sort by

347 publications mentioning hsa-mir-24-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-24-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 382
Other miRNAs from this paper: hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26a-2
The miR-24 expression level was defined as upregulated when the relative expression ratio was >1, and defined as downregulated when the relative expression ratio was <1. [score:13]
Third, overexpression of miR-24 downregulated RegIV at the protein level, while downregulation of miR-24 increased RegIV protein level. [score:9]
Lal A et al. found that miR-24 inhibited cell proliferation and cell cycle progression by suppressing the expression of E2F2, MYC and other cell cycle regulatory genes by binding to “seedless” 3′UTR miRNA recognition elements [20]. [score:8]
Furthermore, we identified RegIV as a target of miR-24 and demonstrated that miR-24 regulated RegIV expression via binding its 3′ untranslated region. [score:8]
miR-24 functions as a novel tumor suppressor in GC and the anti-oncogenic activity may involve its inhibition of the target gene RegIV. [score:7]
We previously found that miR-24, which can serve as a tumor suppressor through a target site polymorphism [19], was a significantly downregulated miRNA in GC cells and tissues compared with non-tumor tissues. [score:7]
miR-24 bound with incomplete complementarity to RegIV mRNA, resulting in direct translational inhibition of RegIV mRNA but with no effect on overall mRNA stability. [score:6]
Figure 1 miR-24 is significantly downregulated in GC and inhibited SGC-7901 cell growth. [score:6]
miR-24 downregulated c-MYC expression in GC cell. [score:6]
Click here for file miR-24 downregulated c-MYC expression in GC cell. [score:6]
analysis showed that RegIV protein levels were greatly suppressed in SGC-7901/miR-24 cells, whereas RegIV protein levels were upregulated in SGC-7901/anti-miR-24 cells (Figure  4D; *P < 0.05, **P < 0.01). [score:6]
We also determined the biological effect of downregulation of miR-24 expression on GC cells. [score:6]
We found downregulation of miR-24 expression both in GC tissues and cell lines. [score:6]
As the different action modes of miRNA, miR-24 did not affect the mRNA level of RegIV but the translational inhibition. [score:5]
The clinical and pathologic characteristics of 63 GC patients are provided in Table  1. Based on relative expression ratios of miR-24/U6 = 1, the cases were divided into two groups: the miR-24 high -expression group (n = 29) and the miR-24 low -expression group (n = 34). [score:5]
Upon upregulation of miR-24, the percentage of cells in G0/G1 phase increased from 40.51% ± 3.15% in controls to 72.24% ± 3.65% (P < 0.01), while knockdown miR-24 reduced the percentage of cells in G0/G1 phase from 42.35% ± 2.78% in controls to 30.25% ± 1.25% (P < 0.05). [score:5]
Overexpression of miR-24 inhibits the migration and invasion of GC cells. [score:5]
We hypothesize that miR-24 can regulate the invasion and metastasis of GC cells by directly targeting the RegIV gene. [score:5]
The opposite result was obtained when the expression of miR-24 was inhibited by anti-miR-24. [score:5]
Ectopic expression of miR-24 in SGC-7901 GC cells suppressed cell proliferation, migration and invasion in vitro as well as tumorigenicity in vivo by inducing cell cycle arrest in G0/G1 phase and promoting cell apoptosis. [score:5]
First, overexpression of miR-24 decreased the activity of a luciferase reporter gene containing the 3′UTR of RegIV, while mutation of the “seed region” sites in the 3′UTR of RegIV abolished the regulatory effect of miR-24. [score:5]
TargetScan, miRBase Tatget and StarBase were applied to search for potential targets of miR-24. [score:5]
Among the predicted targets, RegIV was identified as one of the target genes of miR-24, and we identified one potential miR-24 binding site within its 3′UTR (Figure  4A). [score:5]
Overexpression of miR-24 inhibits GC cell proliferation. [score:5]
Next, we examined the expression of RegIV in nine GC cells and GES-1. We found that RegIV was overexpressed in nine GC cells compared with GES-1, and exhibited an inverse expression pattern compared with miR-24 (Additional file 2: Figure S2A and S2B). [score:5]
To assess whether tumor growth inhibition in SGC-7901/RV-miR-24 cells was partly due to the suppression of proliferation, immunohistochemical analyses of tumor tissues were performed. [score:5]
Wu J et al. reported that transfection of miR-24 into GC cells reduced the expression of AE1 protein, which resulted in inhibiting cellular proliferation [32]. [score:5]
The hsa-miR-24 mimics (miR-24), negative control (miR-control), hsa-miR-24 inhibitor (anti-miR-24) and inhibitor negative control (anti-miR-control) oligonucleotides were purchased from GenePharma. [score:5]
The average expression level of miR-24 was significantly downregulated in tumor tissues compared to matched non-tumor tissues (Figure  1C). [score:5]
We provided detailed mechanistic experimental evidence for the role of miR-24 in GC by suppressing the expression of RegIV. [score:5]
Expression of miR-24 was generally downregulated in nine GC cell lines compared with the immortalized normal gastric mucosal epithelial cell GES-1 (Figure  1A). [score:5]
Overexpression of miR-24 inhibits tumorigenicity in vivo. [score:5]
The expression level of RegIV as determined by was lower in the tumor derived from cells overexpressing miR-24 than the tumor derived from control cells (1.77 ± 0.15 ng/ml in SGC-7901/RV-miR-24 vs. [score:5]
These results support the notion that downregulation of miR-24 resulted in increased protein levels of RegIV in GC. [score:4]
Overexpression of miR-24 inhibited the growth rate of SGC-7901 cells compared with miR-control transfected cells (P < 0.05), whereas anti-miR-24 increased cell growth activities (P < 0.05, Figure  1D). [score:4]
Cell migration and invasion assays showed that overexpression of miR-24 suppressed cell migration (SGC-7901/miR-24 group, 63.0 ± 3.6 cells per field; control group, 126.3 ± 7.0 cells per field; P < 0.05) and invasion (SGC-7901/miR-24 group, 34.7 ± 2.1 cells per field; control group, 63.7 ± 3.5 cells per field; P < 0.05) (Figure  2A,B). [score:4]
All these results indicate that RegIV might be a direct target gene of miR-24 in GC. [score:4]
We found that miR-24 downregulated RegIV and c-MYC (Additional file 4: Figure S4A and S4B). [score:4]
Together, these results provided strong evidence that miR-24 was significantly downregulated in GC. [score:4]
Studies showed that miR-24 may act as oncogene in malignant effusions [26], oral carcinoma [27, 28], prostate cancer [3] and lung cancer [29, 30], but may act as a tumor suppressor in colon cancer [19] and retinoblastoma tumors [31]. [score:3]
Figure 5 miR-24 inhibited tumorigenicity and proliferation in vivo. [score:3]
However, the miR-24 expression level did not show any relationship with age, gender, tumor site, the depth of local invasion, lymph node metastasis, or TNM stage. [score:3]
To more closely examine the mechanisms of miR-24 in GC, we searched for candidate target genes by bioinformatics. [score:3]
As shown with Ki-67 antigen staining, the decreased tumor growth in mice injected with SGC-7901/RV-miR-24 cells may be partially because of lower proliferation caused by the overexpression of miR-24. [score:3]
At first, ectopic expression of miR-24 in SNU-16 cells was confirmed by qRT-PCR. [score:3]
Furthermore, we identified RegIV (regenerating islet-derived family, member 4) as one of the target genes of miR-24. [score:3]
SGC-7901 cells were spin infected at 1500 rpm for 0.5 h at room temperature and the virus-containing supernatant was removed after 2 h. Positive cells were selected by GFP expression by FACS and named as RV-miR-24 or RV-miR-control. [score:3]
Ectopic expression of miR-24 in SGC-7901 cells was confirmed by qRT-PCR. [score:3]
miR-24 targeted RegIV in SNU-16. [score:3]
Second, human GC tissues expressed significantly lower levels of miR-24 than non-tumor tissues, while GC tissues contain significantly higher levels of RegIV protein than non-tumor tissues. [score:3]
At 24 h later, cells were transfected with 200 ng of either pMIR/RegIV or pMIR/RegIV/mut, together with 2 ng of the pRL-TK vector (Promega, Madison, WI, USA) containing Renilla luciferase and 60 pmol of the miR-24 mimic, inhibitor or control. [score:3]
Overexpression of miR-24 in SGC-7901 GC cells significantly reduced proliferation and invasion both in vitro and in vivo, revealing the potential therapeutic effect of miR-24 in GC. [score:3]
RegIV is a target gene of miR-24. [score:3]
Click here for file miR-24 targeted RegIV in SNU-16. [score:3]
Our report identified miR-24 as a candidate tumor suppressor in GC. [score:3]
Together these results suggest that miR-24 may function as a tumor suppressor in human GC. [score:3]
The relationship between miR-24 expression level and clinicopathologic parameters was explored by the Pearson X [2] test. [score:3]
Meanwhile, we detected the expression of c-MYC in GC cells as positive control transfected with miR-24 [20]. [score:3]
We next examined the correlations between expression level of miR-24 and clinicopathologic factors in human GC. [score:3]
In this study, we demonstrated the inhibitory effects of miR-24 on tumor metastasis at the clinical, cellular and molecular level and in an experimental animal mo del. [score:3]
Furthermore, our evidence suggests the possibility for miR-24 as a therapeutic target in GC. [score:3]
Fourth, overexpression of miR-24 was significantly related with proliferation and metastasis, indicating a functional overlap with RegIV. [score:3]
We found that RegIV and miR-24 exhibited an inverse expression pattern in GC tissues (Table  2). [score:3]
These findings suggest the possibility for miR-24 as a therapeutic target in GC. [score:3]
To further elucidate the mechanism of miR-24 -mediated growth inhibition of GC cells, cell cycle analysis was performed (Figure  3C,E). [score:3]
Figure 2 miR-24 inhibited migration and invasion of SGC-7901 cells. [score:3]
Overexpression of miR-24 promotes the apoptosis of GC cells and induces cell cycle arrest in G0/G1 phase. [score:3]
Expression of miR-24 transfected with miR-24 mimics was about 50 times higher than that of miR-control group in SNU-16 (P < 0.01), while no statistical difference with the transfection of anti-miR-24 (Additional file 3: Figure S3A). [score:3]
Figure 4 miR-24 targeted the 3′UTR of RegIV gene and immunostaining of RegIV in gastric tissues. [score:3]
Expression of miR-24 was confirmed by qRT-PCR. [score:3]
To validate the transfection efficiency of miR-24 mimics and inhibitor in SGC-7901. [score:3]
At 24 h post-transfection with miR-24 mimics, inhibitors and controls (100 nM), SGC-7901 cells were incubated in serum-free medium for 24 h, and then 3 × 10 [4] cells in 200 μl serum-free medium were added to the upper chamber. [score:3]
In this study, we identified RegIV as a target gene of miR-24. [score:3]
Click here for file To validate the transfection efficiency of miR-24 mimics and inhibitor in SGC-7901. [score:3]
The miR-24 low -expression group exhibited significantly lower tumor differentiation (P = 0.021). [score:3]
miR-24 was significantly downregulated in GC tissues compared with matched non-tumor tissues and was associated with tumor differentiation. [score:3]
To explore the expression of miR-24 in GC, quantitative real-time RT-PCR (qRT-PCR) was performed. [score:3]
To assess the clinical relevance of these findings, we examined the correlation between the expressions of RegIV and miR-24 in GC tissues. [score:3]
Expression of miR-24 was examined further with qRT-PCR in tumor tissues and matched non-tumor tissues from 63 GC patients (Figure  1B). [score:3]
For each cultured 293 T plate (10 cm), a plasmid mixture containing 10 μg of miR-24 retroviral vector, 10 μg of gag/pol vector and 10 μg of VSVG vector was co -transfected with 90 μl FuGENE6 transfection reagent (Roche, Basel, Switzerland) added directly to 0.6 ml of serum-free medium. [score:2]
In the current study, we identified miR-24 as a potential upstream regulator of RegIV. [score:2]
These results strongly indicated that the 3′UTR of RegIV contains direct binding sites for miR-24. [score:2]
RegIV-mut indicates the RegIV-3′UTR with mutation in miR-24 -binding sites. [score:2]
The expression of miR-24 in GC tissues compared with matched non-tumor tissues and GC cells was detected by qRT-PCR. [score:2]
Synthetic short single or double stranded RNA oligonucleotides and lentiviral vectors were used to regulate miR-24 expression in GC cells to investigate its function in vitro and in vivo. [score:2]
Here we showed that miR-24 could regulate the carcinogenesis of GC through modulating proliferation, migration and local invasion. [score:2]
In this study, we analyzed miR-24 expression levels in GC tissues compared with matched non-tumor tissues, and assessed correlations between miR-24 level and clinicopathologic parameters. [score:2]
Anti-miR-24 increased the expression of RegIV compared with the anti-miR-control (*P < 0.05, **P < 0.01). [score:2]
Next we examined miR-24 regulation of RegIV mRNA and protein levels in transfected SGC-7901 cells. [score:2]
In contrast, knockdown of miR-24 significantly increased cell migration (SGC-7901/anti-miR-24 group, 182.3 ± 5.0 cells per field; control group, 105.3 ± 3.8 cells per field; P < 0.01) and invasion (SGC-7901/anti-miR-24 group, 124.3 ± 3.8 cells per field; control group, 62.7 ± 2.5 per field; P < 0.01) (Figure  2A,C). [score:2]
SGC-7901/RV-miR-24 and SGC-7901/RV-miR-control cells were injected subcutaneously into four-week-old male nude mice, and tumor formation was monitored. [score:1]
Further studies are required to fully understand the detailed mechanisms of miR-24 in GC carcinogenesis and as a potential therapeutic approach. [score:1]
Retrovirus -mediated SGC-7901/miR-24 and SGC-7901/miR-control stable cell lines were obtained as described in the section. [score:1]
Therefore, the tumorigenicity of SGC-7901/RV-miR-24 cells were significantly reduced in vivo. [score:1]
The opposite result was obtained when we used anti-miR-24. [score:1]
The relative expression ratio of miR-24 in each paired tumor and non-tumor tissue was calculated using the 2 [-ΔΔCT] method. [score:1]
Given that miR-24 improved the proliferation of GC cells in vitro, we examined whether miR-24 could affect tumorigenicity in vivo. [score:1]
We evaluated the influence of overexpression of miR-24 on the growth and apoptosis of SGC-7901 GC cells both in vitro and in vivo. [score:1]
Accumulating evidence suggests miR-24 plays important roles in human carcinogenesis. [score:1]
This study examined the role of miR-24 in gastric cancer (GC). [score:1]
A total volume of 100 μl of cells (2 × 10 [6] cells) transfected with RV-miR-24 or RV-miR-control were inoculated subcutaneously into 4-week-old male nude mice (Institute of Zoology, Chinese Academy of Sciences, Shanghai, China). [score:1]
Figure 3 miR-24 induced cell apoptosis and G0/G1 cell cycle arrest. [score:1]
However, the complete underlying mechanisms for miR-24 in GC are still not clear. [score:1]
We found that approximately 12–15% of SGC-7901/miR-24 cells exhibited morphologic features typical of apoptosis, including condensed chromatin and nuclear fragmentation by Hoechst33342 staining for DNA content. [score:1]
Given that observed cellular growth may be affected by the rates of apoptosis and cell cycle progression, we examined the effects of miR-24 on apoptosis and cell cycle in vivo by flow cytometry. [score:1]
Likewise, anti-miR-24 increased the luciferase activity of wild-type Luc-RegIV, but had no effect on Luc-RegIV-mut plasmid (Figure  4C; P < 0.05). [score:1]
The mutant RegIV-3′UTR was designed to mutate three intermittent nucleotides complementary to the miR-24 seed region. [score:1]
A 600 bp fragment of the wild-type (WT) RegIV-3′UTR or mutant RegIV-3′UTR (mut) containing the putative miR-24 binding site was synthesized by RT-PCR. [score:1]
In contrast, after accounting for the rare spontaneous apoptosis in SGC-7901 cells, the SGC-7901/anti-miR-24 group did not show any significant changes by Hoechst33342 staining (Figure  3A). [score:1]
Tumors grew slower in the SGC-7901/RV-miR-24 group than those in the SGC-7901/RV-miR-control group (Figure  5A). [score:1]
The percentage of Ki-67-antigen -positive cells was lower in the tumor derived from SGC-7901/RV-miR-24 cells than the tumor derived from SGC-7901/RV-miR-control cells (37.1% ± 3.6% vs. [score:1]
The genomic region that included the primary transcript of miR-24 was cloned into the EcoRI-XhoI site of the modified pMSCV-GW-RfA-PGK-EGFP retroviral vector. [score:1]
[1 to 20 of 112 sentences]
2
[+] score: 350
Thus, the miR-24 suppression of DHFR expression was most likely regulated at the translational level independent of p53 status. [score:8]
The loss of miR-24 function target site polymorphism that results in DHFR over expression, increased cell proliferation and transformed immortalized cells suggests a novel role for miR-24 as a tumor suppressor miRNA. [score:7]
There was no reduction in DHFR mRNA expression associated with miR-24 overexpression, whereas the decreased expression of DHFR by siRNA was clearly caused by mRNA degradation (Fig 3D, E). [score:7]
We next tested whether cells expressing a mutant miR-24-target site allele (C→T) that over expresses DHFR provides cells with a growth advantage. [score:7]
Overexpression of miR-24 down regulated DHFR expression, reduced anchorage -dependent growth, and induced morphological changes resembling differentiation. [score:6]
0008445.g004 Figure 4Overexpression of miR-24 down regulated DHFR expression, reduced anchorage -dependent growth, and induced morphological changes resembling differentiation. [score:6]
Overexpression of miR-24 down regulated DHFR expression, reduced anchorage -dependent growth, and induced differentiation-like morphological changes in a colorectal cancer cell line. [score:6]
These data support the notion that miR-24 functions as a p53-independent anti-proliferative miRNA and reexpression of miR-24 may constitute a novel approach to arrest tumor development, at least in part by modulating DHFR expression. [score:6]
Overexpression of miR-24 down regulated DHFR expression, reduced anchorage -dependent growth, and induced differentiation-like morphological changes in a colorectal cancer cell lineWe quantitated DHFR protein levels, morphological changes, and anchorage -dependent growth upon transfection of a siRNA specific to DHFR and miR-24. [score:6]
Ectopic expression of miR-24 significantly increased the expression of p53 protein and p21 protein levels in HCT-116 (wt-p53) cells (Fig. 2C). [score:5]
MiR-24 overexpression, independent of p53-function, inhibits anchorage dependent cellular proliferation and induces G2/S arrest MiR-24 is a highly conserved miRNA among species (Fig. S1). [score:5]
We have previously shown that miR-24 has a target site in the 3′UTR of DHFR mRNA and a miR-24- SNP results in loss of miR-24 -mediated inhibition of DHFR, in MTX resistance, and is associated with an increase in DHFR mRNA and protein [22]. [score:5]
In this report we demonstrate that miR-24, an abundant miRNA that is expressed at high levels in differentiated cells, has an anti-proliferative effect and mediates inhibition of the cell cycle independent of p53 and p21 function. [score:5]
Over expression of miR-24 may affect expression of other proteins while the miR-24-TS-SNP phenotype has a more DHFR-specific effect. [score:5]
Overexpression of miR-24 suppressed cellular proliferation in all of the cell lines independent of p53 status (Fig. 1A–G) (p<0.05, standard deviations are plotted as error bars on the graph). [score:5]
Transfection of the DHFR-specific siRNA in miR-24-TS-SNP expressing cells reduced the soft agar colony forming ability of the cells to threefold (Fig. 5E), suggesting that anchorage independent growth was specific to increased DHFR expression. [score:5]
We demonstrated earlier that a miR-24 target site SNP 829C→T (miR-24-TS-SNP) in the DHFR 3′ UTR results in DHFR overexpression due to loss of miR-24 function (22). [score:5]
To further analyze the cell cycle control genes involved in miR-24 overexpression, we analyzed p53 and p21 expression by immunoblotting in HCT-116 (wt-p53), U-2OS (wt-p53) and HCT-116 cells (null-p53) (Fig. 2C–E). [score:5]
Since miR-24 overexpression is associated with differentiation (see introduction for detail) (Fig. 1 and 4), we suggest that the slow growth and differentiation caused by miR-24 overexpression contributes to MTX resistance. [score:5]
Expression of DHFR in S-phase is required for DNA biosynthesis; this is consistent with the finding that the expression level of miR-24 was high in G1 and G2/M but low in S phase [23]. [score:5]
Overexpression of miR-24 clearly decreased the expression of DHFR protein, with a potency that was comparable to control DHFR-siRNA, independent of the presence of functional p53. [score:5]
It has been reported recently that miR-24 can suppress the expression of E2F2, Myc and other cell cycle control genes and trigger cell cycle arrest [23]; however cell lines used were either mutant or p53 deleted [23]. [score:5]
cancer tissue using miRNAMap-2 [26], and found that miR-24 levels were frequently upregulated in normal but down regulated in cancer cell line/tumor samples (Fig. 6A). [score:5]
We demonstrate that miR-24 regulates cellular proliferation, independent of p53 function, by regulating DHFR expression. [score:5]
In contrast, a nonspecific-miR (neg) and oligofectamin (oligo) did not cause an increase in expression of p53 or p21 (Fig. 2C, D), suggesting that miR-24 -mediated induction of p53 and p21 is specific to miR-24 expression. [score:5]
We next inoculated the miR-24-TS-SNP expressing NIH3T3 cells and vector alone expressing NIH3T3 cells subcutaneously on to the back of nude mice and tumor formation was monitored. [score:5]
