] score: 18
miR-100 and mir-99a, both putative tumor suppressors, were under- expressed in T vs N and over-expressed in M vs T. Identification of DEM confirmed that more miRNAs are modulated in T vs N than in M vs T comparison; however, DEMs in metastasis compared with primary tumors may be of great importance, since they include miR-10b, miR-210 and miR-708, which are key regulators of several processes related to disease progression, such as DNA repair, angiogenesis, hypoxia, EMT induction, and cancer recognition by the immune system [16- 18]. [score:9]
miR-100 and mir-99a, both putative tumor suppressors, were under- expressed in T vs N and over-expressed in M vs T. Identification of DEM confirmed that more miRNAs are modulated in T vs N than in M vs T comparison; however, DEMs in metastasis compared with primary tumors may be of great importance, since they include miR-10b, miR-210 and miR-708, which are key regulators of several processes related to disease progression, such as DNA repair, angiogenesis, hypoxia, EMT induction, and cancer recognition by the immune system [16- 18]. [score:9]
[1 to 20 of 2 sentences]
28
[+] score: 18
In particular, the following target proteins were downregulated: PTEN which is known to be targeted by miR-21 [28], [29], cyclin D1 which is known to be targeted by miR-100, miR-99a and miR-223 [30] and Bcl-2 which is known to be targeted directly by miR-34, miR-181b and miR-16 [31], [32], [33] or indirectly modulated by miR-21 [34]. [score:14]
The following miRNAs were tested: miR-221 (line1), miR-99a (line 2), miR-222 (line 3), miR-24 (line 4), miR-410 (line 5), miR-21 (line 6), miR-100 (line 7), miR-214 (line 8), miR-31 (line9), miR-223 (line 12), miR-122 (line 13) and miR-451 (line 14). [score:1]
D. miRNAs MSCs MSC MVs HLSCs HLSC MVs hsa-miR-125b 296.2±82.55 66.1±57.6 51.3±0.25 20.4±3.15 hsa-miR-222 222.25±19.7 39.1±20.2 68.7±25.5 43.2±4.2 hsa-miR-24 135±46.85 40.75±29.6 72.3±17.4 54.4±18.5 hsa-miR-99a 125.7±9.9 23.7±14.1 59.1±10.2 15.0±1.8 hsa-miR-100 115. [score:1]
The abundance of some miRNAs (miR-21, miR-100, miR-99a and miR-223) increased progressively in mTEC concomitantly with the internalization of PKH26- labeled MVs (Figure 7A and B). [score:1]
D. hsa-miR-125b 157.2±44.7 hsa-miR-24 52.5±12.8 hsa-miR-222 120.1±10.7 hsa-miR-222 48.9±18.8 hsa-miR-24 70.9±25.4 hsa-miR-99a 43.3±7.5 hsa-miR-99a 67.9±5.4 hsa-miR-125b 37.8±0.2 hsa-miR-100 62.6±0.0 hsa-miR-100 37.2±0.3 hsa-miR-594 40.3±3.2 hsa-miR-31 30.9±12.3 hsa-miR-31 33.2±8.4 hsa-miR-19b 25.3±4.3 hsa-miR-16 29.4±3.1 hsa-miR-16 21.4±3. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 18
Notably the microRNAs upregulated in the control fascia accounting for the greatest differential in read count are heavily enriched in previously validated anti-fibrotic extracellular matrix targeting microRNAs (Table  1), including let-7 [23– 25], miR-29a-3p [26], miR-26b-5p, miR-30d-5p [27, 28], miR-27a-3p, miR-27b-3p [29, 30], miR-10a-5p [31], miR-26a-5p [32– 35], miR-101-3p [36– 39], and miR-10b-5p [40], as well as anti-proliferative microRNAs including, miR-126-3p [41– 47], miR-99a-5p [48– 54], miR-125a-5p [55– 59], and miR-139-5p [60– 62]. [score:6]
Song Y Dou H Wang P Zhao S Wang T Gong W Zhao J Li E Tan R Hou Y A novel small-molecule compound diaporine A inhibits non-small cell lung cancer growth by regulating miR-99a/mTOR signalingCancer Biol Ther. [score:4]
Additional enriched microRNAs (miR-126-3p [46– 52], miR-99a-5p [53– 59], miR-125a-5p [60– 64], and miR-139-5p [65– 67]) have been shown to affect proliferation in cancer, and may regulate the fibroproliferative activity seen in Dupuytren’s disease. [score:4]
Jin Y Tymen SD Chen D Fang ZJ Zhao Y Dragas D Dai Y Marucha PT Zhou X MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healingPLoS One. [score:2]
Cui L Zhou H Zhao H Zhou Y Xu R Xu X Zheng L Xue Z Xia W Zhang B Ding T Cao Y Tian Z Shi Q He X MicroRNA-99a induces G1-phase cell cycle arrest and suppresses tumorigenicity in renal cell carcinomaBMC Cancer. [score:2]
[1 to 20 of 5 sentences]
30
[+] score: 18
Mir-99a was significantly down regulated in obese female pigs in the sequencing study, but it is significantly up regulated in obese females and significantly down regulated in obese males in the qPCR study. [score:3]
In the female pigs mir-9, mir-124a, mir-103, mir-10b and mir-99a were differentially expressed (Table 6). [score:3]
The up regulation of mir-99a in qPCR of the obese female pigs is consistent with a study in subcutaneous adipose tissue of obese women where mir-99a also was significantly up regulated in the obese state [64]. [score:3]
When the qPCR results were analyzed for male pigs only, mir-99a was differentially expressed in addition to mir-124a and mir-9 (Table 6). [score:3]