A recent report also showed that miR-24 suppressed the expression of cell cycle control genes E2F2 and Myc via binding to 3′-UTR miRNA recognition elements [23]. [score:5]
Taken together these data indicate that miR-24 is an important regulator of cell proliferation and reexpression of miR-24 may have therapeutic anticancer value. [score:4]
We reasoned that miR-24 -mediated down regulation of DHFR may explain the anti-proliferative effect conferred by miR-24 expression. [score:4]
MiR-24 overexpression induces methotrexate resistanceGenerally, MTX treatment inhibits proliferation of rapidly dividing cancer cells without having a limited effect on the proliferation of differentiated cells. [score:4]
Similarly, our work shows that over expression of DHFR leads to increased cellular proliferation and transformation of immortalized cells, and is regulated, at least in part, by miR-24 miRNA. [score:4]
Of clinical significance, miR-24 is deregulated in colorectal cancers from patients; 45% of the patients tested had down regulated miR-24 expression in colorectal cancers as compared to the adjacent normal tissue. [score:4]
MiR-24 is also deregulated in Hodgkin lymphoma cell lines [18], and inhibition of miR-24 in Hela cells markedly increased cell growth [19]. [score:4]
MiR-24 overexpression also induced p53 and p21 expression in the U2-OS osteosarcoma cell line (Fig. 2D). [score:4]
Furthermore, to confirm that transformation was due to high levels of DHFR, we next explored the effect of DHFR knock down in the miR-24-TS-SNP expressing cells using a siRNA specific to DHFR. [score:4]
We previously demonstrated that a loss of miR-24 function polymorphism results in methotrexate resistance as a consequence of increased levels of DHFR mRNA and protein due to loss of translational regulation [22]. [score:4]
MiR-24 regulates the G2/S phase of the cell cycle independent of p53 and p21 function, which in part can be explained by its ability to regulate DHFR translation. [score:4]
The miR-24-TS-SNP expressing cells had on average a nineteen-fold increase in DHFR mRNA, and four to five fold increase in levels of DHFR protein as compared to wild type DHFR expressing cells [22]. [score:4]
MiR-24 overexpression, independent of p53-function, inhibits anchorage dependent cellular proliferation and induces G2/S arrest. [score:4]
There are many reports that demonstrate that miR-24 over expression is associated with a differentiated phenotype (see introduction for detail). [score:3]
To test this hypothesis the effect of miR-24 overexpression on MTX resistance was tested. [score:3]
In summary we propose a novel role for the miRNA miR-24 as an anti-proliferative miRNA, independent of p53 function, by showing that it targets a pro-proliferation gene DHFR. [score:3]
We demonstrate that a loss of function- miR-24 target site polymorphism in the DHFR 3′UTR induces anchorage-independent growth in vitro and renders immortalized cells tumorigenic in nude mice. [score:3]
cancer tissue and found that miR-24 is expression was clearly detectable in normal cell lines/tissues but is down regulated in cancer cell line/tumor samples, as compared to the control cells/tissues (column 1, miR-24-1; column 2, miR-24-2). [score:3]
The ability of wt, miR-24-TS-SNP and vector alone expressing cells to form colonies was tested. [score:3]
As MiR-24 transfection has been shown to induce differentiation in cells, we anticipated that miR-24 overexpression would confer resistance to antiproliferative drugs such as MTX. [score:3]
A miR-24 target site SNP in dihydrofolate reductase 3′UTR confers an ability on immortalized cells to form foci and growth in anchorage-independent fashion. [score:3]
A miR-24 target site SNP in dihydrofolate reductase 3′UTR confers an ability on immortalized cells to form foci and growth in anchorage-independent fashionDHFR is an S-phase enzyme and its levels are associated with cell proliferation. [score:3]
A loss-of-function miR-24 target site SNP contributes to cellular transformation. [score:3]
Alternatively it can be anticipated that a miR-24-TS-SNP that can create miRNA -mediated repression of tumor-suppressor genes may also have an ability to transform the cell [27]. [score:3]
Of interest, we found that a miR-24 target site (TS) SNP 829C→T (hereafter referred as miR-24-TS-SNP) in the DHFR 3′ UTR results in loss of miR-24-function and high DHFR levels in the cell, and imparts a growth advantage to immortalized cells and induces neoplastic transformation. [score:3]
The nonspecific control miR had no effect on cellular proliferation, suggesting that miR-24 mediated inhibition of cellular proliferation is miR-24-specific. [score:3]
This finding, together with the cell proliferation results (Fig. 1), confirmed that miR-24 mediated inhibition of the cell-cycle is independent of p53 function. [score:3]
Further we tested mir-24 expression in colorectal cancer tumors obtained from patients. [score:3]
MiR-24 was also found to be upregulated during the stationary phase of growth in CHO-K1 cells [16], and in sodium butyrate differentiated embryonic stem cells [17]. [score:3]
Sample with the lowest Δ C [T] value of miR-24 was set as 1 to generate relative expression values using 2−dd CT method [37]. [score:3]
Loss of miR-24 function, due to a SNP in the 3′UTR of DHFR leads to overexpression of DHFR mRNA and protein and transformation of immortalized cells. [score:3]
In this study, we demonstrate that p21 levels in the cell are increased upon miR-24 overexpression only in the presence of p53. [score:3]
Hence DHFR overexpression due to a miR-24-TS-SNP makes NIH3T3 cells tumorigenic in nude mice. [score:3]
We demonstrate that a loss of miR-24 function-SNP that results in DHFR over expression and MTX resistance, following other events in a cell, can also predispose immortalized cells for transformation. [score:3]
We next tested if overexpressed DHFR due to the miR-24-TS-SNP can also induce anchorage independent growth in two additional rodent cell lines (NIH3T3 cells and RK3-rat kidney cells) and human breast epithelial MCF10A cells, in addition to CHO cells. [score:3]
Of interest, we observed that over expression of miR-24 rendered cells more resistant to MTX due to reduced cellular proliferation. [score:3]
MiR-24 is found to be upregulated in differentiated cells. [score:3]
Of interest, regardless of the p53 status of a cell, miR-24 inhibited cell proliferation. [score:3]
0008445.g005 Figure 5A loss-of-function miR-24 target site SNP contributes to cellular transformation. [score:3]
MiR-24 overexpression affects cell cycle control genesInduction of the p53 -dependent cell cycle checkpoint control gene p21 triggers cell cycle arrest at both G [1] and G [2] phases [24]. [score:2]
MiR-24 is deregulated in human colorectal cancer tumors and there is a subset of tumors with reduced levels of miR-24 We investigated miR -expression in normal vs. [score:2]
Upon miR-24 transfection cell proliferation was inhibited approximately from 30% to 65% at day 5 as compared to the control (p<0.05, standard deviations are plotted as error bars on the graphs). [score:2]
MiR-24 is expressed in normal tissues such as adipose tissue, mammary gland, kidney and in differentiated skeletal muscles [11]. [score:2]
MiR-24 also plays a role in erythropoiesis by regulating ALK4 and in replicative senescence by regulating p16 [20], [21]. [score:2]
MiR-24 targets DHFR, a gene associated with cell proliferation, independent of p53 function. [score:2]
In this study we used mutant and wild type p53 cell lines to study the effects of miR-24 on cell proliferation and cell cycle control and their mechanisms of regulation. [score:2]
Of possible clinical significance, we find that miR-24 is deregulated in human colorectal cancers, and subsets of tumors have reduced levels of miR-24. [score:2]
MiR-24 overexpression down regulated DHFR levels by approximately six fold as compared to Oligofectamine alone transfected cells (Fig. 4A), and conferred a morphological change resembling a differentiation-like phenotype in a colorectal cancer cell line (HCT-116-wt-p53). [score:2]
MiR-24 is deregulated in human colorectal cancer tumors and there is a subset of tumors with reduced levels of miR-24. [score:2]
MiR-24 overexpression affects cell cycle control genes. [score:2]
MiR-24 overexpression induces methotrexate resistance. [score:2]
High levels of miR-24 have been reported during post-mitotic differentiation of hematopoietic cell lines [12], during thymic development to naive CD8T cells [13] and during myoblast and neuronal differentiation [14], [15]. [score:2]
We found that cells overexpressing DHFR (>fourfold) (Fig. 5A) due to the miR-24-TS-SNP in the DHFR gene formed more colonies as compared to wt and vector alone cells (Fig. 5B, C). [score:2]
We found that the cells with the miR-24-TS-SNP formed more colonies in soft agar and acquired an anchorage-independent phenotype with a six to seven fold increased efficiency as compared with the vector alone cells and three fold more than the cells that overexpressed wt DHFR with a wt 3′ UTR (Fig. 5D). [score:2]
MiR-24 inhibits anchorage -dependent cell proliferation independent of p53 status in six different cancer cell lines. [score:2]
MiR-24 regulates cell proliferation by regulating DHFR levels, independent of p53 status. [score:2]
0008445.g003 Figure 3 MiR-24 regulates cell proliferation by regulating DHFR levels, independent of p53 status. [score:2]
We demonstrate that miR-24 levels are deregulated in tumors obtained from colorectal cancer patients. [score:2]
0008445.g001 Figure 1 MiR-24 inhibits anchorage -dependent cell proliferation independent of p53 status in six different cancer cell lines. [score:2]
Deregulations of both miR-24 sites were found to be associated with CLL [8]. [score:2]
MiR-24 has a target site on DHFR 3′-UTR [22]. [score:2]
Although miR-24 transfection resulted in approximately 70% reduction in cell proliferation, approximately 12% of the total transfected cells, and 38% of total surviving cells, showed a differentiation-like phenotype. [score:1]
A) miR-24 stem-loop precursor is shown (B) miR-24 are well conserved among species, from mouse to humans. [score:1]
The wt DHFR, miR-24-TS-SNP and vector alone constructs were stably transfected into the three cell lines. [score:1]
Transfections of miR-24 and siRNAsR KO, HT-29, U2-OS, MG63, HCT-116 (wt-p53) and HCT-116 (null-p53) cells (2×10 [5]) were plated in six-well plates and transfected with 100 nM of either miR-24 or non-specific miRNA (Ambion) after 24 h by Oligofectamine (Invitrogen) according to the manufacturer's protocols. [score:1]
We used HCT-116 (wt-p53) cells transfected with a miR-24 mimic or non-specific miRNA, or siRNA against DHFR. [score:1]
The effect of miR-24 on the cell cycle was analyzed by flow cytometry using HCT-116 (wt-p53) and HCT-116 (null-p53) cells transfected with a nonspecific control miR or miR-24. [score:1]
To confirm this hypothesis, a miR-24 precursor was transfected into cells of varying p53 function: HCT-116 (wt-p53), U2-OS (wt-p53), and HCT-116 (null-p53). [score:1]
HCT 116 (wt-p53) cells were plated in 96-well plates at 1×10 [3] cells/well in triplicate after transfected with miR-24 mimic, non-specific miRNA, or siRNA against DHFR in 100 µl of medium. [score:1]
At 48 h after transfection with miR-24 mimic or non-specific miRNA, the cells were scraped and lysed in RIPA buffer (Sigma). [score:1]
Although miR-24 transfection reduced HCT-116 cell-proliferation by 70% (mostly cytotoxic effect), approximately 12% of the total transfected cells and 38% of the total surviving cells showed morphological changes that resembled differentiation (Fig. 4C). [score:1]
MiR-24 regulates dihydrofolate reductase, a gene associated with cell proliferation, independent of p53 function. [score:1]
MiR-24 clusters with two other miRNAs, miR-23 and miR-27, on chromosome 9 (cluster-1: miR-23b, miR-27b and miR-24-1) and on chromosome 19 (cluster-1: miR-23a, miR-27a and miR-24-2). [score:1]
Since differentiation markers for colorectal cancer cells are not well established, following miR-24 transfection we used light-microscopy to quantitate the morphological changes in HCT-116 cells [34]. [score:1]
R KO, HT-29, U2-OS, MG63, HCT-116 (wt-p53) and HCT-116 (null-p53) cells (2×10 [5]) were plated in six-well plates and transfected with 100 nM of either miR-24 or non-specific miRNA (Ambion) after 24 h by Oligofectamine (Invitrogen) according to the manufacturer's protocols. [score:1]
We quantitated DHFR protein levels, morphological changes, and anchorage -dependent growth upon transfection of a siRNA specific to DHFR and miR-24. [score:1]
The miR-24-TS-SNP 829C→T occurs at a 14.2% allelic frequency in the Japanese population, and may predispose cells for cellular transformation following other events in a cell. [score:1]
CHO DG44 cells were transfected with either DHFR cDNA containing the wt 3′UTR, or DHFR cDNA with the miR-24-TS-SNP in the DHFR 3′UTR. [score:1]
0008445.g006 Figure 6 MiR-24 is deregulated in human colorectal cancer tumors. [score:1]
HCT 116 (wt-p53) and HCT 116 (null-p53) cells were transfected with miR-24 mimic, non-specific miRNA or siRNA against DHFR described as above. [score:1]
Total RNA, including miRNA, was isolated from the miR-24 transfected cell lines (24 h after transfection) and from clinical colorectal cancer samples using TRIzol reagent, according to the manufacturer's instructions (Invitrogen). [score:1]
For cell proliferation analysis on the six cancer cell lines was performed by plating the cells in 96-well plates in triplicate at 1×10 [3] cells/well after transfection with miR-24 mimic, non-specific miRNA, or siRNA against DHFR (n = 3). [score:1]
MiR-24 is deregulated in human colorectal cancer tumors. [score:1]
Variance ratio test (F-test) was used to compare the variances of miR-24 levels in normal vs cancer tissue. [score:1]
Transfections of miR-24 and siRNAs. [score:1]
Of clinical significance, we found that miR-24 was down regulated in 45% of colorectal cancers as compared to the adjacent normal tissue. [score:1]
MiR-24 is an abundant miRNA and is well conserved between various species (Fig. S1). [score:1]
MiR-24 is a highly conserved miRNA among species (Fig. S1). [score:1]
Therefore, cells transfected with DHFR mRNA containing the miR-24-TS-SNP induced anchorage independent growth in three immortalized rodent cell lines (CHO, NIH3T3 and RK3) and an immortalized human cell line (MCF-10A). [score:1]
MiR-24 regulates dihydrofolate reductase, a gene associated with cell proliferation, independent of p53 functionDHFR is an S-phase specific enzyme and its levels in the cell are associated with cellular proliferation [25]. [score:1]
Since miR-24 is associated with differentiation, we explored the role of miR-24 in cellular transformation. [score:1]
We next determined if the effect of miR-24 on cellular proliferation was related to cell cycle control. [score:1]
[1 to 20 of 118 sentences]
3
[+] score: 330
Upregulation of miR-24 inhibits XIAP protein expression in LSCC cells, and silencing of XIAP mimics the effects of miR-24 upregulation on LSCC cells. [score:11]
Recently, miR-24 was shown to be downregulated in nasopharyngeal carcinoma (NPC) and that is inhibits NPC cell growth, promotes apoptosis, and suppresses the growth of NPC xenografts [25]. [score:8]
Additional experiments demonstrate that re -expression of miR-24 inhibits growth, enhances apoptosis, and reverses chemoresistance in LSCC cells by directly targeting XIAP. [score:8]
Furthermore, upregulation of miR-24 increased expression levels of cleaved caspase-3 (c-caspase-3), cleaved PARP (c-PARP), and decreased expression levels of total caspase-3 and PARP (Fig.   2d). [score:8]
In conclusion, our study demonstrates that miR-24 is downregulated in LSCC and re -expression of miR-24 inhibits growth, enhances apoptosis, and increases radiosensitivity in LSCC. [score:8]
Fig. 7XIAP expression is upregulated in LSCC cells and tissues and inversely correlated with miR-24 expression. [score:8]
Furthermore, LSCC XIAP mRNA expression correlated with miR-24 expression, and XIAP expression was elevated relative to that in a normal human keratinocyte cell line. [score:7]
Furthermore, miR-24 expression in LSCC tissues was higher than that in adjacent normal tissues, with XIAP expression inversely correlated with miR-24 expression. [score:7]
We calculated a △Ct (target-reference), which is equal to the difference between threshold cycles for miR-24 (target) and the threshold cycle for U6 RNA (reference) (△Ct (target-reference) = Ct target-Ct reference). [score:7]
We then observed that expression level of XIAP mRNA expression levels inversely correlated with the expression level of miR-24 in LSCC tissues (Pearson’s correlation, r = −0.508; P < 0.001; Fig.   7c). [score:7]
In addition, miR-24 upregulation increases LSCC sensitivity to irradiation by enhancing irradiation -induced apoptosis, and luciferase activity indicated that miR-24 binds to the 3′-untranslated region (3′-UTR) of XIAP mRNA. [score:6]
Upregulation of miR-24 increased expression of c-caspase-3 and c-PARP proteins in LSCC cells induced by irradiation treatment (Fig.   3d). [score:6]
In concordance with luciferase reporter results, overexpression of miR-24 downregulates endogenous XIAP protein levels in LSCC. [score:6]
Furthermore, XIAP, a member of the inhibitor of apoptosis family of proteins, was identified as a functional and direct target of miR-24. [score:6]
XIAP is upregulated in LSCC tissues and is inversely correlated with miR-24 expression. [score:6]
In addition, miR-24 expression in LSCC tissues was downregulated in comparison with that in adjacent normal tissues. [score:6]
The data also demonstrate a functional link between miR-24 and XIAP in LSCC, suggesting that XIAP may be a target of miR-24, and that abnormal miR-24 and XIAP expression may be correlated with aggressive progression of LSCC. [score:5]
Next, we analyzed the effects of miR-24 expression on apoptosis of LSCC cells following irradiation and found that miR-24 re -expression increased irradiation -induced apoptosis of LSCC cells (Fig.   3c). [score:5]
Re -expression of miR-24 inhibited growth, enhanced apoptosis, and increased radiosensitivity in LSCC cells. [score:5]
Additionally, we generated a mutant XIAP/3′-UTR reporter construct by site-directed mutagenesis of the putative miR-24 target site in wild-type XIAP/3′-UTR (pLUC/XIAP/3′-UTR-mut) using Stratagene QuikChange® Site-Directed Mutagenesis Kit (Stratagene, Hei delberg, Germany). [score:5]
MiR-24 expression is downregulated in LSCC cells and tissues. [score:5]
These results indicate that downregulation of miR-24 may play an important role in LSCC development. [score:5]
More importantly, small interfering RNA (siRNA) -mediated XIAP knockdown mimics the same effects of miR-24 upregulation on growth, apoptosis, and radiosensitivity in LSCC. [score:5]
To validate XIAP as a direct target of miR-24, we performed dual-luciferase reporter assays using a pLUC target reporter plasmid containing XIAP/3′-UTR (pLUC/XIAP/3′-UTR-wt). [score:5]
Re -expression of miR-24 inhibits growth and enhances apoptosis in LSCC cells. [score:5]
Therefore, the increased XIAP mRNA expression in LSCC tissues correlates with low-level miR-24 expression. [score:5]
Functional analyses demonstrated that re -expression of miR-24 could inhibit growth, reduce colony formation, and enhance caspase-3 -dependent apoptosis in LSCC cells. [score:5]
Our data suggest that miR-24 inhibits growth, increases apoptosis, and enhances radiosensitivity in LSCC cells by targeting XIAP. [score:5]
Therefore, re -expression of miR-24 appears to inhibit growth of LSCC cells by inducing caspase-3 -dependent apoptosis. [score:5]
In addition, XIAP mRNA expression significantly increases in LSCC tissues and is inversely correlated with miR-24 expression. [score:5]
Functional analyses indicated that re -expression of miR-24 inhibits growth, reduces colony formation, and enhances apoptosis in LSCC cells. [score:5]
Together, these data suggest that upregulation of miR-24 enhances LSCC irradiation sensitivity by increasing irradiation -induced apoptosis. [score:4]
In the present study, we show that miR-24 is downregulated in LSCC cell lines and tissue. [score:4]
Luciferase activity indicated that miR-24 inhibited signal compared with the miR-NC negative control (Fig.   4b), but had no effect on the activity of reporter vector containing the 3′-UTR of XIAP with six point mutations in the miR-24 -binding site, suggesting that miR-24 interacts directly with the 3′-UTR of XIAP mRNA. [score:4]
To test directly whether XIAP is a target of miR-24, we constructed a luciferase reporter (pLUC/XIAP/3′-UTR-wt) in which the XIAP/3′-UTR nucleotides complementary to miR-24 (nt 2301–2308) were inserted into the pLUC vector. [score:4]
s were performed to examine regulation of putative miR-24 targets. [score:4]
For ectopic expression of miR-24 or knockdown of XIAP, pGCMV/miR-24 (or pGCMV/miR-NC vector) or pSil/shXIAP (pSil/shcontrol) were purchased from GenePharm (Shanghai, China). [score:4]
Collectively, these results indicate that XIAP may be a direct target of miR-24 in LSCC. [score:4]
When combined with various doses of irradiation (0.0, 2.0, 4.0, 6.0 or 8.0 Gy), upregulation of miR-24 decreased growth of LSCC cells (Fig.   3a). [score:4]
XIAP was identified as a direct target mRNA of miR-24 by bioinformatics analysis. [score:4]
These results suggest that XIAP mRNA may be a direct target of miR-24 in LSCC. [score:4]
XIAP as a direct target of miR-24 in LSCC cells. [score:4]
Therefore, silencing of XIAP mimics the effects of miR-24 upregulation on LSCC cells. [score:4]
Fig. 2Effects of miR-24 expression on growth, colony formation, and apoptosis in LSCC. [score:3]
It has been reported that miR-24 functions as a tumor suppressor in a variety of human cancers, including tongue squamous cell carcinoma, osteosarcoma, bladder cancer, and gastric cancer [12– 15]. [score:3]
Flow cytometric analysis showed that miR-24 re -expression enhanced apoptosis in LSCC cells. [score:3]
Quantitative RT-PCR (qRT-PCR) was used to detect miR-24 expression in LSCC cell lines and tissue samples. [score:3]
However, miR-24 expression and its effects on LSCC are unclear. [score:3]
Western blot results suggest that XIAP is controlled by miR-24 in Hep-2/miR-24 (or Hep-2/miR-NC) and AMC-HN-8/miR-24 (AMC-HN-8/miR-NC) cells, as miR-24 decreased expression of XIAP protein in LSCC cells (Fig.   4c). [score:3]
Re -expression of miR-24 increases radiosensitivity in LSCC cells by enhancing irradiation -induced apoptosis. [score:3]
MiR-24 is an abundant miRNA encoded by the corresponding gene that maps to human chromosome 9q22 and 19p13 regions, which is well conserved between species and is expressed in normal tissues such as adipose, mammary gland, kidney, and differentiated skeletal muscle [11]. [score:3]
Fig. 1qRT-PCR of miR-24 expression in LSCC cells and tissue samples. [score:3]
Here, we investigated the effects of miR-24 expression on radiosensitivity of LSCC, with the results suggesting that miR-24 re -expression increased the sensitivity of LSCC to irradiation by enhancing irradiation -induced apoptosis. [score:3]
miR-24 expression levels in LSCC cell lines or tissue were significantly lower than in a normal human keratinocyte cell line or adjacent normal tissues. [score:3]
MTT, colony formation, and flow cytometry was performed to analyze the effects of miR-24 expression on growth, apoptosis, and radiosensitivity of LSCC cells. [score:3]
Thus, identification of target genes may elucidate miR-24 function and the molecular mechanisms by which it mediates LSCC progression. [score:3]
However, whether miR-24 targets XIAP to affect LSCC is poorly understood. [score:3]
a qRT-PCR detection of miR-24 expression in Hep-2 and AMC-HN-8 and HaCaT cells. [score:3]
a qRT-PCR of miR-24 expression in mock or stably transfected Hep-2 and AMC-HN-8 cells. [score:3]
b qRT-PCR detection of miR-24 expression in 15 paired LSCC and adjacent normal tissues. [score:3]
To the best of our knowledge, this is the first report to elucidate a role for miR-24 in LSCC, suggesting that reduced miR-24 plays a critical role in LSCC progression by inducing XIAP expression. [score:3]
Therefore, miR-24 may be a potential molecular target for the treatment of human LSCC. [score:3]
Here, we show that miR-24 expression in LSCC cell lines was significantly lower than that in a human keratinocyte cell line. [score:3]
Fig. 3Effect of miR-24 expression on radiosensitivity of LSCC cells. [score:3]
Our qRT-PCR results indicate that miR-24 expression in Hep-2 and AMC-HN-8 was lower than that in HaCaT (P < 0.01, Fig.   1a). [score:3]
First, other miR-24 target mRNAs need to be identified. [score:3]
These results suggest that targeting miR-24 may be a potential strategy for treating LSCC. [score:3]
c reveals an inverse correlation between relative miR-24 and XIAP mRNA expression level in LSCC tissues (n = 15; r = −0.508; P < 0.001). [score:3]
However, the role of miR-24 in LSCC development and its possible molecular mechanisms are largely unclear and remain to be further elucidated. [score:2]
The effects of miR-24 expression on LSCC growth were then examined by MTT and colony formation assays, indicating reduced growth (Fig.   2b). [score:2]
We also observed that miR-24 expression was significantly lower in LSCC tissues compared with that in the adjacent normal tissues (P < 0.01; Fig.   1b). [score:2]
Previously, Xie et al. reported that miR-24 regulates XIAP to reduce the apoptosis threshold in cancer cells [26]. [score:2]
a A human XIAP/3′-UTR fragment containing wild-type or mutant miR-24 -binding sequence was cloned downstream of the luciferase reporter gene in pLUC-luc. [score:1]
d Flow cytometric analysis of apoptosis in Hep-2 and AMC-HN-8 stably transfected with pGCMV/miR-NC or pGVMV/miR-24, respectively. [score:1]
Cells were transiently cotransfected for 24 h with reporter plasmids (200 ng) and pGCMV/miR-24 (or pGCMV/miR-NC) and harvested in reporter lysis buffer. [score:1]
Similarly, when combined with irradiation (6.0Gy), colony formation of Hep-2/miR-24 or AMC-HN-8/miR-24 cells was reduced in comparison with Hep-2/miR-NC or AMC-HN-8/miR-NC cells (Fig.   3b). [score:1]
miR-24 Laryngeal squamous cell carcinoma XIAP Growth Apoptosis Laryngeal squamous cell carcinoma (LSCC), the most common cancer of the upper digestive tract, accounts for approximately 14 % of head and neck squamous cell carcinoma (HNSCC) [1]. [score:1]
b MTT analysis of Hep-2 and AMC-HN-8 growth following stable transfection with pGCMV/miR-NC or pGVMV/miR-24, respectively. [score:1]
The aim of this study was to investigate the expression of microRNA-24 (miR-24) and its function in laryngeal squamous cell carcinoma (LSCC). [score:1]
We also generated a mutant reporter (pLUC/XIAP/3′-UTR-mut), in which the first six nucleotides in the miR-24 seed region complementary sites were mutated (Fig.   4a). [score:1]
Thus, restoration of miR-24 may be a better method for reversing radioresistance in LSCC. [score:1]
[1 to 20 of 81 sentences]
4
[+] score: 319
Other miRNAs from this paper: hsa-mir-24-2, hsa-mir-337
Mutation of the p16 CR site predicted to be targeted by miR-24 (mCR) or both the CR and 3′UTR sites (mCR+m3′) effectively abrogated this induction in EGFP expression, while mutation of only the 3′UTR (m3′) had a partial effect (∼3-fold induction), as shown in Fig. 8. These results strongly support the view that miR-24 influences p16 expression through the predicted CR and 3′UTR target sites. [score:11]
The finding that miR-24 suppresses p16 translation but does not appear to influence p16 mRNA levels agrees with growing evidence that mammalian miRNAs more commonly suppress protein biosynthesis than they promote target mRNA degradation. [score:9]
HeLa Tet-off cells were transfected transiently with a vector to express EGFP mRNA or with one of four vectors to express EGFP-p16 mRNA bearing intact miR-24 target CR and 3′UTR sequences, mutated CR (mCR), mutated 3′UTR (m3′) or both mutations (mCR+m3′), as shown in Fig. 8 (schematic). [score:8]
The notion that miR-24 might also suppress the elongation phase of p16 translation is supported by our results that ectopic miR-24 overexpression markedly reduced p16 protein levels without changing p16 mRNA levels or distribution on polysome gradients (Fig. 6D). [score:7]
By contrast, the levels of EGFP protein expressed from each transcript was markedly different: EGFP protein expressed from the control EGFP reporter was unchanged between the control and AS-miR-24 transfection groups, while EGFP expressed from the EGFP-p16 chimeric mRNA was significantly higher (∼11-fold) in the AS-miR-24 group than in the control group. [score:7]
The evidence presented here provides mechanistic support for the notion that miR-24 suppresses p16 production by inhibiting both the initiation and elongation of p16 translation. [score:7]
These findings indicated that miR-24 contributed to lowering the translation rate of p16, and suggested that a reduction in translational initiation also contributed to this inhibitory effect. [score:7]
As shown, AS-miR-24 -expressing cells exhibited a moderate but distinct shift towards the actively translating fractions, indicating that p16 mRNA associated with larger polysomes in these cells (Fig. 7D), and suggesting that translational initiation was enhanced after miR-24 levels were reduced. [score:7]
Conversely, introduction of antisense (AS)-miR-24 blocked miR-24 expression and markedly enhanced p16 protein levels, p16 translation, and the production of EGFP-p16 reporter bearing the miR-24 target recognition sites. [score:7]
Modulation of miR-24 levels by transfection of either pre-miR-24 or antisense (AS)-miR-24 directly affected p16 expression levels by altering the engagement of p16 mRNA with the translation machinery and consequently p16 biosynthesis. [score:6]
The reporter vectors used in Fig. 8 are as follows: pEGFP – parent reporter vector pTRE-d2EGFP; pEGFP-p16 – plasmid pTRE-d2EGFP-p16(CR+3′UTR), which comprises the wt p16 CR and 3′UTR [17]; pEGFP-p16(mCR) – plasmid pTRE-d2EGFP-p16(CR+3′UTR), in which the predicted p16 CR miR-24 site was mutated (m) from TCCTGGCTGAGGAGCTGGGCCA to TCCTGGCTGAGGAGCTGCGA CA by site-directed mutagenesis; pEGFP-p16(m3′ ) – plasmid pTRE-d2EGFP-p16(CR+3′UTR), in which the predicted p16 3′UTR miR-24 site was mutated (m) from GTTACTGGCTTCTCTTGAGTCA to GTTACTGGCTTCTCTTGCGGCA by site-directed mutagenesis; pEGFP-p16(mCR+m3′ ) – plasmid pTRE-d2EGFP-p16(CR+3′UTR), in which both of the predicted miR-24 target sites on the p16 CR and 3′UTR were mutated as indicated above. [score:5]
This differential distribution of miR-24 further supported the view that miR-24 might contribute to an inhibition of p16 translation in Y cells that was relieved in S cells. [score:5]
The influence of AS-miR-24 on p16 translation was further tested by employing a heterologous reporter system that studies the expression of d2EGFP (Clontech, ), a short-lived variant of EGFP which is uniquely suited for this analysis. [score:5]
Reduced p16 Expression by Ectopic Overexpression of miR-24. [score:5]
Accordingly, the data could be interpreted as evidence that miR-24 exerts pressure on translating ribosomes to abort translation and ‘drop-off’, as suggested by Petersen and co-workers [24]. [score:5]
miR-24 Appears to Suppress the Initiation and Elongation of p16 Translation. [score:5]
Here, we have identified miR-24-2 (hereafter miR-24) as a microRNA that suppresses p16 translation in cultured human cells. [score:5]
Instead, our collective results suggest that miR-24 overexpression reduces the elongation, rather than the initiation of p16 translation. [score:5]
The radiolabeled signals revealed >twofold higher nascent p16 translation in the AS-miR-24 transfection group (Fig. 7E), while the nascent translation of a control housekeeping protein (GAPDH) was unaffected. [score:5]
Increased p16 expression with replicative senescence was associated with decreased levels of miR-24, a microRNA that was predicted to associate with the p16 mRNA coding and 3′-untranslated regions. [score:5]
Supporting the possibility that p16 translation initiation was suppressed by miR-24 are data showing that a reduction in miR-24 function by AS-miR-24 caused a modest shift in p16 mRNA towards heavier polysomes (Fig. 7D). [score:5]
Collectively, our results indicate that miR-24 suppresses p16 translation in a cancer cell mo del (HeLa) and in a mo del of replicative senescence (WI-38 HDFs). [score:5]
Together with plausible changes in the rates of translational elongation, as discussed above (Fig. 4E), AS-miR-24 caused a marked elevation in p16 expression levels (Fig. 7B). [score:5]
Together, these results support the view that the miR-24-elicited suppression of p16 translation is relieved as miR-24 levels are diminished in WI-38 HDFs progressing towards senescence. [score:5]
Here, we report that the microRNA miR-24 suppresses p16 expression in human diploid fibroblasts and cervical carcinoma cells. [score:5]
Overexpression of miR-24 elevated its abundance in all of the heavy polysome fractions (Fig. 6A), a finding that agreed with miR-24's suppression of the elongation phase of mature, heavy polysomes. [score:5]
By contrast, downregulation of miR-24 (Fig. 7A) preferentially reduced miR-24 abundance in non-polysomal gradient fractions (Fig. 7C); this distribution pattern could preferentially facilitate the loading of ribosomes (initiation step) and have a lesser influence on the elongation of formed polysomes, although this hypothesis awaits experimental analysis. [score:4]
Instead, we set out to gain molecular insight into the regulation of p16 expression levels by miR-24. [score:4]
The expression levels of miR-24 in WI-38 cells were modulated in both directions, elevated by using a pre-miR-24 RNA, reduced by using an antisense (AS)-miR-24 RNA. [score:4]
First, we tested the effect of overexpressing miR-24 in HeLa cells by transfecting pre-miR-24 and monitoring its abundance in cells by RT-qPCR (Fig. 5C). [score:3]
HeLa cells were co -transfected with a plasmid that expressed HA-Ago1 and with RNAs (Ctrl siRNA or pre-miR-24 RNA) for 24 hr, following which HA-Ago1 was immunoprecipitated (). [score:3]
A list of additional targets of miR-24 is available from the authors. [score:3]
The translational influence of modulating miR-24 levels only achieves ∼3- to 5-fold differences in p16 abundance (Fig. 4), far from the magnitude of change observed with replicative senescence. [score:3]
Our results are consistent with a role for miR-24 in repressing both the initiation and elongation stages of p16 translation. [score:3]
Using HeLa cells, polysome fractionation followed by RT-qPCR analysis revealed that, similarly to WI-38 HDFs, miR-24 was localized predominantly in fractions 1 and 2, and hence dissociated from the translational apparatus (Fig. 5A). [score:3]
Ectopic miR-24 overexpression reduced p16 protein but not p16 mRNA levels. [score:3]
First, miR-24 is predicted to bind to transcripts encoding proliferative proteins such as H-Ras (not shown), proteins acting downstream of p16, like CDK6 (Supplemental Fig. S5) and E2F2 (not shown), and also p14ARF, which shares much of the p16 mRNA sequence and is thus similarly inhibited by miR-24 (Supplemental Fig. S6). [score:3]
By 48 hr after transfection, the expression of both EGFP and EGFP-p16 mRNAs remained unchanged as a function of AS-miR-24 (Supplemental Fig. S7). [score:3]
Prediction of p16 mRNA as a target of miR-24. [score:3]
However, a fraction of miR-24 was also present in association with translating polyribosomes, since puromycin treatment shifted the miR-24 distribution towards lighter gradient fractions (Fig, 5A,B). [score:3]
RT-qPCR analysis of the IP material revealed that the presence of p16 mRNA in the HA-Ago1 IP increased markedly after overexpressing miR-24 (Fig. 5D). [score:3]
Further analysis of the influence of miR-24 upon the translation of p16 was conducted by introducing an transcript antisense (AS) to miR-24. [score:3]
The p16 mRNA was predicted to be the target of miR-24 at two sites (CR and 3′UTR) after performing computational analyses using two different programs, Miranda and RNA22. [score:3]
miR-24 associates with p16 mRNA and with actively translating polysomes in HeLa cells. [score:3]
However, the miR-24 that co-sedimented with polysomal fractions did appear to associate with actively translating mRNAs, since treatment with puromycin (Puro. ) [score:3]
Similarly, other miR-24 targets such as the CDK6 mRNA showed increased association with HA-Ago1 after overepressing miR-24, while CDK6 mRNA levels remained unchanged (Supplemental Fig. S5). [score:3]
Evidence that miR-24 interacted with the p16 mRNA was then obtained using a method previously reported to study the functional effects of miRNAs on target mRNAs [29]. [score:3]
Despite the pre-senescent phenotype of these cells and their high p16 levels, miR-24 overexpression (Fig. 4A, right) markedly reduced p16 protein abundance (Fig. 4B), but not p16 mRNA levels (Fig. 4A, left). [score:3]
Since the p16 mRNA distribution profiles in polysome gradients from control and pre-miR-24 transfection groups were largely overlapping (Fig. 6D), the reduced p16 protein levels did not appear to result from lower p16 translational initiation. [score:3]
Furthermore, extended overexpression of miR-24 after a two-week period of sequential transfections, increased SA-β-galactosidase activity (Supplemental Fig. S4B), instead of decreasing it, as anticipated. [score:3]
Since AS-miR-24 elevated p16 levels in both HeLa and WI-38 cells, and p16 functions as a potent inhibitor of cell proliferation in the presence of an intact Rb pathway (such as in WI-38 cells), we hypothesized that AS-miR-24 might elicit growth arrest and possibly enhance the senescent phenotype of HDFs. [score:3]
Overexpression of miR-24 in HeLa cells did not significantly alter the relative distribution of miR-24 on polysome gradients (Fig. 6A), nor did it influence the levels of p16 mRNA in the Ctrl. [score:3]
siRNA or AS-miR-24, along with the plasmids indicated, the levels of EGFP expressed from each reporter vector was assessed; shown are representative Western blotting signals and quantification (Fold, AS-miR-24 vs. [score:3]
Heterologous Reporter Analysis of miR-24 Influence on p16 Expression. [score:3]
Conversely, overexpression of miR-24 (which reduced p16 levels, as shown in Fig. 4B), did not trigger the expected increase in proliferation, but instead reduced it (Supplemental Fig. S4A); similar findings were obtained using cervical carcinoma cells (HeLa) and liver carcinoma cells (HepG2, not shown). [score:3]
Together, our results suggest that miR-24 represses the initiation and elongation phases of p16 translation. [score:3]
miR-24 Influences p16 Expression in Young and Senescent WI-38 HDFs. [score:3]
Enhanced p16 Expression After Reducing miR-24 Function. [score:3]
The influence of these miRNAs upon replicative senescence, as well as the influence of miR-24 upon additional targets which might impact on the senescence/proliferative phenotype of WI-38, both await further analysis. [score:3]
Nonetheless, this shift occurs in the polysomal compartment (not in ligher fractons of the gradient), in agreement with the view that the translational elongation of p16 mRNA may be enhanced in the AS-miR-24 transfection group. [score:3]
It is formally possible that the changes in miR-24 levels and function (by pre- or AS-miR-24 molecules) do not affect p16 translation and instead influence the stability of p16 protein. [score:3]
The microRNA miR-24 was predicted to bind to the p16 mRNA both in the coding region (CR) and the 3′-untranslated region (UTR) (Fig. 3A), based on analysis using the Miranda and RNA22 programs ([28] Supplemental Fig. S1). [score:3]
We thus set out to investigate whether miR-24 might contribute to regulating p16 expression during replicative senescence. [score:2]
This is a less plausible mode of action for miR-24, given the paucity of evidence that p16 levels are controlled through regulated proteolysis. [score:2]
AS-miR-24 -overexpressing HeLa cells displayed modest increases in p16 mRNA levels compared with control (Ctrl. ) [score:2]
We used HeLa cells to investigate how miR-24 regulated p16 expression. [score:2]
A direct comparison of miR-24 levels in each gradient fraction showed that in Y cells, miR-24 was relatively more abundant in the heavy fractions and less in the light fractions, while in S cells, miR-24 levels were relatively higher in the light fractions and lower in the heavy, polysome -associated fractions (Fig. 3C). [score:2]
HeLa Tet-off cells (Clontech) were transfected with the parent reporter vector pTRE-d2EGFP (pEGFP), or with pTRE-d2EGFP-p16(CR+3′UTR) (pEGFP-p16), which comprises the p16 CR and 3′UTR wild-type [17] or mutated sequences of the predicted CR and/or 3′UTR miR-24 sites. [score:1]
Concomitantly Elevated p16 and Reduced miR-24 Levels in Senescent WI-38 HDFs. [score:1]
siRNA (100 nM), miR-24 and U6 snRNA levels were visualized on agarose gels (left), quantified by RT-qPCR, and normalized to 5S (right). [score:1]
siRNA -transfected populations (Fig. 7A), although the p16 mRNA half-life (>12 h) appeared unaffected by the reduced miR-24 levels (not shown). [score:1]
Synthetic 2′O-methyl antisense (AS-miR-24) or pre-miR-24 oligonucleotides (Ambion) were transfected at a final concentration of 100 nM; oligonucleotides and plasmids were transfected with Lipofectamine 2000 (Invitrogen). [score:1]
Pre-miR-24 was first introduced into late-passage cells (∼pdl 51) in order to ectopically elevate the levels of miR-24, which are naturally low in cells of advanced pdls (Fig. 3A). [score:1]
siRNA or pre-miR-24 (100 nM) and 48 hr later cytoplasmic lysates were prepared and fractionated through sucrose gradients. [score:1]
Delivery of Pre-miR-24 by using a lentiviral vector also failed to reduce the senescence phenotype (not shown). [score:1]
0001864.g003 Figure 3(A) Top, p16 mRNA depicting the two locations (in CR and 3′UTR) where miR-24 is predicted to bind. [score:1]
Thus, the relatively modest changes in p16 mediated by altering miR-24 levels are likely insufficient to recapitulate the influence of p16 changes occurring during senescence. [score:1]
However, p16 protein levels were markedly lower in the pre-miR-24 group relative to the control group (Fig. 6C). [score:1]
Top, representative miR-24 levels in each fraction, visualized after RT-PCR (30 cycles) and electrophoresis (1.5% agarose). [score:1]
Transfection of AS-miR-24 caused a small but consistent shift in the peak distribution of p16 mRNA on sucrose gradients (Fig. 4E). [score:1]
On sucrose gradients, miR-24 was found to be vastly more abundant [>70% in both Y (pdl 20) and S (pdl 54) HDFs] in fractions 1 and 2, and hence dissociated from any ribosome components (Fig. 3B). [score:1]
In fractions 1–5 (black bars), miR-24 was comparable or more abundant in S than in Y cells; in fractions 6–10 (gray bars), miR-24 was more abundant in Y than in S cells. [score:1]
Moreover, following an extended transfection protocol (cells were sequentially transfected with AS-miR-24 for two weeks), the number of cells staining positive for the senescence -associated (SA) β-galactosidase activity (a marker of replicative senescence) did not increase but instead decreased in the AS-miR-24 treatment group (Supplemental Fig. S3B). [score:1]
Forty-eight hr after transfection of HeLa cells with plasmid (V or HA-Ago1) and either control (siRNA) or pre-miR-24 RNA, RT-qPCR analysis was used to test the association of p16 mRNA with the RISC complex in the V and HA-Ago1 groups after HA IP. [score:1]
These possibilities were tested in WI-38 cells following AS-miR-24 transfection. [score:1]
siRNA or AS-miR-24, using Lipofectamine 2000; 48 hr later, cells were harvested in RIPA buffer and samples subjected to SDS-PAGE and Western blot analysis to detect EGFP and α-Tubulin. [score:1]