Interestingly, in the male pigs mir-99a was down regulated in the obese subjects, while for the females mir-99a was up regulated in the obese subjects. [score:3]
Interestingly, in the sequencing results mir-99a was significantly down regulated in obese females. [score:2]
Mir-99a is also up regulated during adipocyte differentiation into mature adipocytes [64, 67]. [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 17
Many of these upregulated miRNAs were known oncomiRs in breast cancer, such as miR-200, miR-141 and miR-223 [21– 23], Also, many of down-regulated miRNAs in MCF7 HER2 cells were tumor suppressors, such as miR-125b, miR-31 and miR-99a [24– 26]. [score:9]
Our qRT-PCR data demonstrated that miR-489, miR-125b and miR-99a at least partially restored their expression profile after inhibition of HER2 phosphorylation (Figure 1C). [score:5]
A comparison of our data with these published expression signatures revealed several miRNAs previously found to be associated with HER2 such as miR-125, miR-99a and miR-21 [30, 33, 34]. [score:3]
[1 to 20 of 3 sentences]
32
[+] score: 17
Similarly, studies have demonstrated that IGF1R and mammalian target of rapamycin (mTOR), components of IGF1R signaling pathway, are target genes of another tumor suppressor miRNA, the miR-99a [46, 47]. [score:7]
Downregulation of miR-99a was observed in OSCC patient specimens and cell-lines [46, 47], especially in OSCC patients with lymphovascular invasion [46], suggesting a role for miR-99a in lymphovascular invasion. [score:4]
In addition, miR-99a induced apoptosis and inhibited OSCC cell proliferation, migration, and invasion in vitro as well as lung colonization in vivo [46, 47]. [score:3]
Likewise, restoration of miR-99a level by miR mimic transfection markedly suppressed proliferation and induced apoptosis of TSCC cells [47]. [score:3]
[1 to 20 of 4 sentences]
33
[+] score: 16
In prostate tumor tissue, miR-99a-5p was found to be down-regulated and its overexpression in a prostate cancer cell line was reported to inhibit the growth of the recipient cells and decreased the expression of the prostate-specific antigen [56]. [score:10]
However, overexpression of the miR-99a was also reported to be responsible for increased proliferation, migration and fibronectin levels in a murine epithelial cell line NMUMG, possibly via modulating the TGF-β pathway [57]. [score:3]
The five most common miRNAs (miR-99a-5p, miR-128, miR-124-3p, miR-22-3p, and miR-99b-5p) collectively accounted for 48.99% of all mappable miRNA sequences. [score:1]
For example, miR-99a-5p, the most abundant miRNA in the plasma exosomes, functions in a tissue -dependent manner. [score:1]
The five most abundant miRNAs in the libraries were miR-99a-5p, miR-128, miR-124-3p, miR-22-3p, and miR-99b-5p, which together accounted for 48.99% of all detectable miRNAs (Table  2). [score:1]
[1 to 20 of 5 sentences]
34
[+] score: 16
Specifically, everolimus targets mTOR signaling and mTOR regulated miRNAs such as miR-99a-3p (upregulated), miR-99a-5p (downregulated), miR-221 (upregulated), and miR-100 (downregulated). [score:16]
[1 to 20 of 1 sentences]
35
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05 To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
[1 to 20 of 2 sentences]
36
[+] score: 14
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
[1 to 20 of 3 sentences]
37
[+] score: 14
Other down-regulated miRNAs included miR-99a, which is deleted in the lung cancer cell line MA17 [34] and in serous ovarian cancer [33] and miR-203 whose gene is deleted in nasopharyngeal carcinoma [35] and is down-regulated in cervical cancer [18]. [score:7]
At least eight miRNAs showed significant down-regulation between normal cervical samples and the pre-neoplasic and neoplasic samples, namely miR-143, miR-145, miR-99a, miR-26a, miR-203, miR-513, miR-29a and miR-199a. [score:4]
Eight miRNAs exhibited relative decreased expression with transition from normal cervix to atypical dysplasia to cancer (miR-26a, miR-143, miR-145, miR-99a, miR-203, miR-513, miR-29a, miR-199a) (Figure 4A). [score:3]
[1 to 20 of 3 sentences]
38
[+] score: 14
A Mann-Whitney U test of miRNAs normalized to miR-99a-5p and miR-139-5p expressed in at least 5 of 7 fasting or 5 of 7 non-fasting samples showed that no miRNAs were significantly (P < 0.05) differentially expressed between the two groups (data not shown). [score:5]
A Mann-Whitney U test conducted on miRNAs normalized to miR-99a-5p and miR-139-5p and detected in at least 80% of smokers or 80% of non-smokers showed that no miRNAs were significantly (corrected P-value < 0.05) differentially expressed. [score:3]