Lowering miR-24 increases p16 levels in HeLa cells. [score:1]
Using cycloheximide, we did not detect any influence of miR-24 on p16 protein half-life (not shown). [score:1]
Conversely, Y HDFs were transfected with AS-miR-24 in order to reduce the function of miR-24 in these populations with high endogenous miR-24 levels (Fig. 3A). [score:1]
The intervention to reduce miR-24 (Fig. 4C, right) caused no significant changes in p16 mRNA levels (Fig. 4C, left), but it strongly increased p16 protein abundance (Fig. 4D). [score:1]
Despite its reduced abundance, the remaining miR-24 showed a comparable polysome gradient distribution between the two transfection groups (Fig. 7C). [score:1]
Analysis of p16 predicted sites of miR-24 association using a heterologous reporter. [score:1]
shifted the miR-24 distribution towards lower molecular weight fractions relative to untreated (Untr. ) [score:1]
Modulation of miR-24 alters p16 levels in WI-38 HDFs. [score:1]
html) and the sequences of p16INK4A and miR-24, the program returned the two hits shown in Fig. 3A (in the CR and the 3′UTR) and in Supplemental Figure S7. [score:1]
Data (means+SD) represent the fold differences in miR-24 levels between the transfection groups. [score:1]
Note that the abundance of miR-24 was preferentially reduced in fractions 1 and 2 (left), but the remaining miR-24 was found distributed among all of the fractions of the polysome gradient (right). [score:1]
miR-24 levels decrease with replicative senescence. [score:1]
Late-passage WI-38 cells (pdl 51) were transfected with pre-miR-24 or Ctrl. [score:1]
siRNA and pre-miR-24 transfection groups (Fig. 6B). [score:1]
Briefly, HeLa tet-off cells were contransfected with 0.5 µg of plasmid pTRE-d2EGFP (with or without the binding site for miR-24) along with either Ctrl. [score:1]
Increasing miR-24 reduces p16 levels in HeLa cells. [score:1]
Next, we investigated if miR-24 directly regulated p16 protein abundance in WI-38 HDFs. [score:1]
Bottom, miR-24 levels in each fraction, quantified by RT-qPCR analysis and represented as % of the total miR-24 (semilogarithmic scale). [score:1]
0001864.g004 Figure 4Late-passage WI-38 cells (pdl 51) were transfected with pre-miR-24 or Ctrl. [score:1]
siRNA transfection group (left) and also as a percentage of the total miR-24 in each of the two transfection groups (right). [score:1]
By 48 h after transfection of 100 nM AS-miR-24, the levels of miR-24 were markedly reduced, suggesting that the RNA duplex promoted the degradation of miR-24 (Fig. 7A). [score:1]
Plasmids pTRESNeo (V, from Clontech) or pIRESNeo-HA-Ago1 (HA-Ago1, from Addgene) were transfected (2 µg per plate) to study the association of miR-24 with mRNAs in the RISC complex. [score:1]
Early-passage (pdl 20) WI-38 cells were transfected with AS-miR-24 or Ctrl. [score:1]
[1 to 20 of 109 sentences]
5
[+] score: 274
The TLRs and their associated signaling molecules have proven to be rich targets for miRNA regulation, and include miR-155, miR-21 and miR-146a targeting of TLR4 signaling [7, 8], miR-24 targeting of MD-1 [9], miR-9 and 125b targeting of the TLR4/IL-1R signaling components IRAK-1, TRAF6, IKKe and p50NF-jB [10, 11]; miR-17/20a/106a targeting of signal-regulatory protein α (SIRPα) [12], and miR-98 regulation of IL-10 production [13]. [score:14]
Overexpression of miR-24 enhanced CD206 upregulation during alternative macrophage activation and inhibited its downregulation in macrophage transitioning from alternative to classical activation states. [score:11]
Simultaneous inhibition of TNF-α and IL-6 suggests that miR-24 mediated downregulation of IL-12(p40) secretion is more likely to be due to indirect regulation, and reduced p110δ expression may be involved. [score:10]
Of the cytokines inhibited by miR-24 overexpression, only IL-12(p40) (IL12B) is predicted to be a direct target by in silico analysis. [score:8]
The observation that miR-24 is downregulated by Aa- and Pg-, but not Pg CSE-LPS can be connected, via miR-24 mediated downregulation of p110δ, to the observed reduction in cytokine secretion. [score:7]
Enhanced expression of the alternative activation marker CD206 in miR-24 overexpressing cells under conditions of alternative but not classical polarization, and during Mφ plasticity from alternative to classical activation states, suggests that miR-24 overexpression does not act simply as a ‘brake’ for classical Mφ activation, but also as an ‘indicator’ signaling intent to move forward on the road towards an alternative phenotype. [score:7]
miR-24 overexpression enhances the upregulation of CD206 in alternative but not classically activated Mφ. [score:6]
Transfection with miR-24 mimic, but not inhibitor nor control mimic, enhanced IL-4 and IL-13 induced CD206 upregulation. [score:6]
However, it is noted that while Pg-CSE-LPS induced lower levels of cytokine secretion than Pg-LPS, and miR-24 was downregulated with Pg-LPS stimulation, this hypothesis does not provide an explanation as to why Aa-LPS induced higher levels of cytokine production than Pg-LPS despite a comparable decrease in miR-24 expression. [score:6]
No CD206 upregulation was observed under conditions of classical followed by alternative activation and this was not altered by overexpression of miR-24. [score:6]
Stimulation with Ec-, Aa- or Pg-LPS, but not Pg CSE-LPS, significantly downregulated miR-24 expression relative to unstimulated control cultures. [score:6]
The ability of miR-24 to upregulate CD206 expression is indicative of its positive influence on alternative activation. [score:6]
miR-24 expression decreases PI3 Kinase p110δ expression in Mφ. [score:5]
Overexpression of miR-24 resulted in reduced expression of the Class 1A PI 3-kinase subunit p110 delta (p110δ). [score:5]
Explanations include the possibility that this effect is the result of reduced autocrine/paracrine signaling arising from reduced TNF-α/IL-6 secretion, enhanced p110α/β-specific Class IA PI 3 kinase signaling as the result of reduced competition from p110δ for binding to the regulatory subunit, or indeed the regulation and interaction of other miR-24 targets (which is potentially in the hundreds). [score:5]
This highlights the potential of miR-24 overexpression as a therapeutic for the treatment of inflammatory disease and immunopathological disorders. [score:5]
Transfection with miR-24 mimic, but not inhibitor nor control mimic, diminished the loss of CD206 expression present in cultures that had undergone alternative followed by classical stimulation. [score:5]
Non-primed, non-stimulated mature mD-Mφ were transfected with miR-24 mimic, inhibitor, or negative control mimic and expression of p110δ was assessed by western blot at 36 hours. [score:5]
It is also possible that this is mediated/enhanced by reduced receptor expression as miR-24 is predicted to target several cytokine receptors including tumor necrosis factor receptor superfamily (TNFRSF) members 11A (TNFRSF11A), 1B (TNFRSF1B), 10b (TNFRSF10B), 10d (TNFRSF10D), and 19 (TNFRSF19); also interleukin 6 receptor (IL6R), interleukin 12 receptor, beta 1(IL12RB1), and interleukin 10 receptor, beta (IL10RB). [score:5]
Overexpression of miR-24 inhibited cytokine secretion in response to LPS. [score:5]
Stimulation of macrophages with LPSs of Aa, Pg, and Pg CSE origin resulted in dissimilar levels of cytokine expression and differential expression of miR-24. [score:5]
Previously, we have published data describing miR-24 mediated inhibition of innate Mφ activation; including the reduced phagocytosis of E. coli and S. aureus bioparticles and associated cytokine production [19], reduced Protein kinase C alpha (PKCα) and NF-κB activation and associated cytokine production [9, 19], and the induction of convergent/divergent miRNA expression in Mφ stimulated with Aa-, Pg-, or Pg-CSE-LPS [18]. [score:5]
Therefore the most likely mechanism/s responsible for the observed phenotype are miR-24 suppression of a negative regulator of alternative activation or a positive regulator of classical activation. [score:5]
Thus one possible mechanism by which cigarette smoke contributes to periodontal pathology is via the modification of LPS resulting in the dysregulation of an endogenous mechanism (miR-24 downregulation) that promotes pro-inflammatory, anti-microbial cytokine secretion. [score:5]
Priming of macrophages with interferon gamma (IFN-γ) did not overcome this inhibitory effect, but classical activation of macrophages with IFN-γ plus TNF-α, TNF-β, or IL-17, modulated the pattern of miR-24 mediated suppression in a cytokine-specific fashion. [score:5]
Transfection with miR-24 mimic, but not inhibitor or control mimic, inhibited TNF-α production in positive control (no cytokine pre-treatment) and cultures pre -treated with IFN-γ, IFN-γ and TNF-β, and IFN-γ and IL-17A, but TNF-α production was restored to untransfected levels by IFN-γ and TNF-α pre-treatment (Figure 3A). [score:5]
It is also possible that miR-24 modulates expression of other PI 3-kinase family members, predicted targets of which include PIK3CG, PIK3C2A, and PIK3C2B. [score:5]
Further screening of the predicted targets of miR-24 should provide further insight on the miRNA -mediated mechanisms of IL-10 regulation. [score:4]
We now present data describing the regulatory relationship between Mφ, periodontopathic LPS, and miR-24 expression. [score:4]
The fact that miR-24 overexpression reduces not only early, pro-inflammatory cytokine production (TNF-α, IL-12p40, IL-6) but also late, anti-inflammatory cytokine production (IL-10) raise the possibility that miR-24 is regulating a single signaling molecule that participates in both the rapid and delayed TLR4 -induced signaling pathways. [score:4]
The development of cell-type specific systems of over/underexpression via promoter specificity or delivery systems featuring cell type tropism, as well as recent advancements in inducible systems, such as Tet-On/Tet-Off, should facilitate experiments that deepen our understanding of the role miR-24 plays in immunity. [score:4]
Investigation of the direct and indirect regulation of the expression of these genes by miR-24 will answer some of the mechanistic questions left standing regarding the observed Mφ phenotype. [score:4]
Mature mD-Mφ were sequentially transfected with miR-24 mimic, inhibitor, or negative control mimic for 18 hours, then treated with cytokines that promote classical Mφ activation (IFN-γ, IFN-γ and TNF-α, IFN-γ and TNF-β, IFN-γ and IL-17A) for 18 h, and then culture media was replaced with fresh media containing Aa LPS. [score:3]
PI3 Kinase p110δ was identified as a putative target of miR-24 by in silico analysis. [score:3]
Pathogen- and environment-specific modifications in LPS alter the expression of cytokines and miR-24 in human macrophages. [score:3]
Mature mD-Mφ were transfected with miR-24 mimic, inhibitor, or negative control mimic, and treated with cytokines that promote classical Mφ activation: IFN-γ and TNF-α, or alternative activation: IL-4 and IL-13 for 72 hours. [score:3]
miR-24 overexpression promotes alternative over classical activation under conditions of Mφ plasticity. [score:3]
Transfection with miR-24 mimic inhibited IL-12 (p40) production under all cultures conditions (Figure 3C). [score:3]
An unexpected, although in hindsight predictable, finding was the identification of Mφ activation state as a factor that alters specific parameters of miR-24 mediated inhibition; namely, that classical activation via IFN-γ plus TNF-α, TNF-β, or IL-17A, selectively restores LPS -induced TNF-α secretion to varying degrees. [score:3]
Notably, the ability of miR-24 to inhibit Mφ activation, pro-inflammatory cytokine production, and pathogen phagocytosis, may reduce the availability of these signals. [score:3]
miR-24 inhibits the production of pro-inflammatory cytokine production by Mφ in response to LPS from periodontal pathogens. [score:3]
Primary human macrophages were differentiated from CD14 [+] monocytes isolated from peripheral blood mononuclear cells (PBMCs) by MACS positive selection and transfected with miR-24 miRNA mimics, inhibitors, or negative control mimic; followed by stimulation with cytokines and/or LPS under various conditions representing key stages of macrophage activation. [score:3]
Transfection with miR-24 mimic, but not inhibitor nor control mimic, resulted in lower levels of IL-12p40 at both time-points in cultures stimulated with Aa-, Pg- or Pg CSE-LPS (Figure 2C). [score:3]
Our previous bioinformatic analysis of miR-24 identified numerous predicted targets with roles in intracellular signaling pathways known to be central to Mφ activation and polarization, including members of the PI-3 kinase family [9]. [score:3]
miR-24 expression at the 18 hour time-point was analyzed by RT-PCR (Figure 1D). [score:3]
While important differences were observed in the effect of miR-24 on macrophages, these data indicate that overexpression of miR-24 would be predominantly anti-inflammatory Macrophage (Mφ) activation can occur via the recognition of pathogen -associated molecular patterns (PAMPs) by pathogen-recognition receptors (PRRs, including the toll-like receptors [TLRs]) or by cytokine-receptor ligation, with nuclear factor- kappa B (NF-κB) activation being a common downstream effect of these stimuli [1]. [score:3]
The results of this study suggest that overexpression of miR-24 in Mφ may be of greater therapeutic benefit for the treatment of inflammatory disorders driven by innate vs. [score:3]
miR-24 -mediated inhibition of LPS induced cytokine production is dependent upon Mφ activation state. [score:3]
Transfection with miR-24 mimic also inhibited IL-6 production, both in positive control and IFN-γ primed cultures, but this effect was lost when IFN-γ priming was performed with the addition of TNF-α, TNF-β, or IL-17A (Figure 3B). [score:3]
To clarify, TLR4 ligation results in the induction of pro-inflammatory cytokines via a MyD88 -dependent pathway of NF-κB activation, while the induction of IL-10 by the same stimulus requires the Toll/IL-1R domain-containing adaptor inducing IFN-β (TRIF) -dependent pathway of NF-κB activation- a pathway that is inherently slower due to the involvement of autocrine/paracrine signaling by secondary-response genes, one of which is IL-27 (a predicted target of miR-24) [29]. [score:3]
Levels of IL-10 were also decreased in the classically activated groups (IFN-γ [+/−] TNF-α/TNF-β/IL-17A) relative to control mimic -transfected Mφ in-line with previous reports of mutual IFN-γ-IL-10 antagonism [27, 28], while miR-24 inhibitor had no significant effect on IL-10 levels. [score:3]
Previously, we have demonstrated an inhibitory role for miR-24 in the phagocytosis of Escherichia coli and Staphylococcus aureus bioparticles and the induction of cytokine secretion in response to lipopolysaccharide (LPS) of the same origin; also, we have identified divergent and convergent miRNA responses to LPS from the periodontopathic pathogens Aggregatibacter actinomycetemcomitams (Aa) and Porphyromonas gingivalis (Pg), and revealed cigarette smoke extract as an environmental modifier of Pg LPS structure (Pg CSE) impacting macrophage miRNA responses. [score:3]
There was a trend for higher CD206 expression in miR-24 mimic transfected cells stimulated with IFN-γ and TNF-α, but was determined to be statistically insignificant. [score:3]
Mature mD-Mφ were transfected with miR-24 mimic, inhibitor, or negative control mimic, treated with IFN-γ and TNF-α, or IL-4 and IL-13 for 24 hours, at which point media was removed and fresh media supplemented with the opposing cytokines (i. e. IFN-γ and TNF-α treatment was replaced with IL-4 and IL-13, and vice versa). [score:3]
Transfection of Mφ with miR-24 mimic reduced the relative amount of p110δ protein expression compared to controls (Figure 5). [score:2]
MiR-24 mediated inhibition of LPS -induced cytokine secretion is dependent upon macrophage activation state at the point of stimulation, and this may be due to the degree to which p110δ is involved in the intracellular signaling pathway/s that transduce receptor ligation into cytokine induction. [score:2]
MiR-24 expression was assessed by RT-PCR. [score:2]
In summary, this work adds to the body of data describing miR-24 as a negative regulator of the pro-inflammatory, anti-microbial Mφ induced by innate or classical stimuli. [score:2]
Compared to cultures transfected with miR-24 inhibitor or control mimic, or positive control (untransfected), transfection with miR-24 mimic resulted in lower TNF-α levels at the 18 hour time-point in cultures stimulated with Aa-LPS or Pg-LPS (Figure 2A). [score:2]
Here we show that miR-24 is a negative regulator of Mφ classical activation by LPS and promotes alternative activation under conditions of polarization and plasticity. [score:2]
MiR-24 mediated inhibition of IL-10 was only observed in the positive control (no classical activation) group (Figure 4). [score:2]
MiR-24 is a negative regulator of macrophage classical activation by LPS and promotes alternative activation under conditions of polarization and plasticity. [score:1]
At 96 hours post-stimulation, supernatant levels of IL-10 were significantly lower in miR-24 mimic transfected positive control cultures but not in IFN-γ and IFN-γ and TNF-β primed cultures (Figure 4). [score:1]
miR-24 is highly conserved between species, with identical human (hsa-miR-24-3p) and murine (mmu-miR-24-3p) mature sequence (UGGCUCAGUUCAGCAGGAACAG). [score:1]
Mature mD-Mφ were transfected with miR-24 mimic, inhibitor, or negative control mimic, for 18 hours, and stimulated with LPS and levels of TNF-α, IL-6 and IL-12p40 were measured by ELISA at 18 and 72 hours post stimulation. [score:1]
Similarly, transfection with miR-24 mimic resulted in lower levels of IL-6 at both time-points in Pg-LPS and Pg CSE-LPS stimulated cultures, but only at the 72 hour time-point in Aa-LPS stimulated cultures (Figure 2B). [score:1]
Pre-treatment with IFN-γ and TNF-β or IFN-γ and IL-17A resulted in levels of TNF-α in miR-24 mimic transfected cultures that were intermediate to those of IFN-γ and IFN-γ and TNF-α. [score:1]
[1 to 20 of 67 sentences]
6
[+] score: 248
Other miRNAs from this paper: hsa-mir-24-2, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a
Our study found that miR-24-3p down-regulated the expression of PRKCH in ACC by directly targeting the 3’UTR of PRKCH mRNA. [score:9]
miR-24-3p directly targets PRKCH and down-regulates its expression. [score:9]
Because miRNAs function by affecting the expression of target genes, we used an internet research tool to predict the target gene and determine the miR-24-3p target of the 3’UTR of PRKCH. [score:9]
The results showed that miR-24-3p was down-regulated (Fig 1A left panel) but PRKCH was up-regulated (Fig 1A middle panel) compared with the expression in adjacent non-tumor tissues. [score:8]
A high level of PRKCH suppresses p53/p21 expression, whereas miR-24-3p promotes the p53/p21 pathway by decreasing the expression of PRKCH. [score:7]
Our results revealed that the overexpression of miR-24-3p may promote the expression of p53/p21 via decreasing the expression of PRKCH in ACC. [score:7]
Thus, the results demonstrate that miR-24-3p directly targets the 3’UTR of PRKCH and down-regulates both its mRNA and protein levels in ACC-2 and ACC-M cells. [score:7]
To determine the target genes that mediate the effects of miR-24-3p in LACC, we used the prediction algorithms of TargetScan, PicTar and miRBase Targets. [score:7]
miR-24-3p suppresses the migration and invasion of ACC-2 and ACC-M cells and down-regulates the EMT process. [score:6]
The expression of miR-24-3p and PRKCH in the tissues allowed us to determine whether miR-24-3p directly targets the 3’UTR of PRKCH. [score:6]
miR-24 is upregulated during the terminal differentiation of multiple lineages to inhibit cell cycle progression [10, 11]. [score:6]
Furthermore, we demonstrated that miR-24-3p suppresses this proliferation, migration and invasion by down -regulating the expression of PRKCH. [score:6]
Overall, our results demonstrate that miR-24-3p suppresses proliferation, migration and invasion and promotes the p53/p21 pathway by down -regulating PRKCH expression. [score:6]
The results indicated that the overexpression of miR-24-3p suppressed the migration and invasion of ACC cells, while ASO-miR-24-3p increased the migration and invasion of ACC-2 and ACC-M cells (Fig 3A). [score:5]
miR-24 directly down-regulates mitogen-activated protein kinase (MAPK) phosphatase-7 and enhances the phosphorylation of both c-jun-NH(2)-kinase and p38 kinases [13]. [score:5]
The results showed that the overexpression of PRKCH may counteract the decreased PRKCH expression caused by miR-24-3p at the protein levels (Fig 6A). [score:5]
Next, the overexpression of PRKCH could disrupt the suppression of miR-24-3p in the migration and invasion of ACC cells (Fig 6D). [score:5]
2010; 4: 563– 9. 10 Lal A, Navarro F, Maher CA, Maliszewski LE, Yan N, O'Day E, et al miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. [score:5]
All of the results demonstrated that miR-24-3p suppressed PRKCH expression to promote the p53/p21 pathway at both the mRNA and protein levels. [score:5]
The results indicated that the overexpression of miR-24-3p suppressed the rate of colony formation. [score:5]
Next, we confirmed that miR-24-3p down-regulated the mRNA and protein levels of endogenous PRKCH. [score:4]
The EGFP reporter system and western blot results confirmed that miR-24-3p directly targeted the PRKCH. [score:4]
miR-24 regulates apoptosis by targeting the open reading frame (ORF) region of FAF1 in cancer cells [12]. [score:4]
Therefore, miR-24-3p may promote the p53/p21 pathway by down -regulating the expression of PRKCH. [score:4]
miR-24-3p affects the p53 pathway by regulating the expression of PRKCH. [score:4]
After 48 h, we tested EGFP intensity, and the results indicated PRKCH is a direct target of miR-24-3p (Fig 1C). [score:4]