After normalization to miR-99a-5p and miR-139-5p, Pearson correlation coefficients between serum triglyceride concentration and miRNA levels showed 6 miRNAs were significantly (4 directly and 2 inversely) correlated with serum triglyceride levels (Table  5). [score:2]
Taking the above results into consideration, we have identified miR-99a-5p and miR-139-5p as novel endogenous controls for serum miRNA studies due to their consistency across all sample sets. [score:1]
We propose that miR-99a-5p and miR-139-5p should be used for sample normalization instead of these commonly used endogenous controls due to the fact that they are not significantly affected by hemolysis and that they have the lowest standard deviation across a series of 154 samples (Table  3). [score:1]
Therefore, for the following analyses, all data were normalized to the average Ct values of miR-99a-5p and miR-139-5p. [score:1]
The results were normalized to miR-99a-5p and 139-5p and a fold-change analysis was conducted. [score:1]
[1 to 20 of 7 sentences]
39
[+] score: 13
Further functional experiments found that overexpression of miR-99a inhibit cell proliferation, migration and invasion of NSCLC cells in vitro and tumor metastasis of NSCLC in vivo [6]. [score:5]
In addition, other inhibitors such as miR-99a and heat shock protein 90 (HSP 90) have been also involved in lung tumor development. [score:4]
Down-regulation of miR-99a is significantly associated with last-stage and tumor metastasis in NSCLC patients. [score:4]
[1 to 20 of 3 sentences]
40
[+] score: 13
We also found an age -associated increase of the median expression of miR-96 (p = 0.002), miR-145 (p = 0.024) and miR-9 (p = 0.026), decrease of the expression of miR-99a (p = 0.037), and no changes regarding miR-132 and miR-182. [score:5]
The expression of IGF-1R, FOXO1, FOXO3a, as well as of miR-9, miR-96, miR-99a, miR-132, miR-145, and miR-182 was examined in PBMC of young (27.8 ± 3.7 years), elderly (65.6 ± 3.4 years), and long-lived (94.0 ± 3.7 years) Polish Caucasians using real-time PCR. [score:3]
In contrast, the expression of miR-99a decreased with age (p = 0.037 for the whole group, Y vs. [score:3]
Using this approach, we selected miR-96, miR-99a, miR-145, and miR-182 for IGF-1R mRNA, and miR-9, miR-96, miR-132, miR-145, and miR-182 for FOXO1 mRNA. [score:1]
miR-99a or miR-145, as well as the FOXO1 mRNA vs. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 13
The miRNAs hsa-miR-99a and hsa-miR-365 are downregulated in Lupus vulgaris [38], but were upregulated in blood of melanoma patients. [score:7]
Out of the 51 miRNAs that were deregulated in blood of melanoma patients four miRNAs, namely hsa-miR-99a, hsa-miR-365, hsa-miR-30a, and hsa-miR-146a, were deregulated in non-cancer skin diseases [37, 38]. [score:5]
The best classification accuracy has been obtained by using a subset that consists of 16 miRNAs including hsa-miR-186, hsa-let-7d*, hsa-miR-18a*, hsa-miR-145, hsa-miR-99a, hsa-miR-664, hsa-miR-501-5p, hsa-miR-378*, hsa-miR-29c*, hsa-miR-1280, hsa-miR-365, hsa-miR-1249, hsa-miR-328, hsa-miR-422a, hsa-miR-30 d, and hsa-miR-17*. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 13
The expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC had significantly lower expression levels than in well differentiated HCC (p < 0.05) (Table  2). [score:5]
14.0 and showed that the expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC were expressed significantly lower than in well differentiated HCC. [score:5]
In contrast, miR-99a expression exhibited a positive correlation with the degree of tumor differentiation [9]. [score:3]
[1 to 20 of 3 sentences]
43
[+] score: 12
miR-190a is known to be downregulated in aggressive neuroblastoma (NBL), and overexpression of miR-190a leads to inhibition of tumor growth and prolonged dormancy periods in fast growing tumors 8. Recent study showed that miR-190a is involved in estrogen receptor (ERα) signaling, causing inhibition of breast tumor metastasis 9. Androgen has been shown to repress the expression of miR-99a/let7c/125b-2 cluster through AR 23. [score:12]
[1 to 20 of 1 sentences]
44
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
Among the miRNAs examined, 79 miRNAs (24%) responded to the hyperandrogenic condition and interestingly, 80% of which were upregulated compared to the control group supporting the notion that hyperandrogenic condition down-regulates androgen receptors in the granulosa cells [35] which could be mediated by these upregulated miRNAs (rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p). [score:9]