Our results revealed that PRKCH was a direct target gene of miR-24-3p and decreased the p53/p21 protein levels. [score:4]
As shown in Fig 3C, the overexpression of miR-24-3p increased E-cadherin but decreased the ICAM-1 and vimentin protein levels in both ACC-2 and ACC-M cells. [score:3]
PRKCH rescues the suppression of malignant behavior mediated by miR-24-3p. [score:3]
miR-24-3p may also rescue the suppression of PRKCH on the p53/p21 mRNA levels (Fig 7D). [score:3]
In all target genes, PRKCH has a conservative miR-24-3p binding site in its 3’UTR, and the binding to this site has high specificity. [score:3]
In addition, PRKCH disrupted the suppression of molecular markers in EMT mediated by miR-24-3p in ACC (Fig 6F). [score:3]
The plasmid pri-miR-24-3p, which promotes the high expression of miR-24-3p, was constructed in our laboratory. [score:3]
Next, we explored whether the effects of miR-24-3p on malignant phenotypes were achieved due to miR-24-3p decreasing the expression of PRKCH. [score:3]
By contrast, ASO-miR-24-3p increased the expression. [score:3]
Additionally, miR-24-3p decreased the expression of PRKCH at both the mRNA and protein levels. [score:3]
These results showed that miR-24-3p suppresses the migration and invasion of ACC cells. [score:3]
PRKCH rescues the suppression of the malignant behavior mediated by miR-24-3p. [score:3]
The expression of EGFP protein in cotransfected cells w with the pcDNA3/EGFP PRKCH 3’UTR wild type with pcDNA3/pri-miR-24-3p or ASO-miR-24-3p. [score:3]
The expression of EGFP protein in cotransfected cells w with the pcDNA3/EGFP PRKCH 3’UTR mut with pcDNA3/pri-miR-24-3p or ASO-miR-24-3p. [score:3]
0158433.g006 Fig 6 (A) tested that the overexpression of PRKCH could rescue the decreased PRKCH protein induced by miR-24-3p after cotrasfection. [score:3]
The results showed that the overexpression of miR-24-3p decreased the PRKCH mRNA and protein levels. [score:3]
The plasmid ASO-miR-24-3p, which blocks the expression of miR-24-3p, was purchased from GenePharma (Shanghai, China). [score:3]
miR-24-3p suppresses the proliferation of ACC-2 and ACC-M cells and exacerbates apoptosis. [score:3]
In this study, we demonstrated that miR-24-3p displayed lower levels in ACC tumors than in adjacent non-tumor tissues and showed that miR-24-3p suppressed the proliferation, migration and invasion of ACC. [score:3]
Next, we tested the expression of molecular markers (E-cadherin, ICAM-1 and vimentin) to clarify the influences of miR-24-3p on the EMT process. [score:3]
Next, we found that miR-24-3p may rescue the suppression of the p53/p21 pathway caused by PRKCH via cotransfection assays (Fig 7B right panel). [score:2]
Next, we explored the functions of miR-24-3p in the expression of endogenous RPKCH mRNA and protein by qRT-PCR and western blot assays (Fig 1D, Fig 1E). [score:2]
The two assays showed that miR-24-3p suppressed proliferation in both ACC-M and ACC-2 cells. [score:2]
A recent study confirmed miR-24-3p had an abnormally low expression in high metastasis type of adenoid cystic carcinoma cells based on gene chip analysis and qRT-PCR assay [9]. [score:2]
0158433.g001 Fig 1. (A) qRT-PCR assays to assess the expression levels of miR-24-3p (left), PRKCH (middle) and p53 (right) mRNA in 5 pairs of LACCs (lacrimal adenoid cystic carcinomas) and adjacent non-tumor tissues. [score:2]
Flow cytometry was used to test whether miR-24-3p regulated the apoptosis of ACC-2 and ACC-M cells. [score:2]
MTT assays showed that the overexpression of PRKCH may rescue the decreased cell viability caused by miR-24-3p (Fig 6B, S4 Fig, and S5 Fig). [score:2]
The assay also revealed that the overexpression of miR-24-3p decreased the migration of both ACC-M and ACC-2 (Fig 3B). [score:2]
Although miR-24-3p and PRKCH have been shown to regulate malignant behavior in ACC, their further mechanisms have not been studied. [score:2]
PRKCH also restored the apoptosis induced by miR-24-3p (Fig 6E, S6 Fig). [score:1]
The above results showed that miR-24-3p and PRKCH had opposing functions in malignant phenotypes. [score:1]
To further assess the influence of miR-24-3p on the p53/p21 pathway via PRKCH, we tested the effect on the mRNA level by qRT-PCR. [score:1]
The fragment containing the binding sites of miR-24-3p with PRKCH 3’UTR or mutant sites (Fig 1B) was cloned into the vector pcDNA3/EGFP. [score:1]
S7 Fig (A)s to test the proliferation of the transfected cells with pSilencer-NC or shR-PRKCH and ASO-NC or ASO-miR-24-3p. [score:1]
Next, we validated the effects of miR-24-3p on the p53 pathway (Fig 7B left panel). [score:1]
The results revealed that high levels of miR-24-3p promoted the p53/p21 pathway. [score:1]
First, we tested the efficiency of the plasmids pcDNA3/pri-miR-24-3p and ASO-miR-24-3p in ACC-2 and ACC-M cells with qRT-PCR (Fig 2A). [score:1]
First, we cotransfected the plasmids wild-type or mutant pcDNA3/EGFP-PRKCH 3’UTR with miR-24-3p or AS0- miR-24-3p or the vectors in ACC cells. [score:1]
The sequence of miR-24-3p was “UGGCUCAGUUCAGCAGGAACAG”. [score:1]
Transwell chamber inserts were used to explore the effects of miR-24-3p on the migration and invasion of ACC cells. [score:1]
Conversely, ASO-miR-24-3p increased the rate (Fig 2C). [score:1]
By contrast, ASO-miR-24-3p decreased E-cadherin but increased the ICAM-1 and vimentin protein levels. [score:1]
The cells were cotransfected with the pcDNA3/EGFP PRKCH 3’UTR wild type or the pcDNA3/EGFP-PRKCH 3’UTR mut with pcDNA3/pri-miR-24-3p or ASO-miR-24-3p. [score:1]
The results showed that miR-24-3p exacerbates apoptosis in ACC-M. Taken together, these results indicate that (Fig 2D. [score:1]
First, we tested the relationship between miR-24-3p and PRKCH in tissues. [score:1]
However, few studies have been performed on the mechanism of miR-24-3p in LACC. [score:1]
[1 to 20 of 72 sentences]
7
[+] score: 245
We examined the expression of the eight most significantly upregulated miR-24 target mRNAs (from microarray) at baseline and three different time points during PPE -induced AAA development. [score:9]
Neither Chi3l1 nor miR-24 expression was significantly altered with IL-4 treatment, although there was a trend towards downregulation of Chi3l1 and upregulation of miR-24 in RAW 264.7 cells (Supplementary Fig. 5D,E). [score:9]
miR-24 remained significantly downregulated at three time points (days 7, 14 and 28; Fig. 1d), while miR-23b and miR-27b were downregulated only at day 7, supporting independent release of individual miRNAs from the cluster-transcript. [score:7]
Of all the downregulated individual miRNAs, miR-24 had the most significant negative correlation with upregulated genes (Fig. 1c) 11. [score:7]
Macrophage miR-24 expression was modulated through transfection with either an antagomiR (anti-24) to inhibit or a pre-miR (pre-24) to overexpress miR-24 (versus scrambled-miR control; scr-miR). [score:7]
All were upregulated exclusively at day 7, leaving Chi3l1 as the most compelling miR-24 target during murine AAA development. [score:7]
miR-24 downregulation was pro-inflammatory in macrophages, augmenting expression of mediators Tnf-α and Ccl2/Mcp-1 (Fig. 2h). [score:6]
miR-24 overexpression blocked Chi3l1 induction in vivo, limiting AAA expansion, while anti-miR-24 led to higher Chi3l1 expression and development of larger, rupture-prone aneurysms. [score:6]
Successful miR-24 inhibition and overexpression in vivo were confirmed by qRT–PCR (Supplementary Fig. 7C). [score:5]
Chi3l1 expression was again negatively correlated (increased) with miR-24 expression (Fig. 2c). [score:5]
Overexpressing miR-24 substantially attenuated increases in AAD, while further inhibition with anti-24 augmented AAD expansion (Fig. 4b and Supplementary Table 4). [score:5]
Chi3l1, which belongs to the chitinase-like protein family and is a potential chronic inflammatory disease biomarker 14, was the only top miR-24 target gene substantially altered at all time points, and showing a complimentary negatively correlated trend versus miR-24 (Fig. 1g,h). [score:5]
Again, miR-24 was the only member of the miR-23b-24-27b cluster to be significantly downregulated at all three time points (days 7, 14 and 28) during aneurysm development (Fig. 2b). [score:5]
We explored the regulatory role of miR-24 on inflammation and CHI3L1 expression in HEK293 and aneurysm-related cell types in vitro. [score:4]
Inflammatory stimuli downregulated miR-24 in macrophages and vascular SMCs at least partly via NF-κB. [score:4]
Anti-miR-24 transfection primarily augmented the degree of inflammatory and apoptosis-related responses rather than activating/repressing alternative pathways, suggesting that the observed miR-24 downregulation with aneurysm is pathologic rather than homeostatic. [score:4]
Furin, a proprotein convertase, has been shown to be a direct target of miR-24 in cardiac fibroblasts 19. [score:4]
In vivo (mouse), in vitro (cell culture) and ex vivo (human tissue and plasma), we identified miR-24 as a key regulator of AAA initiation and propagation, which acts in part by targeting CHI3L1 (Supplementary Fig. 9). [score:4]
As in our animal mo dels, miR-24 was significantly downregulated (−1.9±0.09-fold) in human AAA tissue (versus control). [score:4]
miR-24 and its target Chi3l1 regulate inflammation. [score:4]
Direct targeting of the CHI3L1–3′UTR by miR-24 was confirmed by transfecting HEK293 cells (ATCC) with Switchgear GoClone luciferase constructs. [score:4]
Pre-miR-24 inhibits AAA development in mouse mo dels. [score:4]
We show that both CHI3L1 treatment and miR-24 inhibition activate JNK/ERK in SMC in vitro, while pre-miR-24 decreases phospho-JNK/ERK, suggesting additional mechanistic links between miR-24/CHI3L1 regulation and AAA. [score:4]
Regulation of miR-24 through NF-κB in vitroTransfection of IL-6 -treated peritoneal mouse macrophages and RAW 264.7 cells was performed using Lipofectamine RNAiMAX (Invitrogen) reagent, and siRNA targeting either Rela (p65) or Nfkb1 (p50) subunits of the transcription factor NF-κB (Ambion). [score:4]
In both macrophage lines, anti-24 augmented the IL-6 -induced Chi3l1 increase, whereas pre-24 countered IL-6, driving Chi3l1 expression below scr-miR -treated baseline, further confirming miR-24 regulation (Fig. 2g and Supplementary Fig. 3A). [score:4]
e. m. (c) Cytokine expression in IL-6-stimulated, miR-24-modulated and si Chi3l1 -transfected hASMC. [score:3]
miR-24 expression was also visualized in the aneurysm intimal–medial region. [score:3]
In our study, plasma and tissue levels of miR-24 were significantly decreased in AAA patients, but unlike CHI3L1 these were not clear disease-severity indicators. [score:3]
IL-6 stimulation decreased miR-24 (Fig. 2i) and increased CHI3L1 expression (Fig. 3a). [score:3]
miR-24 expression and downstream effects in angiotensin II -induced AAAs and in vitro. [score:3]
miR-24 modulation inversely altered both Chi3l1 expression and Chi3l1 protein levels in peritoneal macrophages and RAW 264.7 cells. [score:3]
Further experiments on macrophage polarization, utilizing recombinant IL-4 and IL-6 stimulation of murine peritoneal macrophages, revealed that miR-24 modulation predominantly affects M1 prototypical macrophage markers, such as Il12 and Nos1 (Supplementary Fig. 5F,G), but not those of the M2 subtype, as no substantial change was observed in the expression of Il10 and Arg1 (Supplementary Figs 5H and 6A). [score:3]
Of these genes, 63 were predicted targets of miR-24 alone (Supplementary Fig. 1D). [score:3]
CHI3L1 appears to be a crucial regulator of transmural vascular inflammation in AAA and its regulation by miR-24 suggests potential therapeutic approaches. [score:3]
miR-24 expression and Chi3l1 in human AAA. [score:3]
In situ hybridization (ISH) showed diminished miR-24 expression throughout the aneurysmal aortic wall of PPE mice (versus sham and untreated controls; Fig. 1f). [score:3]
These results suggest that IL-6 (abundant in developing AAA) decreases miR-24-1 expression in macrophages, leading to a rise in Chi3l1. [score:3]
CHI3L1 (a 18-glycosyl hydrolase family member) 14 is a predicted target of miR-24 involved in acute and chronic inflammation 35 36. [score:3]
Analysis suggested Chi3l1 as an intriguing miR-24 target. [score:3]
First, via HEK293 transfection, direct suppression of CHI3L1 transcription through 3′UTR binding of miR-24 was confirmed by luciferase assay (Supplementary Fig. 2E). [score:3]
miR-24 target-genes in AAA mo dels. [score:3]
Modulation of miR-24 expression did not affect blood pressure in transduced mice (Supplementary Table 6). [score:3]
Relative expression of miR-24-1 and miR-24-2 clusters were obtained by TaqMan for pri-miR-24-1 (5′-CUCCGGUGCCUACUGAGC UGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAG-3′) and pri-miR-24-2 (5′-GCCUCUCUCCGGGCUCCGCCUCCCGUGCCUACUGAGCUGAAACAG UUGAUUCCAGUGCACUGGCUCAGUUCAGCAGGAACAGGAGUCCAGCCCCCUAGGAGCUGGCA-3′; both from Applied Biosystems). [score:3]
miR-24 modulation effects on gene expression in murine AAA. [score:3]
As in macrophages, miR-24 modulation in SMCs altered CHI3L1 expression (Fig. 3a). [score:3]
How to cite this article: Maegdefessel, L. et al. miR-24 limits aortic vascular inflammation and murine abdominal aneurysm development. [score:2]
We detected decreased plasma miR-24 expression in patients with small (45–67 mm; n=54) and large AAA (69–150 mm; n=51; Fig. 6e) compared with both controls and PVOD patients. [score:2]
Death from aortic rupture occurred significantly more often in anti-24 -treated mice (58%), compared with scr-miR- (36%) and pre-24 -transfected (12%) through day 28. miR-24 expression in anti-/pre-24-transduced mice was less altered than in the PPE mo del (Supplementary Fig. 8A). [score:2]
Overexpression of miR-24 in peritoneal macrophages and RAW 264.7 increased apoptosis (Annexin V+ and caspase 3/7 assays) beyond that seen with IL-6 stimulation alone, while anti-24 abrogated the pro-apoptotic effects of IL-6 (Fig. 3d,e). [score:2]
Regulation of miR-24 through NF-κB in vitro. [score:2]
IL-6 treatment decreased miR-24 expression compared with control cells at two time points (Fig. 2e). [score:2]
Regulation and modulation of miR-24 in vitro. [score:2]
Further, anti-24 increased (while pre-24 decreased) phospho-Akt levels, partly explaining miR-24 -based macrophage apoptosis regulation (Supplementary Fig. 5A,B). [score:2]
The IL-6 -induced decrease in miR-24 was essentially eliminated in macrophages by prior siRNA -mediated knockdown (>75%) of either RelA (p65) or Nfkb1 (p50), key components of NF-κB (Fig. 3h). [score:2]
We utilized human immunodeficiency virus type 1-derived lentivirus to modulate miR-24 during murine AAA development. [score:2]
The pre-miR-24 (PMIRH24) sequence was: 5′-AATTCGCCCTTGATGGGATTTGCTTCCTGTCACAAATCACATTGCCAGGGATTTCCAACCGACCCTGAGCTCTGCCACCGAGGATGCTGCCCGGGGACGGGGTGGCAGAGAGGCCCCGAAGCCTGTGCCTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTCCACACCAAGTCGTGTTCACAGTGGCTAAGTTCCGCCCCCCAGGCCCTCACCTCCTCTGGCCTTGCCGCCTGTCCCCTGCTGCCGCCTGTCTGCCTGCCATCCTGCTGCCTGGCCTCCCTGGGCTCTGCCTCCCGTGCCTACTGAGCTGAAACACAGTTGGTTTGTGTACACTGGCTCAGTTCAGCAGGAACAGGGGTCAAGCCCCCTTGGAGCCTGCAGCCCCTGCCTTCCCTGGGTGGGCTGATGCTTGGAGCAGAGATGAGGACTCAGAATCAGACCTGTGTCTGGAGGAGGGATGTGGTGGGTGGGGTTGGCTGGGCCCAAATGTGTGCTGCAGGCCCTGATCCCCAACTCTGCAACTGGGGACCCCTGCATGGCCACAGCTCAGGCTGGGCTGTGGTGCCAGCATAGATAGCGGCCGC-3′. [score:1]
miR-24 modulation in vivo. [score:1]
There were no differences in miR-24 levels between patients with small (52–67 mm; n=12) and large AAA (69–115 mm, n=10), although there was a trend towards lower miR-24 with larger AAA. [score:1]
ISH for miR-24 was performed by using the miRCURY LNA microRNA ISH Optimization Kit (Exiqon), and 5′-DIG- and 3′-DIG -labelled probes for mmu-miR-24 according to the manufacturer’s protocol. [score:1]
miR-24- Chi3l1 interactions controlled inflammatory activity within the dilated aortic wall, effects abrogated by pre-miR-24 transfection. [score:1]
Effects of miR-24 modulation in vivo. [score:1]
In situ hybridization ISH for miR-24 was performed by using the miRCURY LNA microRNA ISH Optimization Kit (Exiqon), and 5′-DIG- and 3′-DIG -labelled probes for mmu-miR-24 according to the manufacturer’s protocol. [score:1]
Microarray studies examining miR-24-modulated aortic tissue confirmed that pre-miR-24 transfection led to AAA -associated-pathway reductions, including immune response and cytokine activity. [score:1]
Notably, miR-24 was one of the circulating miRNAs biomarkers in the cited study, suggesting that it might also detect patients at increased risk of future myocardial infarction. [score:1]
Pri-miR-23b, -27b and -24-1 may be transcribed independently from the cluster gene in mice, although pre-miR-23b may be co-transcribed with pre-miR-27b and pre-miR-24-1 (ref. [score:1]
Final analysis groups included two different sets consisting of 7-day PPE -treated versus sham-saline -treated aortae (five arrays each) and 7-day PPE -treated-miR-24-modulated aortae versus controls (sham-operated saline -treated (four arrays), scr-miR-PPE -treated (five arrays), pre-miR-24-PPE -treated (three arrays) and anti-miR-24-PPE -treated (six arrays)). [score:1]
More intriguing, miR-24 could perhaps be used prospectively to detect patients at high risk for rapid AAA growth/rupture. [score:1]
As observed in vivo, decreases in macrophage miR-24 with IL-6 stimulation were due to reductions in pri-miR-24-1 (Fig. 2f). [score:1]
We also investigated changes in circulating miR-24 plasma expression and Chi3l1 protein levels in our two murine AAA mo dels, and discovered that plasma miR-24 was significantly repressed in mice with aneurysms (Supplementary Fig. 8C). [score:1]
The anti-miR-24 (MZIP-24) sequence was: 5′-GATCCGTGGCTCAATTCAGCAGGCACCGCTTCCTGTCAGCTGTTCCTGCTGAACTGAGCCATTTTTGAATT-3′. [score:1]
The sequence of the LNA miR-24 control probe was: 5′-DIG/CTGTTCCTGCTGAACTGAGCCA/DIG-3′. [score:1]
One is intronic (mouse-chr13; human-chr9: miR-23b, miR-27b and miR-24-1) and the second is intergenic (mouse-chr8; human-chr19: miR-23a, miR-27a and miR-24-2) 12. [score:1]
Because, furin has previously been shown to indirectly regulate matrix metalloproteinases-2 and -9, and to control latent transforming growth factor beta (TGF-β) activation processing (key players in AAA pathobiology) 20 21, we evaluated whether miR-24 modulation in vitro would alter furin in human aortic SMCs. [score:1]
Further, qRT–PCR from days 3 and 7 showed that pri-miR-24-1 (not pri-miR-24-2) was substantially decreased in aneurysmal tissue (versus sham; Fig. 1e). [score:1]
miR-24 modulation had minimal impact on Chi3l1 in the suprarenal (non-aneurysmal) abdominal aorta, suggesting uptake of miRNA modulators only at the site of injury (Supplementary Fig. 7D). [score:1]
Confocal microscopy of double-immunofluorescence-stained aortas with anti-F4/80 and -Chi3l1 confirmed altered levels of both with miR-24 modulation and co-localization within PPE -induced AAAs (Fig. 5e). [score:1]
miR-24 modulation in ANGII -induced AAA and levels in human AAA. [score:1]
However, a combination of both CHI3L1 and miR-24 could potentially be utilized in patients for AAA detection and rupture risk stratification. [score:1]
Larger patient cohorts are needed to validate miR-24 or CHI3L1 as diagnostic biomarkers for AAA. [score:1]
As in aortic tissue, miR-24 plasma levels were indistinguishable between patients with small or large AAAs. [score:1]
We next examined the effects of miR-24 and Chi3l1 on macrophage survival. [score:1]
Transfection of all different cell types was performed using Lipofectamine RNAiMAX (Invitrogen) reagent, mixed with anti-hsa-miR-24, pre-hsa-miR-24 or scrambled controls (Ambion). [score:1]
The miR-24-1 pre-miR and miR-ZIP-anti-24 (System Biosciences) were cloned into a human immunodeficiency virus lentiviral vector containing a copGFP reporter with the miRNA precursor under constitutive CMV promoter control. [score:1]
Appropriately, similar effects on JNK and ERK phosphorylation were also observed after miR-24 modulation (Supplementary Fig. 4C,D). [score:1]
miR-24 and CHI3L1 are novel AAA biomarkers. [score:1]
Mature miR-24 sequences are indistinguishable by quantitative reverse transcription PCR (qRT–PCR). [score:1]
ISH was performed as described above utilizing the miRCURY LNA microRNA ISH Optimization Kit (Exiqon) and 5′-DIG- and 3′-DIG -labelled probes for mmu-miR-24. [score:1]
Interestingly, IL-6 markedly increases miR-24 degradation/processing, an effect that appears to be transcription -dependent (Supplementary Fig. 6H). [score:1]
ISH for miR-24 and immunohistochemistry (IHC) using anti-F4/80 (a macrophage inflammatory marker) revealed that miR-24 co-localized with activated macrophages in aneurysmal aortic mouse tissue (post-PPE day 7; Fig. 2d). [score:1]
[1 to 20 of 89 sentences]
8
[+] score: 242
Other miRNAs from this paper: hsa-mir-24-2
Second, over -expression of miR-24 significantly down-regulates S100A8 protein expression, while has no effect on S100A8 mRNA level, which further suggests that miR-24 directly regulate S100A8 gene through translational level. [score:12]
As a direct target of S100A8, miR-24 negatively regulates S100A8 expression at translational level. [score:9]
In conclusion, miR-24 was down-regulated in LSCC, and functions as a tumor suppressor in Hep2 cells partly through targeting the S100A8 gene. [score:8]
miR-24 down-regulates S100A8 expression at translational level. [score:8]
Thus, the identification of S100A8 as a miR-24 target gene provides a possible explanation as to why the overexpression of miR-24 can inhibit LSCC Hep2 cell invasion. [score:7]
First, overexpression of miR-24 significantly reduces the luciferase activity of 3'UTR sequence of S100A8, while mutation at the miR-24 target site in the 3'UTR of S100A8 could significant decrease the miR-24 regulation effect. [score:7]
cancer tissue using miRNAMap-2.0 (15), and found that miR-24 levels were frequently up-regulated in normal but down-regulated in tumor samples (Fig. 1A). [score:7]
Given that miR-24 is markedly down-regulated in laryngeal carcinoma, it may thus function as a potential tumor suppressor. [score:6]
We speculate that miRNA-24 inhibits LSCC Hep2 cell invasion through regulating S100A8 protein expression. [score:6]
Rogler et al showed that miR-24 was up-regulated in hematopoietic carcinoma and induced tumor suppressive activities (7). [score:6]
Collectively our present results indicate that miR-24 down-regulated in LSCC leads to loss of tumor suppressor function, which enhanced Hep2 cell invasion. [score:6]
These results strongly suggest that miR-24 negatively regulates S100A8 expression through translational repression pathways. [score:6]
Several studies have shown that miR-24, functioning as a tumor suppressive gene, plays an important role in human cancer and other diseases. [score:5]
Compared with controls, miR-24 had no significant effect on the S100A8 mRNA expression (data not shown), while the S100A8 protein level was significantly down-regulated when Hep2 cells were cotransfected with miR-24 and Lut-S100A8-Wt (P<0.05) (Fig. 4). [score:5]
Our results show that the up-regulation of miR-24 leads to significant cell morphological changes, reduced cell number, low proliferation and enhanced cell invasion potential of LSCC, which implies that miR-24 is associated with the biological effect of LSCC and retards the development of LSCC. [score:5]
However, given that a single miRNA has multiple targets, we believe that miR-24 also has other targets. [score:5]
As shown in Fig. 1B, 75% (15 of 20) of carcinoma tissues showed reduced miR-24 expression with respect to normal counterparts, and the average expression level in carcinoma tissues was significantly lower than that in normal larynx tissues, which is consistent with the miRNAMap-2.0 gene chip results. [score:5]
The discrepancy of miR-24 expression and function might be mainly due to its effect on the multiple target genes (2, 21). [score:5]
ANOVA analysis showed a significant statistical difference between the pre-miR-24 transfection and control groups (P<0.05, Fig. 2J), which implies that down-regulation of miR-24 may contribute to tumor metastasis in LSCC. [score:4]
For example, Mishra et al found that miR-24 was abnormally down-regulated in human colorectal cancer tumors and showed a p53-independent cellular proliferation (8). [score:4]
Recent studies found that FAF1, DHFR, E2F2, MYC and other cell cycle regulatory genes are target genes of miR-24 (8, 9, 21, 22). [score:4]
Therefore, we further down-regulated endogenous S100A8 protein level using S100A8 antibody blocking, and then detected the role of S100A8 in miR-24 mediated Hep2 cell invasion after cells were transfected with pre-miR-24 36 h. Transwell results showed that the transmembrane cells of pre-miR-24 and control miR transfection groups were 12.37±0.52 and 32.48±0.95, respectively. [score:4]
However, the activity of the reporter construct with a mutation at the miR-24 target site was unaffected when Hep2 cells were co -transfected with pre-miR-24 (P>0.05). [score:4]
Further, we used series of experiments to confirm that S100A8 is a direct negative target gene of miR-24 in LSCC. [score:4]
miR-24 is down-regulated in human LSCC specimens. [score:4]
Through analysis using miRanda and RNA22, we identified S100A8 as a possible target of miR-24 among the regulated genes. [score:4]
Of clinical significance, miR-24 is involved in the regulation of oral squamous cell carcinoma (OSCC) growth and that the expression level of miR-24 in plasma might be validated as a tumor marker for OSCC (12). [score:4]
However, Liu et al reported the up-regulation of miR-24 in tongue squamous cell carcinoma (TSCC) and the miR-24 mediated changes led to enhanced proliferation and reduced apoptosis in TSCC cells (19). [score:4]
To explore the possible role of miR-24 in LSCC development, we tested miR-24 expression in LSCC obtained from 20 patients by SYBR qRT-PCR. [score:4]
Importantly, studies have clarified the high stability of miRNAs in blood and the increase in plasma miR-24 is detectable in patients with a low level of miR-24 up-regulation in tumors (12, 20). [score:4]
In parallel, we cloned a second reporter construct, named Lut-S100A8-Mut, in which the conserved targeting site of miR-24 was specifically mutated, putatively to abolish the miRNA binding ability. [score:3]
Although the expression of miR-24 in cancers is controversial, the functional evidence for a role of miR-24 has been documented consistently. [score:3]
Most evidence suggested that miR-24 is aberrantly expressed in many kinds of cancers and the erythropoiesis process, which lead to significantly malignancies and cell differentiation alteration (8– 11). [score:3]
The wild-type of S100A8 gene 3'UTR, harboring miR-24 target sites, was cloned into the downstream of pGL3 plasmid, which was driven by the SV40 basal promoter, Lut-S100A8-Wt. [score:3]
Expression of miR-24 was determined by the SYBR-Green -based real-time quantitative PCR (qPCR). [score:3]
In the present study, we found that miR-24 acts as an endogenous siRNA for S100A8, and cell invasion ability induced by S100A8 can be subtracted by the overexpression of miR-24. [score:3]
To investigate whether miR-24 down-regulation played a causative role in Hep2 cells, we assessed the biological effect of miR-24 on the development and/or progression of LSCC using a gain of function approach. [score:3]
In this study, S100A8 mRNA was predicted to be a potential target of miR-24 after computational analysis using two different programs (miRanda and RNA22). [score:3]
miR-24 inhibits Hep2 cell invasion partly through S100A8 blockage. [score:3]
It has been observed that miR-24 was aberrantly expressed in human malignancies, including tongue squamous cell carcinoma. [score:3]
The above results indicate that the expression level of miR-24 has an influence on cell growth in vitro. [score:3]
S100A8 mRNA is a target of miR-24. [score:3]
To test at which level S100A8 was down-regulated by miR-24, qRT-PCR and Western blotting assays were performed. [score:3]
As a new target gene of miR-24, S100A8 is an important inflammation factor, localized in the cytoplasm and/or nucleus of a wide range of cells. [score:3]
Our findings revealed that the identification of miR-24 and its target gene S100A8 in LSCC may help to understand the molecular mechanism of carcinogenesis, and also give us strong rationale to further investigate miR-24 as a potential treatment target for LSCC. [score:3]
Then the Hep2 cells (which have low endogenous miR-24 expression) were co -transfected with the reporter vector and miRNA mimics. [score:3]
Site-directed mutagenesis of the miR-24 target site in the S100A8 3'UTR (Lut-S100A8-Mut) was carried out using the Quikchange Mutagenesis Kit (Stratagene, Hei delberg, Germany), with Lut-S100A8-Wt serving as a template (mutagenic oligonucleotide primer sequences are listed in Table I. For reporter assays, Hep2 cell were transiently co -transfected with luciferase plasmid and microRNA precursor (control miR: 5′-UGGAAUGUAAAGAAGUAUGUA-3′, pre-miR-24: 5′-UGGCUCAGUUCAGCAGGAACAG-3′) using Lipofectamine™ 2000. [score:2]
Site-directed mutagenesis of the miR-24 target site in the S100A8 3'UTR (Lut-S100A8-Mut) was carried out using the Quikchange Mutagenesis Kit (Stratagene, Hei delberg, Germany), with Lut-S100A8-Wt serving as a template (mutagenic oligonucleotide primer sequences are listed in Table I. For reporter assays, Hep2 cell were transiently co -transfected with luciferase plasmid and microRNA precursor (control miR: 5′-UGGAAUGUAAAGAAGUAUGUA-3′, pre-miR-24: 5′-UGGCUCAGUUCAGCAGGAACAG-3′) using Lipofectamine™ 2000. [score:2]
To confirm whether the 3'UTR of S100A8 was a functional target of miR-24 in LSCC, we set up a luciferase reporter assay. [score:2]
These results indicate that S100A8 3'UTR carries a direct and specific miR-24 binding site. [score:2]
Together, these results indicate that 3'UTR of S100A8 carries a direct and specific binding site of miR-24 in vitro. [score:2]
Together, these results suggest that miR-24 plays an important role in LSCC development. [score:2]
Since the sampling of blood is relative non-invasive and the examination of blood can facilitate early diagnosis, our findings further reveal that plasma miR-24 might be a potential useful LSCC biomarker. [score:1]
The transmembrane cells of S100A8 protein that blocked following pre-miR-24 transfection group was much less, with only some cells observed, and no more than 15 cells in the whole membrane. [score:1]
The programs returned a hit between the 455 bp sequences of S100A8 and miR-24 (Fig. 3A). [score:1]
In this study, we explored the role and mechanism of miR-24 in the development and aggression of LSCC by analyzing the biological characteristics and regulation manner of miR-24 in LSCC. [score:1]
As shown in Fig. 2G–I, the invasion effect of pre-miR-24 on Hep2 cells by Transwell showed the number of trans-membrane Hep2 cells undergoing pre-miR-24 transfection was much lower than those in control groups on day 7. The transmembrane Hep2 cell number ranged from 34±1.25 and 32.48±0.95 to 12.37±0.52 in the vehicle, control miR and pre-miR-24 transfection groups, respectively. [score:1]
Substantial evidence shows that miR-24 encoding gene maps to human chromosome 9q22 and 19p13, regions that are unstable and frequently altered in head and neck squamous cell carcinoma (16, 17). [score:1]
As shown in Fig. 2A and B, qRT-PCR revealed that miR-24 precursor (pre-miR-24) enhanced miR-24 level, suggesting that pre-miR-24 is efficiently introduced into the cells and the following detection is invincible. [score:1]
In addition, we investigated miR-24 expression in normal vs. [score:1]
Especially on day 7, the cells transfected with pre-miR-24 showed significantly lower proliferation ability than those in control groups (Fig. 2F). [score:1]
The Cell -based experiments were carried out by transfection of 50 nM pre-miR-24 or control miR into Hep2 cells using Lipofectamine™ 2000 in accordance with the manufacturer's procedure. [score:1]
Media/FBS were purchased from Invitrogen/Gibco (Karlsruhe, Germany), pGL3-Promoter vector from Promega (Madison, WI, USA), control miR and pre-miR-24 from Ambion (Austin, TX, USA), Lipofectamine™ 2000 from Invitrogen (Carlsbad, CA, USA), and Transwell chambers (1 cm [2], 12 mm pores) from Machery-Nagel (Düren, Germany). [score:1]
This result indicates that S100A8 protein plays a critical role in miR-24 mediated Hep2 cell invasion. [score:1]
Another study showed that miR-24 emerged as a biomarker specific for Kaposi sarcoma (13). [score:1]
However, the relationship of miR-24 to LSCC is not yet reported. [score:1]
Meanwhile, we assessed the effects of miR-24 on cell invasion, a key determinant of malignant progression and metastasis. [score:1]
miR-24 induces morphological change and impairs proliferation and invasion properties in Hep2 cells. [score:1]
[1 to 20 of 68 sentences]
9
[+] score: 182
Other miRNAs from this paper: hsa-mir-24-2, hsa-mir-125b-1, hsa-mir-125b-2
This data suggests regulation of miR-24 expression during retinal development, perhaps due to its role in regulation of p53 via ARF to suppress p53 hyperactivation and unwanted cell death. [score:8]
In our expression analyses, miR-24 is less abundant in human retinoblastomas than in normal fetal and adult retinas, with highest expression in adult retinas, consistent with reports of elevated miR-24 expression in terminally differentiated cells [21]. [score:7]
Thus, low ARF protein in retinoblastomas despite robust mRNA expression, at least in part, may reflect the presence and activity of miR-24 to inhibit ARF expression. [score:7]
N = 3. (B) Comparison of normalized ARF protein expression (values taken from ARF protein/ ARF mRNA expression, as depicted in Figure 1C) to miR-24 expression in human fetal retina (FR), human adult retina (HR 50), RB1 [-/- ]retinoblastoma cell lines (RB 247, 381, 1021, WERI-Rb1 (WERI), Y79), RB1 [+/+ ]retinoblastoma cell lines (RB 3823, 522) and other cell lines (HeLa, S KOV3, HEK-T, SaOS2, OVCAR3). [score:7]
Indeed, miR-24 has documented expression in normal retinas and retinoblastomas, and demonstrated translational repression of p16 [INK4a ]mRNA, which shares 100% homology with the 3' untranslated region of ARF [20, 24, 25]. [score:7]
Comparisons of normalized miR-24 expression and ARF protein expression demonstrates that RB1 [-/- ]cell lines have very high miR-24 relative to the amount of expressed protein, in comparison to RB1 [+/+ ]cell lines with low ARF protein and miR-24 (RB 3823 and 522; Figure 4A,B and 4C). [score:7]
For example, expression of miR-125b and miR-24 is similar in retinoblastomas [28], and miR-125b has been shown to regulate the 3' untranslated region of p16 [INK4a ]and ARF mRNA [20]. [score:6]
miR-24, a microRNA that represses p14 [ARF ]expression, is expressed in retinoblastoma cell lines and correlates with lower protein expression when compared to other cell lines with high p14 [ARF ]mRNA. [score:6]
The microRNA miR-24 [20], expressed in both normal retinas and retinoblastomas [17], regulates the 3' untranslated region of both p16 [INK4a ]and ARF mRNA [20]. [score:6]
Differential miR-24:protein ratios between RB1 [-/- ]retinoblastomas, fetal retina and adult retina, and RB1 [+/+ ]retinoblastomas, combined with ARF -mediated apoptosis and miR-24-regulated ARF expression in WERI-Rb1 cells nonetheless demonstrate a unique mechanism in RB1 [-/- ]retinoblastoma tumors through which proliferation could be maintained by miR-24 suppression of ARF. [score:6]
Analysis of miR-24 in human fetal and adult retinas, primary retinoblastoma tumors, retinoblastoma cell lines and other cell lines revealed the highest miR-24 expression in human adult retinas, consistent with reports of elevated miR-24 expression in terminally differentiated cells [21]. [score:5]
The reduced miR-24 level in retinoblastomas relative to normal retinas may be explained by the requirement of sustained expression of proliferation genes in tumor cells while maintaining sufficient amounts of miR-24 to repress the ARF tumor suppressor. [score:5]
AdARF mRNA did not contain the two potential miR-24 target sites, which may explain the accumulation and activity of exogenously-expressed ARF (Figure 2). [score:5]
p14 [ARF ]protein levels were restored without change in mRNA abundance upon miR-24 inhibition suggesting that miR-24 could functionally repress expression, effectively blocking p53 tumor surveillance. [score:5]
We uncovered an intact p53 response in WERI-Rb1 cells through overexpression of ARF protein; however, whether targeting miR-24 in retinoblastoma cells would increase ARF protein expression to optimal levels to elicit a p53 response remains to be investigated. [score:5]
In human fetal retinas, adult retinas, and retinoblastoma cells, we determined endogenous p14 [ARF ]mRNA, ARF protein, and miR-24 expression, while integrity of p53 signalling in WERI-Rb1 cells was tested using an adenovirus vector expressing p14 [ARF]. [score:5]
Moreover, the pleiotropic miR-24, in addition to its regulation of ARF, has been shown to repress expression of MYC and E2F2 [21], which are important in driving proliferation and imperative to tumor growth. [score:4]
To evaluate the potential role of miR-24 expression in retinoblastoma and other cell lines, miR-24 expression was compared to the level of mRNA-normalized ARF protein expression (taking into account the protein/mRNA ratios from Figure 1C). [score:4]
Paradoxically, when pRB is inactivated during retinal tumorigenesis, ARF protein regulation mediated by high miR-24 intrinsic levels may impede the tumor suppressor functions of p53. [score:4]
To gain insight on the role of miR-24 on the ARF-p53 axis, a thorough examination of the biological and functional implications of miR-24 expression in human retinal and retinoblastoma tumor development is thus warranted. [score:4]
Other cell lines with abundant ARF protein (HeLa, HEK-T) but low miR-24 (Figure 4B and 4C), or high miR-24 and ARF protein (S KOV3), demonstrate lower miR-24:protein ratios, suggesting that high miR-24 levels could functionally regulate ARF protein expression in RB1 [-/- ]cell lines. [score:4]
Our miR-24 and ARF protein expression data are in agreement with ARF protein regulation by miR-24 that is unique to RB1 [-/- ]retinoblastomas. [score:4]
Regulation of ARF protein expression by miR-24 in retinoblastoma cell lines points to a possible mechanism through which ARF protein is decreased in retinoblastoma cells. [score:4]
These "low miR-24" RB1 [-/- ]tumors raise the possibility that the level of miR-24 expression may be insufficient to compromise the p53 response in some retinoblastoma tumors. [score:3]
Our data indicates that p53-tumor surveillance in response to RB1 loss may be suboptimal in the developing retina, not only due to high levels of MDM2 and MDM4, but inadequate levels of ARF, possibly as a result of suppression by miR-24. [score:3]
In retinoblastoma cells where high levels of p14 [ARF ]mRNA are not accompanied by high p14 [ARF ]protein, we found a correlation between miR-24 expression and low p14 [ARF ]protein. [score:3]
However other factors besides expression, such as components of the RISC complex, may influence the effect of miR-24 activity in retinoblastoma cells [27]. [score:3]
Some RB1 [-/- ]primary tumors showed low miR-24 expression, comparable to RB1 [+/+ ]cell lines. [score:3]
To study p14 [ARF ]biogenesis, retinoblastoma cells were treated with the proteasome inhibitor, MG132, and siRNA against miR-24. [score:3]
We now demonstrate repression of ARF expression by miR-24 in retinoblastoma that may effectively block activation of p53 tumor surveillance in response to RB1 loss. [score:3]
Intriguingly, the low miR-24:protein ratios in RB1 [+/+ ]retinoblastomas are consistent with the notion that, in the absence of selection pressure from ARF activation induced by RB1 loss, tumor cells may maximize proliferation through the derepression of MYC and E2F2 [21] without the compromise of tumor suppressor activation. [score:3]
miR-24 suppresses ARF in retinoblastoma cell lines. [score:3]
All RB1 [-/- ]cell lines, in addition to two out of the 4 primary RB1 [-/- ]retinoblastomas (RB 2133 and RB 2362) demonstrated higher miR-24 expression than the RB1 [+/+ ]cell lines (Figure 4A). [score:3]
Transient over -expression of siRNA against miR-24 led to elevated p14 [ARF ]protein in retinoblastoma cells. [score:3]
BLT performed the miR-24 expression analysis and anti-miR-24 siRNA experiment, and KHT performed all other experiments. [score:3]
We showed that fetal retinas in general demonstrate higher miR-24 expression than retinoblastoma tumors. [score:3]
We suggest that miR-24 -mediated repression of ARF, a crucial signal transducer that bridges loss of pRB to p53-tumor surveillance, may also compromise the proper response to RB1 inactivation, alleviating the requirement for genetic abrogation of the p53-pathway during retinoblastoma development. [score:2]
However, SaOS2 and OVCAR3 cell lines show similar miR-24:protein ratios as RB1 [-/- ]retinoblastoma cell lines, suggesting that miR-24 regulation of ARF may apply to other cell types. [score:2]
Indeed miR-24 was shown to be involved in developmental apoptosis in Xenopus retina [26]. [score:2]
Knockdown of miR-24 (approximately 50%, Figure 4D) resulted in increased ARF protein (2.8-fold), but no change in ARF mRNA (Figure 4E, F & 4G). [score:2]
However, fetal retinas show in general higher levels of miR-24 compared to the average expression of primary retinoblastomas and retinoblastoma cell lines (Figure 4A). [score:2]
Figure 4 Role of miR-24 in retinoblastoma ARF regulation. [score:2]
Thus the observed miR-24 in retinoblastoma tumors might be at an optimal level that maximizes tumor cell growth and survival. [score:1]
High miR-24/ARF protein ratios in human retinoblastoma cell lines. [score:1]
Asychronous WERI-Rb1 cells were transiently transfected with 50 pM of anti-miR-24 siRNA (Ambion, ID: AM12902) or control siRNA (Ambion, ID: AM17010) using a WERI-Rb1 cell transfection reagent (Altogen Biosystems) in serum-free Iscove's MDM. [score:1]
Anti-miR-24 siRNA. [score:1]
To further assess the function of miR-24 in RB1 [-/- ]retinoblastoma cell lines, we transiently transfected WERI-Rb1 cells with a small interfering RNA (siRNA) against miR-24. [score:1]
During retinal tumorigenesis, miR-24 may intrinsically compromise the p53 response to RB1 loss. [score:1]
[1 to 20 of 48 sentences]
10
[+] score: 177
Other miRNAs from this paper: hsa-mir-24-2
Those who expressed miR-24 at levels less than the cut-off value were assigned to the downregulation group (n=61), and those with expression above the cut-off value were assigned to the upregulation group (n=50). [score:11]
Similarly to what was carried out with patients with ALL, the patients with AML were divided in subgroups according to downexpression and upexpression [< or > 75th percentile expression level of miR-24 (8.22-fold)]: downexpression group (n=18) and upexpression group (n=18). [score:11]
In the multivariate analysis, for patients with miR-24 expression, OR estimates retained their significance (p<0.05) in the presence of other prognostic factors, which also influenced AL outcome (age, gender and risk by age and leukocytes at diagnosis), which suggests that miR-24 is an independent prognostic marker for AL. More importantly, we proved that miR-24 expression was significantly associated with OS of patients with AL. In support of this, Kaplan-Meier analysis of OS showed that patients with high miR-24 expression tended to have a significantly shorter OS compared with patients with low expression (log-rank p<0.05), indicating that high miR-24 expression is a marker of poor prognosis for patients with AL. Thus, miR-24 could be used as molecular prognostic marker in addition to known prognostic indicators, in order to identify patients who are more likely to have a higher risk of death, thus, should receive more aggressive treatment. [score:10]