A list of differentially expressed miRNAs (Fold change ≥ 2 and their corresponding P value) is presented in Figure  4. Beside this group, miRNAs which were also highly abundant in DHT -treated ovaries are rno-miR-221, rno-miR-222, rno-miR-25, rno-miR-26b, rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 11
Furthermore, starBase analysis revealed a significant difference in hsa-miR-99a expression in 420 OSCC patients and 43 subjects from the Pan-Cancer data set [30] (Fig 1F) (p = 1.78 × 10 [−15]). [score:3]
Boxplot chart showing the differential expressions of miR-99a-5p in 420 OSCC patients and 43 normal controls, as taken from the Pan-Cancer dataset [30]. [score:3]
Our present study confirmed the association of the clinically examined rs2929970 in the WISP1 3′-UTR region with OSCC risk; this association is most likely attributed to a putative hsa-miRNA-99a binding site (Fig 1). [score:1]
The hsa-miR-99a-5p sequence marked by green fonts. [score:1]
Predicted hsa-miR-99a-5p binding site with SNP rs2929970 was highlighted by color red fonts. [score:1]
Binding site polymorphism from SNP rs2929970 [G/A] in human WISP1 3’-UTR mRNA with microRNA hsa-miR-99a-5p to decrease oral cancer susceptibility among Taiwan HNSCC population. [score:1]
The miRNA hsa-miR-99a (miRBase ID: MI0003190, Fig 1B) shares binding site complementarily with rs2929970 in the 3′-UTR region (Fig 1C and 1D). [score:1]
[1 to 20 of 7 sentences]
46
[+] score: 11
The results showed that, compared with negative control group, there was no significant difference in metastatic foci in the miR-99a or miR-125b-2 upregulated group; only the let-7c upregulated group showed more metastasis foci (Fig.   5e, f). [score:6]
To additionally determine whether the other two miRNAs, miR-99a and miR-125b-2, that occur in the cluster with let-7c contribute to our observations, we generated a distant metastasis mouse mo del with miR-99a overexpressed cells or miR-125b-2 or let-7c overexpressed cells. [score:5]
[1 to 20 of 2 sentences]
47
[+] score: 11
We found that ten of the down-regulated miRNAs (miR101, miR26a, miR26b, miR30a, miR30b, miR30d, miR30e, miR34b, miR-let7 g and miRN140) were grouped together in a functional network (Figure 3A) and nine of the down-regulated miRNAs (miR-130a, miR-133a, miR-142, miR-150, miR15a, miR-16, miR-29b, miR-30c and miR-99a) were grouped together in a second network (Figure 3B). [score:7]
With the aid of IPA pathway designer, we found that 27 of the 31 down-regulated miRNAs were linked to one or more mRNA networks and 20 of them (let-7 g, miR-101, miR-126, miR-133a, miR-142-5p, miR-150, miR-15a, miR-26b, miR-28, miR-29b, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b, miR-99a, mmu-miR-151, mmu-miR-342 and rno-miR-151) were involved in all of the top 4 networks. [score:4]
[1 to 20 of 2 sentences]
48
[+] score: 11
Noveski et al. determined that miR-23b, miR-32, miR-154 and miR-99 in MArrest and SCOS were up-regulated [42], and we found that these genes were also up-regulated in NOA. [score:7]
For the up-regulated genes, 21 genes among 717 genes (0.029%) were common among PostMA, MA and SCOS, and half of these genes were miRNA (LOC100130428, LOC100131541, MALAT1, MGC24103, miR-145, miR-199a-2, miR-21, miR-27b, miR-30e, miR-32, miR-99a, miR-LET7A2, miR-LET7C, miR-LET7G, PP12719, PWAR6, SNX2, TET2, ZEB2, ZNF189 and ZNF737). [score:4]
[1 to 20 of 2 sentences]
49
[+] score: 10
Disease Origin References of iPSC lines Phenotype of iPSC-derived neurons miRNAs of interest Fragile X syndrome Loss of function of FMRP (FMR1 gene) Urbach et al. (2010), Sheridan et al. (2011) Hyper-excitability of glutamatergic synapses DICER and AGO-1 complexes Rett’s syndrome Loss of function of MeCP2 transcriptional repressor Marchetto et al. (2010), Kim et al. (2011c), Cheung et al. (2012) Decreased soma size, neurite atrophy, decreased efficiency of glutamatergic synapses miR-132, miR-184, miR-483-5p, miR-212 Schizophrenia Multifactorial Urbach et al. (2010); Brennand et al. (2011), Paulsen Bda et al. (2012), Robicsek et al. (2013) Diminished neuronal connectivity miR-17-5p, miR-34a, miR-107, miR-122, miR-132, miR-134, miR-137 Down’s syndrome Additional copy of chromosome 21 Briggs et al. (2013), Weick et al. (2013) Reduced synaptic activity, increased sensitivity to oxidative stress miR-99a, miR-125b, miR-155, miR-802, Ret 7c Micro -RNAs, as fine regulators of protein translation, influence directly the level of gene expression. [score:9]
Hsa21 has been predicted to contain at least five nc -RNAs, miR-99a, miR-125b, miR-155, miR-802, and Ret-7c (Kuhn et al., 2008). [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 10
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
[1 to 20 of 1 sentences]
51
[+] score: 9
Huang H. G. Luo X. Wu S. Jian B. MiR-99a inhibits cell proliferation and tumorigenesis through targeting mTOR in human anaplastic thyroid cancer Asian Pac. [score:4]
It should be noted that the differential expression between grades I and II observed in deep sequencing in a few miRNAs (miR-21, miR-34a, miR-376, miR-451 and miR-99a) were not verified in RT-qPCR (Table 2 and Table 3). [score:3]
Sun J. Chen Z. Tan X. Zhou F. Tan F. Gao Y. Sun N. Xu X. Shao K. He J. MicroRNA-99a/100 promotes apoptosis by targeting mTOR in human esophageal squamous cell carcinoma Med. [score:2]
[1 to 20 of 3 sentences]
52
[+] score: 9
For example, miR-143 and miR-145 are downregulated in colon cancer [27], miR-127 is down regulated or silenced in T24 cell (Bladder transitional carcinoma cell); on the otherhand miR-99 is overexpressed/amplified in pancreatic cancer. [score:7]
In [38], it has been reported that miR-99, miR-100, miR-100-1, miR-125a, miR-125b-1, miR-199a-1 and miR-199a-2 are overexpressed both in pancreatic cancer and chronic pancreatitis compared with normal pancreatic tissue indicating that these can be a common inciting event for neoplastic growth. [score:2]
[1 to 20 of 2 sentences]
53
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Targets of the most remarkably down-regulated miRNAs (let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223) regulate proliferation, gene expression, stress response, apoptosis, and angiogenesis. [score:9]
[1 to 20 of 1 sentences]
54
[+] score: 9
This is justified because up to 56 target of miR-99a have been predicted (among others MTOR, EIF2C, FGFR3, BMP2R, KDM6B) from TargetScan database. [score:5]
Moreover, based on literature reports it can be expected that the decrease in miR-99a in males exerts a neuroprotective effect, such as that observed under oxidative stress conditions (Tao et al., 2015). [score:1]
This is in contrast with miR-99a that appears increased in age and sex effects, but is accounted for by the same probe. [score:1]
Other important microRNAs detected as sex -associated were miR-99a and miR-663a. [score:1]
Neuroprotective effect of microRNA-99a against focal cerebral ischemia-reperfusion injury in mice. [score:1]
[1 to 20 of 5 sentences]
55
[+] score: 9
MiR-99 was reported to mediate down-regulation of mTOR/FGFR3 and suppress tumor growth; miR-100 is known to inhibit mTOR signaling and enhance sensitivity to Everolimus in clear cell ovarian cancer (Nagaraja et al., 2010; Oneyama et al., 2011); and mTORC1 was recently reported to regulate miR-1 in skeletal myogenesis (Sun et al., 2010). [score:9]
[1 to 20 of 1 sentences]
56
[+] score: 8
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
For instance, of the miRNAs that decrease with hematopoietic differentiation in our analysis, mouse studies have shown that a decrease in miR-146a is crucial for megakaryocytopoiesis [43] and a decrease in the miR-99a/miR-125a cluster is important for loss of stemness as the cells mature [44]. [score:1]
Interestingly, four of the reduced miRNAs, miR-99a, miR-100, miR-125b, miR-125a-5p, are members of homologous tricistronic clusters involved in stem and progenitor cell homeostasis [37]. [score:1]
[1 to 20 of 4 sentences]
57
[+] score: 8
Therefore, upregulation of miR-99a reduced DSB repair following IR through repression of SNF2H [71]. [score:4]
miR-99 can also mediate HR repair by regulating its target, SNF2H, which is required for recruitment of BRCA1 and RAD51 to sites of breaks. [score:4]
[1 to 20 of 2 sentences]
58
[+] score: 8
To confirm the validity of the NanoString results, we performed targeted microRNA qPCR on two targets (Figure 2c: miR-99-5p, P=3.96 × 10 [−5]; Figure 2d: mir-9-5p, P=6.23X10 [−9]). [score:5]
These four microRNAs, (mir99, [42] mir9, [43] mir30b [44] and mir92a-3p [45]) are associated with differentiation or suppression of proliferation, further supporting our hypothesis. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 7
The up-regulated miRNAs include let-7a and miR-99a and the down-regulated include miR-196a, miR-470, miR-21*, miR-208a, miR-683, miR-184, miR-693-3p, miR-202-3p, miR-429, miR-878-3p and miR-327. [score:7]
[1 to 20 of 1 sentences]
60
[+] score: 7
Kuo et al. found that MiR-99a exerts antimetastasis through inhibiting MTMR3 expression, making MTMR3 a therapeutic target for oral cancer treatment [9]. [score:6]
And a new role of MTMR3 was revealed in oral cancer last year as a downstream regulator of MiR-99a in the antimetastasis process [9]. [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 7
Torres and coworkers [29] found that the expression of miR-99a, miR-100 and miR-199b was up-regulated in plasma of EEC patients, and a combination of miR-99a and miR-199b was more accurate in distinguishing EEC disease when compared with single miRNAs. [score:7]