To evaluate the correlation between miR-24 expression and the risk of relapse to ALL, patients were divided into groups with downregulation and upregulation of miR-24 expression. [score:9]
These data suggest that upregulation of miR-24 expression may have an important role in the relapse of the disease. [score:8]
It was observed that those patients with upexpression of miR-24, showed a significant increase in the risk of relapse to ALL (OR=2.51, 95% CI 1.10–5.72, p=0.028) compared to those patients who had downexpression of miR-24 expression (Table V). [score:6]
These results suggest that upregulation of miR-24 expression may play a role in the progression of AML. [score:6]
Therefore, it is critical to identify biomarkers for the early identification of patients with a high-risk of treatment failures, in order to modify therapeutic methods for improving the overall survival (OS) of patients with AL. miR-24 is a tumor-suppressor among the miRNAs that are consistently upregulated during terminal differentiation. [score:6]
A previous study has shown miR-24 to have an increased expression in AML and a decreased expression in ALL (28). [score:5]
Overexpression of miR-24 in liver, gastric, prostate and cervical cancer cell lines was found to protects these cells from apoptosis whereas knockdown of miR-24 turns differentiated cells into a proliferation state and sensitizes them to apoptosis (13, 15). [score:4]
miR-24 was found to be enriched in CD34 [+] HSPCs (9), and has a well-defined role as a regulator of normal erythropoiesis via targeting of human activin receptor type 1, ALK4 (12). [score:4]
In conclusion, our data indicated that miR-24 upregulation was associated with poor prognosis in AL. miR-24 was identified for the first time as an independent marker for predicting the clinical outcome of AL patients. [score:4]
This suggests that the regulation of miR-24 expression, and the high association with the risk of relapse (p<0.05) may be a factor that led to >50% of deaths in the patients with AL included in the present study. [score:4]
miR-24 is expressed in a cyclical manner and takes part in maintaining and regulating proper cell cycle progression and apoptosis (13, 15). [score:4]
Expression of miR-24 is associated with unfavorable prognosis in AL patients. [score:3]
We also examined the relationship between miR-24 expression levels and the risk of relapse to AML. [score:3]
We observed a significant correlation between miR-24 expression levels and risk of relapse (OR=7.00, 95% CI 1.59–30.79, p=0.010), (Table VI). [score:3]
The 75th percentile expression level of miR-24 (2.54-fold) was used as a cut-off point to divide all 111 patients with ALL into 2 groups. [score:3]
miR-24 was differentially expressed in AML and ALL. [score:3]
Nevertheless, our data generate novel hypotheses regarding the role of miR-24 expression in the risk and relapse of AL and an impact on survival of AL patients, which will have to be confirmed in independent studies. [score:3]
We observed a statistically significant association between the expression of miR-24 and the risk of AL (OR=2.51, 95% CI 1.10–5.72, p=0.028 for ALL and OR=7.00, 95% CI 1.59–30.79, p=0.010 for AML). [score:3]
We observed that ALL patients with high miR-24 expression tend to have shorter OS than those with low miR-24 (Fig. 2D; log-rank test; p=0.001 for ALL and Fig. 3D; log-rank test; p=0.018 for AML). [score:3]
However, the number of studies on the miR-24 expression features and functions in samples from pediatric patients with AL is relatively low. [score:3]
The log-rank test and Kaplan-Meier curves were used to analyze the effect of the miR-24 expression, gender, risk of relapse and risk classification (standard- and high-risk) on OS. [score:3]
miR-24 expression in AL patients with/without rearrangement. [score:3]
miR-24 expression in the AML patients was much higher than that in the ALL patients (p<0.001) (Table IV and Fig. 1A). [score:3]
The expression of miR-24 was determined from the threshold cycle (Ct), and the relative expression levels were calculated by the 2 [−ΔΔCt] method. [score:3]
Risk of relapse based on the miR-24 expression and other risk factors. [score:3]
In the present study, we observed that miR-24 expression was significantly increased in both AML and ALL patients (p<0.001). [score:3]
In a logistic regression analysis, an association was observed between miR-24 expression and the risk of relapse of ALL (p<0.05). [score:3]
Reported targets of miR-24 include pro-apoptotic (FAF-1, caspase 9, Bim and Apaf-1) and cell cycle proteins (13– 15) and it was observed that miR-24 promotes the survival of hematopoietic cells (16). [score:3]
In addition, the univariate and multivariate analyses performed showed that miR-24 expression is an independent prognostic factor for AL (Tables V and VI). [score:3]
We further quantitatively detected miR-24 expression in 111 cases of ALL and 36 cases of AML divided into two subtype groups: rearrangement -positive (ALL, 8; AML, 3) and rearrangement -negative (ALL, 64; AML, 22). [score:3]
Secondly, we determined if there was a significant association between miR-24 expression and patient survival, which could point to a potential role for miR-24 as a prognostic marker of AL. A case control study was carried out in the Pediatric Oncology Service of the State Cancer Institute (SCI) from the South of Mexico (Acapulco, Guerrero, Mexico), between September 2005 and July 2013. [score:3]
To identify whether miR-24 was differentially expressed between the ALL and AML samples, we examined miR-24 levels in samples of the AL patients and the healthy individuals. [score:3]
In addition, miR-24 expression, was associated with risk of relapse of leukemia (p<0.05). [score:3]
Additionally, miR-24 is implicated in regulating apoptosis and cell proliferation. [score:2]
Notably, two from our cases with t(8;21) rearrangement presented high expression of miR-24 when compared with others rearrangements (ETV6-RUNX1/BCR-ABL), which is similar to previous findings (8, 28– 30). [score:2]
Our data proved that miR-24 expression was significantly higher in AL patients compared with that in apparently healthy individuals (p<0.001). [score:2]
Then, we compared miR-24 expression in patients according to ETV6-RUNX1/BCR-ABL vs. [score:2]
We investigated the expression of miR-24 in samples of AL patients and detected its relationships with clinical parameters. [score:1]
This phenomenon was consistent with previous publications, where it was noted that miR-24 promotes the survival of hematopoietic progenitors (16, 28). [score:1]
AML1-ETO rearrangement positivity and observed that miR-24 was significantly higher in the AML1-ETO -positive patients (p=0.022); the mean was 1.55-fold (ETV6-RUNX1/BCR-ABL) vs. [score:1]
Our primary aim was to investigate the differential expression of miR-24 in patients with AL and healthy individuals. [score:1]
Previous studies have identified the processes in which miR-24 is involved in hematopoietic cell lines. [score:1]
The association between miR-24 expression and survival of AL patients was investigated. [score:1]
Yet the role of miR-24 in AL samples is poorly understood. [score:1]
In the present study, we investigated the expression of miR-24 in clinical samples from children with AL, as well as healthy controls. [score:1]
In turn, miR-24 in the ALL patients was significantly low (0.84 median, p=0.002). [score:1]
One-way analysis of variance (ANOVA) was used to compare differences among the miR-24 levels between groups, and results are presented as mean ± SD. [score:1]
Univariate logistic regression analysis for the association with the risk of relapse to AL were tested first for miR-24 expression, gender and other clinical characteristics, and those factors were included into a second multivariate logistic analysis. [score:1]
[1 to 20 of 51 sentences]
11
[+] score: 156
Meanwhile, miR-24 is apparently up-regulated by E6 and E7 expression and may promote cell proliferation by targeting the cell cycle inhibitor p27. [score:10]
We observed by RQ-PCR and Northern blotting that HFKs transduced to express both E6 and E7 onco-proteins resulted in increased miR-24 expression (Fig. 2a and c) and decreased miR-205 expression (Fig. 2b and d). [score:7]
In the case of miR-24, it is also feasible that inactivation of pRb also contributes to its up-regulation, since it is known to be up-regulated by c-MYC (Li et al., 2013) and has several putative E2F1 binding sites in the vicinity of the miR-23b–27b–24 cluster region (Supplementary Fig. 2b). [score:7]
In the case of miR-24, we noted that knocking down expression resulted in an increase of p21 and p27, indicating an inhibition of the cell cycle (Fig. 2i). [score:6]
Using three miRNA target prediction algorithm programs, we found that miR-24 was consistently predicted to target p27 (Fig. 4a and Supplementary Fig. 3). [score:5]
Two highly expressed miRNAs were miR-205 and miR-24, both of which showed an increase in expression following differentiation, suggesting they were important in this process. [score:5]
In this study, we have focused on p27 and p16 as targets of miR-24, but we fully expect other (known and, as yet, unknown) targets of miR-24 to be also affected, any of which might also contribute to control of differentiation. [score:5]
Only two other studies have investigated these miRNAs in differentiation of keratinocytes and our results agree with their observations that miR-205 is up-regulated during differentiation of keratinocytes (Nissan et al., 2011), whilst miR-24 is up-regulated in murine keratinocytes during differentiation (Amelio et al., 2012). [score:5]
Knockdown of miR-205 resulted in significantly increased HFK proliferation, with ~40% more cells staining for BrdU incorporation than control cells, whilst knocking down of miR-24 significantly inhibited HFK proliferation by ~21% (Fig. 2h). [score:5]
Since miR-24 and miR-205 have putative roles as an oncogene and a tumour suppressor respectively, we wanted to specifically examine the effect of altering miR-24 and miR-205 expression on proliferation in cycling HFKs. [score:5]
The luciferase activity of a reporter construct containing the wild-type p27 3′UTR region (p27-3′UTR) showed significant reduction when miR-24 was over-expressed in the same cells, indicating that miR-24 was binding to the target region in the 3′UTR of p27 mRNA (as shown in Supplementary Fig. 3). [score:5]
Like miR-205, miR-24 also seems to play contrasting roles depending on the setting, but it is generally found to be up-regulated in various cancers including oral squamous cell carcinoma (Lin et al., 2010) and is postulated to have an oncogenic function. [score:4]
Quantitative real-time polymerase chain reaction (RQ-PCR) (Fig. 1a) and Northern blotting (Fig. 1b and c) both show that miR-24 and miR-205 are significantly up-regulated during calcium -induced HFK differentiation. [score:4]
The fact that altering miR-24 levels results in a similar pattern of expression for p27 suggested that it may also be a target and we proceeded to confirm this with a luciferase reporter assay (Fig. 4d). [score:4]
However, we did not observe an exact correlation since p27 protein levels increase until Day 6, before decreasing, where we might have expected the increasing levels of miR-24 to result in decreased p27 levels from Day 0 to Day 9. However, we had noted a similar delayed response during differentiation between miR-203 and its target p63 (McKenna et al., 2010), so we suggest that miR-24 may still contribute to the control of p27 levels during HFK differentiation, although other mechanisms are likely to also play a role and presumably override the regulation of p27 by miR-24 during the early period of differentiation. [score:4]
However, as we noted in our introduction, miR-24 can play contrasting roles depending on the setting and there is evidence from other studies that miR-24 can also inhibit cell proliferation (Amelio et al., 2012, Mishra et al., 2009). [score:3]
Taken together, these keratinocyte studies demonstrate that both miR-205 and miR-24 play important roles in keratinocyte proliferation and differentiation, with abnormal expression of either likely to result in altered cell behaviour. [score:3]
Nor can we exclude the possibility that other miRNAs play a role, including miR-23b and 27b from the same cluster as miR-24, and also other miRNAs which target p27. [score:3]
These results suggest that, in HFKs, miR-24 and miR-205 nominally behave in an oncogenic and tumour suppressor function respectively, observations which agree with the roles proposed for them by other studies in keratinocytes (Lin et al., 2010; Kim et al., 2013). [score:3]
HFKs were seeded at a concentration of 100,000 cells/well in 12 well plates and transfected with 500 ng of either p27-3′UTR plasmid of p27-MUT, together with either pre-miR-24 or non -targeting negative control (pre-neg) at a concentration of 50 nM. [score:3]
miR-24 targets p27 in cycling keratinocytes. [score:3]
Our observations are corroborated by a recent study by Giglio et al. (2013), published while this manuscript was being prepared, which also demonstrates that miR-24 targets p27 in keratinocytes. [score:3]
In the reverse experiment, we over-expressed miR-24 levels in HFKs and demonstrated that p27 levels were significantly reduced (Fig. 4b and c). [score:3]
It is possible that a switch in miR-24 function therefore occurs during HFK differentiation, whereby proliferation is inhibited instead of promoted. [score:3]
We were also interested in the potential targets of miR-24 within the cell. [score:3]
This is apparently the case in the differentiation of normal HFKs, where an increase in miR-24 correlates with decreased proliferation, whilst the lack of miR-24 induction noted in cells expressing E6 and E7 associates with increased proliferation. [score:3]
Presumably, this might be due to the effect of miR-24 on other targets which would override the proliferative effect of miR-24 noted in cycling cells. [score:3]
As expected, when miR-24 was over-expressed in HFKs, we noted that HFK proliferation was significantly increased (data not shown). [score:3]
However, when miR-24 was over-expressed with a reporter construct which had mutated residues in the miR-24 binding site of p27 3′UTR (p27-MUT), no reduction in luciferase activity was observed. [score:3]
As a control, we quantified levels of p16, a known target of miR-24 (Lal et al., 2008). [score:3]
Therefore, in this report, we investigate how the expression of miR-24 and miR-205 is affected by expression of HPV onco-proteins in HFKs during proliferation and differentiation. [score:3]
To test this relationship in vitro, we again knocked down miR-24 levels in HFKs and demonstrated by RQ-PCR (Fig. 4b) and western blotting (Fig. 4c) that p27 levels were significantly increased as a result. [score:2]
The observation that p27 levels were increased when miR-24 was knocked down prompted us to investigate whether it was a potential target of miR-24. [score:2]
Furthermore, a study by Mishra et al. (2009) suggested that miR-24 regulation was independent of p53 activity in cancer cells. [score:2]
In cycling cells, the increased miR-24 levels appear to be associated with the increased proliferation which is exhibited by cycling cells expressing E6 and E7 compared to control cells. [score:2]
This is strong evidence that miR-24 does indeed regulate p27 levels in keratinocytes. [score:2]
microRNA miR-24 miR-205 HPV Keratinocytes Differentiation Over the past decade, a growing body of evidence has shown that microRNAs (miRNAs) play a fundamental role in the development, function and maintenance of tissues and cells in various organisms. [score:2]
To date, several individual miRNAs have been identified as playing fundamental roles in keratinocytes, including microRNA-205 (miR-205) and microRNA-24 (miR-24). [score:1]
We validated these screening results by measuring miR-24 and miR-205 expression in keratinocytes induced to differentiate by calcium treatment, and in organotypic rafts, which are 3-dimensional skin equivalents (McCance et al., 1988), derived from normal HFKs. [score:1]
These possible contributing factors may go some way to explaining why we find p27 levels do not exactly correlate with miR-24 levels during differentiation. [score:1]
A matched control construct contained 2 mutated bases in the miR-24 binding site (cataCTGAGCCAagtat changed to cataCTGTACCAagtat) (p27-MUT). [score:1]
Indeed, we are inclined to speculate that miR-24 may play differing functions in cycling and differentiating cells. [score:1]
Association of miR-24 with proliferation is an observation which is supported by our findings in Fig. 2(h) and it also agrees with observations by others, who have shown that miR-24 promotes cell proliferation in different settings (Lin et al., 2010, Giglio et al., 2013). [score:1]
One construct contained the wild-type p27 3′UTR region with the miR-24 binding site intact (p27-3′UTR). [score:1]
Since we had confirmed this interaction we were then interested to see if miR-24 levels inversely correlated with p27 levels during differentiation, so we quantified p27 by RQ-PCR (Fig. 4e) and western blotting (Fig. 4f) in samples from our organotypic raft mo del. [score:1]
In summary, we have provided further data supporting the evidence that that miR-24 and miR-205 play important roles in keratinocytes. [score:1]
The membrane was hybridized overnight at 42 °C with DIG -labelled LNA probe specific for miR-24 or miR-205 (0.1 nM) (Exiqon) or DIG -labelled antisense probe to U2snRNA (GGGTGCACCGTTCCTGGAGGTAC) (100 ng/ml). [score:1]
However, some of our data (not shown) suggested that E6 and E7 separately resulted in increased miR-24 levels, but this data was not conclusive enough to allow us to draw similar conclusions for a relationship between miR-24 and p53 in HFKs. [score:1]
Likewise, increases in miR-24 and miR-204 were observed in the organotypic raft mo del of keratinocyte differentiation (Fig. 1d–f). [score:1]
miR-24 and miR-205 are induced during keratinocyte differentiation. [score:1]
Amelio I. Lena A. M. Viticchiè G. Shalom-Feuerstein R. Terrinoni A. Dinsdale D. Russo G. Fortunato C. Bonanno E. Spagnoli L. G. Aberdam D. Knight R. A. Candi E. Melino G. miR-24 triggers epidermal differentiation by controlling actin adhesion and cell migrationJ. [score:1]
Transfection of HFKs with anti-miR-24, pre-miR-24, anti-miR-205, pre-miR-205 and negative controls (all Ambion) was performed using FuGene HD (Roche, Mannheim, Germany) following manufacturer's protocols. [score:1]
[1 to 20 of 52 sentences]
12
[+] score: 136
Our findings were in consistent with studies using the hemin -treated K562s or EPO -induced CD34+ HPCs to differentiate into mature erythrocytes, revealing the upregulation of miR-23a, miR-27a or miR-24 during erythropoiesis, whereas an activin A -mediated erythroid mo dels reported the inhibitory role of miR-24 in haemaglobin accumulation. [score:6]
The aforementioned experiments suggested that in addition to effecting erythroid differentiation, upregulated GATA-1 bound and activated the miR-27a and miR-24 genes, which led to further repression of GATA-2 translation and facilitated GATA-1 replacement of GATA-2 at miRNAs promoter (Figure 6A). [score:6]
Here, miR-27a and miR-24 perform post-transcriptional protection through repressing the translation of GATA-2, which should not be expressed in differentiated erythroid cells. [score:5]
In contrast to miR-451 locus whose expression was restricted to the fetal liver in embryonic day (E) 16.5 mouse embryos, the major site of haematopoiesis and erythropoiesis at this stage of development, miR-27a and miR-24 seem to serve as universal regulators in different cell types. [score:5]
As expected, the percentage of benzidine -positive cells (Supplementary Figure S4A) and gamma-globin accumulation (Supplementary Figure S4B) increased in miR-27a or miR-24 over-expressed K562s, whereas the percentage of benzidine -positive cells decreased in K562s following the inhibition of miR-27a or miR-24. [score:5]
Increased GATA-2 expression led to a decrease in the levels of Pri-27a∼24 and mature miR-27a or miR-24 (Figure 5E), whereas GATA-2 knock-down increased the transcription and maturation of miR-27a and miR-24 (Figure 5E). [score:4]
Figure 5. The GATA switch regulated miR-27a and miR-24 expression. [score:4]
Collectively, the expression patterns of miR-27a and miR-24 in two separate erythroid differentiation mo dels (K562s and HPCs) suggested that they may be two potential regulators of erythroid differentiation. [score:4]
Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cellsThe miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:4]
Therefore, miR-27a and miR-24 accelerated the development of mature erythroid populations by repressing GATA-2 expression in transplanted mouse mo dels. [score:4]
Remarkably, only a few reports have raised concerns about the expression of miR-27a and miR-24 in haematopoiesis (30, 31). [score:3]
These binding changes resulted in transcriptional changes of miR-27a and miR-24, as evidenced by an increase or decrease in their primary and mature transcripts on GATA-1 over -expression or silencing (Figure 1H). [score:3]
miRNA mimics (miR-27 a and miR-24), miRNA inhibitors (Anti-27a and Anti-24) and negative control molecules (Scramble) were obtained from Dharmacon (Austin, TX, USA) and transfected with DharmFECT1 (Dharmacon, Austin, TX, USA) at a final concentration of 60 nM. [score:3]
These results were consistent with the expression levels of miR-27a and miR-24 (Figure 5E). [score:3]
To determine whether GATA-1 would influence the expression of miR-27a and miR-24, the primary and mature transcripts of miR-27a and miR-24 were evaluated in K562s transfected with siRNAs specific to GATA-1 or constructs overexpressing GATA-1 (Figure 1G). [score:3]
Similarly, inhibition of miR-27a or miR-24 resulted in increased GATA-2 occupancy and decreased GATA-1 binding with DNA sequences (Figure 6B and C). [score:3]