[1 to 20 of 1 sentences]
62
[+] score: 7
Among neoplasm with activated IGF signaling, some miRNAs acted as tumor suppressors to inhibit the expression of IGF-1 receptor (IGF-1R), such as miR-145, and miR-99a in breast cancer and HCC, respectively [10], [11]. [score:7]
[1 to 20 of 1 sentences]
63
[+] score: 7
In contrast, miR-125b-2 plays an important role as a tumor suppressor and has been shown to reduce the incidence of solid tumors in individuals with DS carrying hsa-miR-99a and let-7c (28). [score:3]
The miRNAs encoded by hsa 21 (i. e., hsa-miR-99a, let-7c, miR-125b-2, miR-155, and miR-802) have been proven to correlate with the complex and variable phenotypes of DS and were shown to be overexpressed in the heart, frontal cortex, and hippocampus of fetuses with DS as found in our study (4, 16, 17, 18, 19). [score:3]
The expressions of 14 miRNAs [i. e., human chromosome (hsa)-let-7c, hsa-mir-125b-2, hsa-mir-155, hsa-mir-3118, hsa-mir-3156, hsa-mir-3197, hsa-mir-3648, hsa-mir-3687, hsa-mir-4327, hsa-mir-4759, hsa-mir-4760-3p, hsa-mir-548x, hsa-mir-802, and hsa-mir-99a] encoded by chromosome 21 were evaluated; u6-snRNA was used as the control sample for normalization. [score:1]
[1 to 20 of 3 sentences]
64
[+] score: 7
The miR-99 family, including miR-99b-5p, regulates the DNA-damage response in breast and prostate cancer cells by targeting the chromatin remo deling factor SNF2H [30]. [score:4]
When the miR-99 cluster is over-expressed in irradiated cells, the rate and the overall efficiency of repair by both NHEJ and homologous recombination are reduced [30]. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 7
Of these 16 miRNAs, 9 were downregulated (let-7d, miR-106b, miR-122a, miR-141, miR-183, miR-195, miR-200a, miR-335, mir424) and 7 were upregulated (miR-100, miR-199a, miR-296, miR-29a, miR-29c, miR-99a, mir-494). [score:7]
[1 to 20 of 1 sentences]
66
[+] score: 7
The protective function of mTOR inhibition in HIVAN could be due to the regulation of microRNAs since rapamycin treatment reverses the downregulation of miR99a, miR-100a, miR-199a, miR-200a, miR-200b, miR-200c, miR-429, and miR-141 caused by HIV infection of human podocytes in culture (94). [score:7]
[1 to 20 of 1 sentences]
67
[+] score: 7
Similarly, miR-99a is down-regulated in psoriatic KC despite the high output of the IGF1 signaling pathway in psoriasis [4]. [score:4]
We found that miR-99a targets IGF-1R [4], a major player in KC proliferation and differentiation [12]. [score:3]
[1 to 20 of 2 sentences]
68
[+] score: 7
The most significantly upregulated human miRNAs were miR-513a-3p, miR-298, and miR-206; whereas miR-99a, miR-200 family, miR-199b-5p, miR-100, and miR-335 were the most significantly downregulated miRNAs. [score:7]
[1 to 20 of 1 sentences]
69
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127. [score:7]
[1 to 20 of 1 sentences]
70
[+] score: 7
Especially, previous study of Puerta-Gil et al. identified miR-143, miR-222, and miR-452 as tumor stratification and noninvasive diagnostic biomarkers for BC [9]; Majid et al. [10] reported that miR-23b could function as a tumor suppressor that may confer a proliferative advantage and promote bladder cancer cell migration and invasion; Wu et al. [11] also found that miR-99a could inhibit cell proliferation, migration and invasion by targeting fibroblast growth factor receptor 3 in BC. [score:7]
[1 to 20 of 1 sentences]
71
[+] score: 7
In ovarian cancer, 11 miRs were upregulated (miR-16, miR-20a, miR-21, miR-23a, miR-23b, miR-27a, miR-93, miR-141, miR-200a, miR-200b, and miR-200c) and 12 were downregulated (miR-10b, miR-26a, miR-29a, miR-99a, miR-100, miR-125a, miR-125b, miR-143, miR-145, miR-199a, miR-214, and let-7b). [score:7]
[1 to 20 of 1 sentences]
72
[+] score: 7
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In a number of single studies, miRNAs such as let-7d [26], let-7i [26] and miR-210 [23] were also found to be up-regulated in prostate cancer, in contrast to let-7g [23], miR-27b [28], miR-99a [23], miR-126 [54], miR-128 [26], miR-152 [28], miR-200a [58] and miR-449a [59] which were down-regulated in prostate cancer samples. [score:7]
[1 to 20 of 1 sentences]
73
[+] score: 7
Moreover, the upregulation of miR-142-5p, miR-221, miR-30, miR-32, miR-374, miR-99a, miR-122 and miR-101 and the downregulation of miR-145, miR-195 and miR-98 observed in JEV-infected PK-15 cells in our study have been reported in the brains of mice infected with West Nile virus (WNV), another mosquito-borne flavivirus [34]. [score:7]
[1 to 20 of 1 sentences]
74
[+] score: 6
The equivalent namesake mouse and zebrafish miRNAs of gga-mir-2188, gga-mir-99a-5p and gga-mir-142-3p have been shown to be involved in the development of the vascular system and hematopoiesis in the embryos of mice and zebrafish [15– 17]. [score:2]
Whilst in humans hsa-mir-99a and hsa-mir-92a are necessary for correct embryo development [20, 21]. [score:2]
Of the seven miRNAs three; gga-mir-30c-5p, gga-mir-99a-5p and gga-mir-100-5p have been reported to be present within chicken embryos [14]. [score:1]
Coppola A Romito A Borel C Gehrig C Gagnebin M Falconnet E Cardiomyogenesis is controlled by the miR-99a/let-7c cluster and epigenetic modificationsStem Cell Res. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 6
Other miRNAs from this paper: mmu-mir-99a, mmu-mir-99b, hsa-mir-99b
To validate that hypothesis we generated target site predictions for the human miRNA family miR-99, consisting of four different miRNAs, for all 9158 human mRNAs by training on the 10 most-abundantly expressed human miRNAs. [score:5]
We were able to successfully predict 134 out of 155 MTIs in the miRTarBase database for the miR-99 miRNA family, thereby achieving a recall value of 86.5 %. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 6
A study has demonstrated that diaporine A can inhibit non-small cell lung cancer growth by up -regulating miR-99a, which is followed by the suppression of mTOR signaling pathway to achieve its antitumor effects [17]. [score:6]
[1 to 20 of 1 sentences]
77
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
[1 to 20 of 1 sentences]
78
[+] score: 6
In the case of the miR-99b/let-7e/125a cluster, inhibition of miR-99, miR-125a and let-7e resulted in the specific upregulation of IGF1R, TNFAIP3 and IGF1R, and of ITGA4 and THBS1, respectively. [score:6]
[1 to 20 of 1 sentences]
79
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
Several microRNAs had similar expression when comparing results from the present study with those of There were nine microRNAs (bta-miR-10b, bta-miR-423-3p, bta-miR-99a-5p, bta-miR-181a, bta-miR-423-5p, bta-miR-148a, bta-miR-26a, bta-miR-192, and bta-miR-486), that were upregulated in earlier stages of life in both studies. [score:6]
[1 to 20 of 1 sentences]
80
[+] score: 6
In turn, Warth et al. carried a functional screen of 130 candidate miRs, identifying 10 miRNAs with a positive effect in Treg differentiation, of which, miR-100, miR-99a and miR-10b, also inhibited the Th17 program. [score:3]
Among these, miR-99a would also act by repressing mTOR to promote Treg differentiation, in cooperation with the constitutively expressed miR-150 [74]. [score:3]
[1 to 20 of 2 sentences]
81
[+] score: 6
Cluster1-a (let-7a-2, miR-100, miR-125b-1) and Cluster1-b (let-7c, miR-99a, miR-125b-2) are involved in HSPC (hematopoietic stem and progenitor cell) homeostasis such as self-renewal, proliferation, quiescence, and differentiation by blocking TGFβ pathway and amplifying Wnt signaling (Emmrich et al., 2014), whereas LIN28B represses let-7 to inhibit erythroid development and maintain stemness (Copley et al., 2013; Lee et al., 2013b). [score:4]
Moreover, let-7 is known to regulate hematopoietic stem cell fate along with miR-99a/100, miR-125b-1/2, and LIN28B (Copley et al., 2013; Lee et al., 2013b; Emmrich et al., 2014). [score:2]
[1 to 20 of 2 sentences]
82
[+] score: 6
Up-regulated expressions of miR-410, miR-99a, and miR-140 in early chondrogenic differentiation have been identified [34– 36]. [score:6]
[1 to 20 of 1 sentences]
83
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 5
Alterations in miRNA expression have been observed in CRC, and several dysregulated miRNAs, including miR-625-3p [8], miR-99-5b [9], miR-361-5p [10], miR-17-5p [11], miR-137 [12], miR-95 [13], miR-23a [14, 15], miR-155 [16], miR-150 [17], miR-191[18], miR-339-5p [19], miR-429 [20], miR-345 [21], miR-22 [22], miR-638 [23] and miR-138 [24], have been shown to regulate CRC cell growth, apoptosis and metastasis. [score:5]
[1 to 20 of 1 sentences]
85
[+] score: 5
Sun D miR-99 family of MicroRNAs suppresses the expression of prostate-specific antigen and prostate cancer cell proliferation Cancer Res. [score:5]
[1 to 20 of 1 sentences]
86
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
It was found that ten miRNAs were overexpressed in RIF endometrial samples, including miR-23b, miR-99a, and miR-145, whereas three were underexpressed. [score:5]
[1 to 20 of 1 sentences]
87
[+] score: 5
But the role of many other miRNAs, such as miR-100 and miR-99a, that we and Crowe et al. found to be highly expressed, have not been studied [20]. [score:3]
For miR-27b, miR-10b, miR-199a-1 and miR-99a most of the miRNA pool was contributed by 3′ addition isomiRs. [score:1]
AGO2-RIP-Seq Log2Fold (Control vs IL-1β), Q-value 1 mir-27b-3p 11Yes [21] −1, 1.43E-08 2 mir-10b-5p 2 No NS 3 let-7a-5p 9 No NS 4 mir-22-3p —Yes [43] NS 5 mir-26a-5p 5Yes [48] NS 6 mir-100-5p 14 No NS 7 let-7f-5p 18 No NS 8 mir-140-3p 1Yes [20] NS 9 mir-148a-3p —Yes [13] NS 10 mir-125a-5p — No NS 11 mir-21-5p 15Yes [13] NS 12 mir-199a-3p — No NS 13 mir-125b-5p 12Yes [13] NS 14 mir-222-3p —Yes [49] NS 15 let-7i-5p — No 1.01, 1.12E-23 16 let-7c-5p 17 No NS 17 mir-99b-5p 20 No NS 18 mir-92a-3p —Yes [50] 0.94, 4.87E-07 19 mir-99a-5p —Yes [51] NS 20 mir-92b-3p — No 1.35, 3.31E-09 NS, non-significant. [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 5
miR miRNA-Cluster in vitro Glomeruli in Biopsy Selected Validated Targets miRPath KEGG Target Pathway Higher Lower Higher Lower let-7c-5p miR-99a C+ C− DSA+ TGFBR1, HMGA2, MPL Apoptosis, PI3K-Akt-Signalling, NF-kappa B Signalling, Cell Cycle, ErbB Signalling, TGF-beta Signalling miR-28-3p None C+ C− DSA+ None found. [score:5]
[1 to 20 of 1 sentences]
89
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
This study demonstrated that eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) were highly expressed, while nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) were expressed at lower level between the follicular and luteal stages in ovine ovarian tissues. [score:5]
[1 to 20 of 1 sentences]
90
[+] score: 5
For example, miR-625, miR-103/miR-107, miR-21 and miR-301 have been found to promote CRC to invade and metastasize by stimulating multiple metastasis-promoting genes [27– 30], whereas miR-99, miR-137, miR-132 and miR-128 function as tumor suppressors to inhibit the metastasis of CRC [31– 34]. [score:5]
[1 to 20 of 1 sentences]
91
[+] score: 5
Recently, it has been shown that five miRNA genes are overexpressed in the heart and brain of people with Down syndrome [24], three of which (miR-99a, let-7c, miR-125b-2) are expressed in the inner ear [25]. [score:5]
[1 to 20 of 1 sentences]
92
[+] score: 5
However, Someya et al. showed that miR-99a overexpression by 93% or more after irradiation was associated with an elevated incidence of rectal bleeding, suggesting the radiation -induced overexpression of this biomarker could differ with individual radiosensitivity. [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
c -hsa-mir-99a was not expressed in any of the samples, yet, co -expression of two out of the three members of the cluster, which are different in sequence (and therefore cross-hybridization to the microarray was not likely to have occurred), together with CEBPA gene, supports this prediction. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
McBride et al. (2012) observed nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) with decreased expression and eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) with increased expression between the follicular and luteal stages in ovine ovarian tissues [21]. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
A number of miRNAs are involved in the development of EC dysfunction, such as upregulated miR-185 in response to high glucose milieu [28], miR-99a in LPS-stimulated [38], and miR-149 in TNF-α -induced EC dysfunction through p38MAPK [36]. [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 5
For example, in mouse, miR-99a is expressed in hair and supporting cells in the cochlea, but it is expressed only in hair cells in the vestibule [73]. [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
Other miRNAs from this paper: hsa-mir-331, hsa-mir-449a
Our previous studies also showed that lncRNA ANRIL could be a growth regulator, which promoted GC proliferation by epigenetically silencing of miR-99a/miR-449a [11]; lncRNA HOTAIR could function as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in GC [12]. [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
miRNAs expression profiles by microarray analysis have shown that the miRNAs most highly expressed in normal cervix were miR-145, miR-26a, miR-99a, let-7a, miR-143, let-7b, let-7c, miR-125b, miR-126, and miR-195, in that order [11, 18, 30, 31]. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 5
BBR was determined to suppress miR-99~125b, miR-17~92 and miR-106~25 in MM cells. [score:3]
The miR-99a~125b cluster was studied with t-anti-mirs (Antagomir) that have complete complementary antisense locked nucleic acids (LNAs) directed against mature miR-125b (anti-miR-125b). [score:2]
[1 to 20 of 2 sentences]
100
[+] score: 4
The overexpression of miR-100, let-7e, and miR-99a, which have been shown to be powerful regulators of the epithelial-to-mesenchymal transition (EMT) [28– 30], was found in the mesenchymal tumor subtype. [score:4]
[1 to 20 of 1 sentences]