Enforced expression of miR-27a and miR-24 in mouse enhanced mature erythroid populations. [score:3]
The effect of GATA-1 on miR-27a and miR-24 expression in HPC erythroid differentiation was examined. [score:3]
These data suggested that the inhibition of GATA-2 could rescue the erythroid deficiency caused by miR-27a or miR-24 silencing. [score:3]
Figure 7. MiR-27a and miR-24 overexpression enhanced erythropoiesis in mice. [score:3]
Over -expression of miR-27a or miR-24 decreased the binding of GATA-2 and increased GATA-1 occupancy (Figure 6B and C). [score:3]
Our study demonstrates that GATA factors elaborately control the transcription of miR-27a and miR-24 and reveals a regulatory circuit that regulates the GATA-1/2 switch via miR-27a and miR-24 to promote erythroid maturation. [score:3]
MiR-27a and miR-24 co -targeted GATA-2 in erythrocytes. [score:3]
By the light of nature, we further demonstrated the GATA-1/miR-27a/24/GATA-2 regulatory circuit in human erythroid cells, representing the decoding of an expansive regulatory layer of GATA-1 and GATA-2. In details, GATA-2 localized to chromatin sites of the miRNA promoter and transcriptionally repressed miR-27a and miR-24 in early stage erythroblasts. [score:3]
As expected, treatment with miR-27a or miR-24 mimics increased the level of primary transcript in K562s, whereas repression of miR-27a or miR-24 by miRNA inhibitors decreased the level of pri-miRNA (Figure 6D). [score:3]
Suppression of miR-27a or miR-24 blocked erythroid differentiation in zebrafish. [score:3]
Figure 3. Suppression of miR-27a or miR-24 blocked erythroid differentiation in zebrafish. [score:3]
Animals that displayed miR-27a and miR-24 overexpression demonstrated an increase in region 3 (R3) of CD71 [low]/TER119 [high] erythrocytes and a concomitant decrease in region 1 (R1) of CD71 [high]/TER119 [high] erythroblasts from bone marrow and spleen (Figure 7A, B). [score:3]
Zebrafish demonstrate increased miR-27a and miR-24 levels during development and is a classic and reliable mo del to study haematopoietic gene function (Figure 3B). [score:2]
MiR-27a and miR-24 mediated a forward regulatory circuit composed of a GATA switch. [score:2]
A previous study reported the effect of miR-24 on zebrafish cardiac development (15). [score:2]
GATA-2 modulated the regulatory effects of miR-27a and miR-24 on erythroid differentiation. [score:2]
To analyse the roles of miR-27a and miR-24 in vivo, we used miRNA MOs to test whether the knock-down of endogenous miRNAs would affect zebrafish erythropoiesis. [score:2]
Figure 2. MiR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs. [score:1]
We speculate that miR-27a and miR-24 may serve at a ‘standby state’, which means they are ready for the manipulation by different cellular factors, as GATA-1 in erythropoiesis, c-MYC in tumour metastasis (33), Runx2 in osteoblast differentiation (28) and PU. [score:1]
Data from control (SCR, n = 3), miR-27a (n = 3) and miR-24 (n = 3) animals are shown as the means ± SD. [score:1]
As expected, miR-27a and miR-24 reduced luciferase gene activity by ∼50% and ∼30%, respectively. [score:1]
With the exception of observations from the activin -induced haematopoietic differentiation mo del (32), miR-27a and miR-24 have been constantly demonstrated increased accumulation as differentiation proceeds, which support the idea that activation of the miR-27a and miR-24 loci might be required for the terminally differentiated cells. [score:1]
Overall, the aberrant miR-27a or miR-24 levels fed back to positively modulate the level of their own primary transcripts. [score:1]
MiR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs. [score:1]
A conservation analysis of miR-27a and miR-24 sequences indicated that they are highly conserved among multiple species, including zebrafish (Figure 3A). [score:1]
A bioinformatic analysis showed that the GATA-2 3′ UTR has potential binding sites for both miR-27a and miR-24 (Figure 4A). [score:1]
Here, we demonstrate that the GATA-1/2 switch occurs at the common gene locus encoding miR-23a, miR-27a and miR-24. [score:1]
Thus, our attempt to investigate the regulatory mechanism of miR-27a and miR-24 during erythropoiesis led to the identification of another erythroid GATA member, GATA-2. Figure 4. GATA-2 was post-transcriptionally regulated by miR-27a and miR-24 during erythropoiesis. [score:1]
Meanwhile, in vitro and in vivo functional analyses indicated that miR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs, zebrafish and mice. [score:1]
Furthermore, q-PCR using specific Taqman probes revealed that pri-miR-23a∼27a∼24-2 and mature miR-27a, miR-24 and miR-23a were increased in EPO -driven erythroid differentiation of primary cultured human CD34+ HPCs (Figure 1D). [score:1]
These results suggested that miR-27a and miR-24 are required for erythroid differentiation during primitive haematopoiesis in zebrafish. [score:1]
Cell-counting analyses at different stages of differentiation showed an increase of mature erythroblasts (orthochromatic and erythrocyte) in miR-27a- or miR-24-transduced HPCs with a concomitant decrease of immature erythroblasts (basophilic and polychromatic erythroblasts) (Figure 2A and B). [score:1]
To test the roles of miR-27a and miR-24 in vivo, we conducted transplantation experiments in mice. [score:1]
Moreover, the miRNA-transduced HPCs generated larger colonies, when a typical BFU-E generated by GFP-transduced HPCs was ∼30∼60 μm, whereas the miR-27a- or miR-24 colonies were larger than 100 μm (Supplementary Figure S2E). [score:1]
MiR-27a and miR-24 display completely evolutionary conservation among eukaryotes and are organized in a cluster on chromosome 19 of the human genome. [score:1]
Additionally, a reduction in hbbe3 and scl staining was also observed in miR-27a and miR-24 MOs -injected embryos at 10 somites (Figure 3G), which suggested an impairment of early erythroid differentiation by miRNA MOs treatment. [score:1]
The miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:1]
For measurement of Pri-miR-27a∼24-2, miR-27a and 24 expression, q-PCR was performed using Taqman probes (Applied Biosystems, Foster City, CA, USA): pri-miR-27a∼24 (Hs03294931_pri), miR-27a (TM408), miR-24 (TM402), human GAPDH (Hs9999905_M1), RNU6B (TM1093) according to manufacturer’s instruction. [score:1]
To determine the effect of miR-27a and miR-24 on erythrocyte differentiation in adult haematopoietic tissues, a flow cytometry analysis was performed 8 weeks post-transplantation. [score:1]
As erythropoiesis proceeds, GATA-1 level increased, and GATA-1 displaced GATA-2 from their shared binding site, thus leading to transcriptional activation of miR-27a and miR-24 (Figure 6E). [score:1]
This cluster is composed of three members, miR-23a, miR-27a and miR-24, and has been linked to osteoblast differentiation, angiogenesis, cardiac remo delling, skeletal muscle atrophy and tumorigenesis (27–29). [score:1]
Taken together, these results demonstrated that miR-27a and miR-24 were required for the proper erythroid differentiation in primary cultured CD34+ HPCs. [score:1]
[1 to 20 of 58 sentences]
13
[+] score: 120
Other miRNAs from this paper: hsa-mir-24-2, hsa-mir-34a
Inverse correlation between HNF4A and both miR-24 and miR-34a expression levels in human liversTo verify the impact of miR-24 and miR-34a variations on HNF4Aand because substantial variability in the expression of HNF4A and its downstream coagulation genes targets remains unexplained, we analyzed ex vivo miRNA-mRNA correlations in human liver samples. [score:7]
[27, 28, 30]MiR-24 regulates coagulation factors by targeting HNF4AThe functional role of miR-24 in regulating HNF4α downstream targets was tested in HepG2 cells by transfecting with miRNA mimics. [score:7]
To study the possible indirect effect of miRNAs on coagulation factor expression, we selected two miRNAs, miR-24 and miR-34a, previously pointed as direct inhibitors of HNF4α [27, 30]. [score:7]
[27, 28, 30] MiR-24 regulates coagulation factors by targeting HNF4AThe functional role of miR-24 in regulating HNF4α downstream targets was tested in HepG2 cells by transfecting with miRNA mimics. [score:7]
In vitro study in HepG2 cellsTo study the possible indirect effect of miRNAs on coagulation factor expression, we selected two miRNAs, miR-24 and miR-34a, previously pointed as direct inhibitors of HNF4α [27, 30]. [score:7]
As shown in Fig 6A, liver samples with lower expression of miR-24 had significantly higher expression of HNF4A, F9, F11, PROS1 and PROZ. [score:5]
Expression range of miR-24 and miR-34a with HNF4A mRNA and its downstream targets in healthy livers. [score:5]
Of note, liver samples with extreme expression of miR-24 levels (percentiles 10 [th] and 90 [th]) were, in the opposite, those with utmost HNF4A and coagulation factors expression. [score:5]
Both miRNAs bind to several sites in human HNF4A, as described in Fig 3. While miR-34a interacts in three different sites located within HNF4A 3’UTR, miR-24 mostly inhibits HNF4α expression by binding to sites located within the coding region [27] (Fig 3). [score:5]
0154751.g006 Fig 6Expression range of miR-24 and miR-34a with HNF4A mRNA and its downstream targets in healthy livers. [score:5]
To verify the impact of miR-24 and miR-34a variations on HNF4Aand because substantial variability in the expression of HNF4A and its downstream coagulation genes targets remains unexplained, we analyzed ex vivo miRNA-mRNA correlations in human liver samples. [score:5]
Overall, these results confirmed the role of miR-24 and miR-34a in regulating HNF4α expression and showed a new trans-mechanism of regulation of several coagulation factors by miRNA through HNF4α. [score:5]
The idea that miR-24 and miR-34a gene regulation is mediating as a significant mechanism contributing to variation in gene expression has been previously documented. [score:4]
[27, 28, 30] The functional role of miR-24 in regulating HNF4α downstream targets was tested in HepG2 cells by transfecting with miRNA mimics. [score:4]
The bibliographic review ofstudies that experimentally validated HNF4A regulation by miRNA, conducted us to select miR-24 and miR-34a as indirect regulators candidates of several coagulation factors [27, 30]. [score:4]
Inverse correlation between HNF4A and both miR-24 and miR-34a expression levels in human livers. [score:3]
Our in vitro results showed that miR-24 and miR-34a had a significant impact on the expression of coagulation factors in HepG2 (Fig 4B). [score:3]
MiR-24 regulates coagulation factors by targeting HNF4A. [score:3]
A) Densitometric analysis of HNF4α protein expression transfected with SCR, miR-24, and miR-34a; representative western blot. [score:3]
Thus, these authors described that transient inhibition of HNF4A in an hepatocellular carcinoma mo del drives a feedback loop circuit through several inflammatory miRNAs, and among them miR-24 [34]. [score:3]
In summary, our results suggest that miR-24 and miR-34a participate in the interindividual variability observed in expression of coagulation factors genes in humans. [score:3]
Similarly, a wide variability was also observed for miR-24, as shown in Fig 1. Next, we analyzed the correlation between HNF4A expression and the same 9 coagulation factors in human livers. [score:3]
Moreover, our in vitro data supported a lower inhibitory effect for miR-24 in comparison with miR-34a, which might explain that only statistically significant values are found for liver samples from extreme percentiles (Fig 6). [score:3]
To quantify expression levels of miRNAs, commercial RT-PCR assays for miR-24, miR-34a, and U6 snRNA (endogenous control) from Life Technologies were used. [score:2]
In turn, we also confirmed here a regulatory connection between miR-24 and HNF4A, as Hatziapostolou et al did in samples from 12 healthy livers [34]. [score:2]
Takagi et al. were the first describing in vitro the regulation of HNF4α by miR-24 and miR-34a [30]. [score:2]
Our series of human liver samples extended to 104, and provide additional consequences for miR-24/ HNF4A interaction, as it had repercussions on the levels of coagulation factors transcripts. [score:1]
We found a slight inverse correlation between HNF4A and both miR-24 and miR-34a hepatic transcript levels (r = -0.170; p = 0.08 and r = -0.228; p<0.05; respectively) (Fig 5). [score:1]
HepG2 cells were transfected with 100 nM mimic precursors of miR-24, miR-34a or SCR. [score:1]
As expected, results from western blot analysis using whole cell lysates from HepG2 confirmed a decrease of 70% of HNF4α mediated by miR-24 (p = 0.01) (Fig 4A) and a decrease of 25% in mRNA levels (Fig 4B). [score:1]
Similarly to that seen for miR-24, western blot analysis of lysates from HepG2 showed a significant decrease of HNF4α (Fig 4A) and HNF4A mRNA (Fig 4B), as previously described [27, 30]. [score:1]
Dot plot diagram of HNF4A mRNA, selected coagulation factors and miR-24 (A) or miR-34a (B) levels in livers. [score:1]
P10 and p90 represent 10 [th] and 90 [th] percentiles of miR-24 (A) and miR-34a (B), respectively. [score:1]
HepG2 transfection with miR-24 caused a decrease in mRNA of all selected factors although such reduction was only statistically significant for F10, F12, PROS1 and SERPINC1 (Fig 4C). [score:1]
[1 to 20 of 34 sentences]
14
[+] score: 118
The expression of miR-24 due to sustained JNK activation may lead to a suppression of SR-B1, which in turn can potentially suppress JNK (ref). [score:7]
Taken together, our data reveal that JNK-miR-24 directly contributes to the suppression of Smad4 expression, which leads to a subsequent reduction of homeostatic negative regulator IRAK-M, in low-grade inflammatory monocytes programmed by super-low-dose LPS. [score:7]
Our data map out an integrated negative feedback circuit that involves JNK-miR-24 -mediated suppression of Smad4, which in turn leads to reduced expression of IRAK-M. The reduction of IRAK-M may allow sustained elevation of JNK and miR-24 in low-grade inflammatory monocytes programmed by super-low-dose LPS (Fig. 7a). [score:5]
Given the known role of IRAK-M in suppressing JNK activation and causing monocyte tolerance 13, we plan to further confirm that the disruption of IRAK-M may lead to non-resolving inflammatory monocyte polarization through sustained miR-24 expression. [score:5]
Indeed, we demonstrated that the selective JNK inhibitor SP600125 potently inhibited the induction of miR-24 in the CD11b [+]Ly6C [++] pro-inflammatory monocytes challenged by super-low-dose LPS (Fig. 5b). [score:5]
The levels of miR-24 expressed in splenocytes of HFD-fed ApoE [−/−]/ Irak-M [−/−] mice were significantly higher as compared with the miR-24 levels expressed in splenocytes of HFD-fed ApoE [−/−] mice (Fig. 7k). [score:4]
Our data complement these studies and further define molecular mechanisms responsible for the reduction of SR-B1 by super-low-dose LPS, through the upregulation of miR-24. [score:4]
However, our study serves as a key step to present at least the cardinal principle for the establishment of non-resolving low-grade inflammation, with a specific focus on the disruption of a cardinal negative feedback regulator IRAK-M mediated by sustained expression of miR-24. [score:4]
We demonstrated that the reduction in IRAK-M is also coupled to the reduction of SR-B1, aided by sustained activation of JNK and expression of miR-24. [score:3]
Given our above finding of sustained elevation of miR-24 mediated by chronic JNK activation, we tested whether elevated miR-24 may be critically responsible for the reduction of Smad4 mRNA and its downstream target IRAK-M. We observed that the application of miR-24 antagomir in cultured monocytes restored the RNA levels of both Smad4 and IRAK-M reduced by super-low-dose LPS (Fig. 6e,f). [score:3]
Bone marrow cells isolated from WT C57 BL/6 mice or IRAK-M [−/−] mice were cultured in RPMI 1640 medium supplemented with 10 % fetal bovine serum, 2 mM L-glutamine, 1% penicillin/streptomycin and with M-CSF (10 ng ml [−1]) in the presence of super-low-dose LPS (100 pg ml [−1]), and mirVana miR-24 antagomir (10 nM, Life Technologies, Carlsbad, CA) or JNK inhibitor SP600125 (10 μM, Sigma-Aldrich), was also added to the cell cultures in some experiments. [score:3]
We further tested whether the sustained JNK activation may be responsible for the elevated expression of miR-24 in polarized monocytes. [score:3]
We focused our attention to examine the pathophysiological relevance of miR-24 induction by super-low-dose LPS, as miR-24 is among the most highly expressed miRNAs previously observed in both human patients with familial hypercholesterolemia, as well as in HFD-fed ApoE -deficient mice 38. [score:3]
Subclinical-dose endotoxin selectively induces miR-24 that causes the reduction of negative feedback modulators of inflammation such as Smad4-IRAK-M, which in turn leads to sustained low-level activation of JNK, miR-24 and reduced expression of SR-B1. [score:3]
Polarized monocytes reduce SR-B1 expression through miR-24. [score:3]
In contrast, miR-24 mimic failed to exert its degradation effect on mutant SR-B1 target with defective miR-24 -binding site (Fig. 4g). [score:3]
Our data reveal that the reduction of SR-B1 and inflammatory monocyte polarization are critically coupled, due to the elevated expression of miR-24 by polarized inflammatory monocytes. [score:3]
To test the expression of miR-24 in living cells, 100 pM SmartFlare RNA probe of miR-24-3p (Millipore, Billerica, MA) was added to the cell cultures and incubated at 37 °C for 16 h. The cells were harvested and stained with anti-Ly6C, anti-Ly6G and anti-CD11b antibodies. [score:3]
We next searched the 3′-untranslated region (3′-UTR) of SR-B1 and found putative miR-24 -binding sites (Fig. 4e). [score:3]
Through flow cytometry analyses, we observed that super-low-dose LPS selectively induced the expression levels of miR-24 in the CD11b [+]Ly6C [++] pro-inflammatory monocytes (Fig. 4c). [score:3]
The expression levels of miR-24-3p within CD11b [+]Ly6C [++] monocytes were examined by flow cytometry. [score:3]
It is interesting to note that miR-24 is also among the most highly expressed miRs in plasma samples from human atherosclerosis patients 38. [score:3]
Suppression of SR-B1 in inflammatory monocytes by super-low-dose LPS is dependent on miR-24 induction. [score:3]
The disruption of the IRAK-M homeostatic circuit is due to miR-24 -mediated suppression of Smad4. [score:3]
Adoptive transfer of in vitro cultured murine monocytesBone marrow cells isolated from WT C57 BL/6 mice or IRAK-M [−/−] mice were cultured in RPMI 1640 medium supplemented with 10 % fetal bovine serum, 2 mM L-glutamine, 1% penicillin/streptomycin and with M-CSF (10 ng ml [−1]) in the presence of super-low-dose LPS (100 pg ml [−1]), and mirVana miR-24 antagomir (10 nM, Life Technologies, Carlsbad, CA) or JNK inhibitor SP600125 (10 μM, Sigma-Aldrich), was also added to the cell cultures in some experiments. [score:3]
Polarization of monocytes through reduction of Smad-4 and IRAK-M. Reduction of IRAK-M is due to miR-24 -mediated suppression of Smad4. [score:3]
Application of miR-24 antagomir in cultured BMM restored the expression levels of SR-B1 (Fig. 4d). [score:3]
Induced miRNAs including miR-24 and miR-29 by super-low-dose LPS identified through miRNAseq were listed in Supplementary Table 1. We further confirmed the elevated expression of miR-24 and miR-29 in HFD-fed ApoE -deficient mice conditioned with super-low-dose LPS as compared with PBS-conditioned control mice (Fig. 4a,b). [score:2]
RNA co-immunoprecipitation analyses showed direct association of miR-24 with the SR-B1 3′-UTR within the microprocessor complex (Supplementary Fig. 4). [score:2]
RNA co-immunoprecipitation analyses also showed direct association of miR-24 with the Smad4 3′-UTR within the microprocessor complex (Fig. 6k). [score:2]
Luciferase reporter assays demonstrated that miR-24 dose dependently reduced the SR-B1 target messenger RNA stability (Fig. 4f). [score:2]
To test the mechanism for miR-24 -mediated reduction of Smad4 and IRAK-M, we searched the 3′-UTR of Smad4 and IRAK-M, and found a highly conserved miR-24 -binding site in the 3′-UTR of Smad4 (Fig. 6i). [score:1]
Total miRs isolated from splenocytes were used for real-time reversre transcriptase–PCR analyses for the relative levels of miR-24 (a) and miR-29 (b). [score:1]
HEK293 cells were plated in 24-well clusters, then co -transfected with 500 ng constructs with or without miR-24 mimic. [score:1]
Fresh LPS, miR-24 antagomir and SP600125 was added to the cell cultures every 2 days. [score:1]
Likewise, the miR-24 antagomir also restored the protein levels of Smad4 and IRAK-M (Fig. 6g,h). [score:1]
Our data unravel that subclinical super-low-dose LPS programmes the sustained elevation of pJNK and miR-24 levels, to enable the non-resolving low-grade polarization of monocytes, due to the disruption of the Smad4-IRAKM negative feedback circuit both in vitro and in vivo. [score:1]
Fresh LPS, SP600125 and miR-24 antagomir was added every 2 days. [score:1]
The reduction of SR-B1 through elevated miR-24 may further facilitate the establishment of polarized inflammatory monocytes. [score:1]
Fluorescent RNA probe for miR-24-3p was added to the cell cultures 16 h before harvesting. [score:1]
Mean fluorescent intensity of miR-24 probe, phosphorylation of JNK and production of MCP-1 within the CD11b [+]/Ly6G [-]/Ly6C [+] inflammatory monocytes were determined by flow cytometry. [score:1]
A previous animal study also suggests that miR-24 may be correlated with lipid accumulation and hyperlipidemia 39. [score:1]
Our data further reveal the molecular mechanism for sustained reduction of IRAK-M, due to miR-24-triggered degradation of the transcription factor Smad4. [score:1]
[1 to 20 of 43 sentences]
15
[+] score: 107
Other miRNAs from this paper: hsa-mir-24-2
Disease free survival in patients stratified according to miRNA-24 expression below or above median. [score:5]
A. Disease free survival in patients stratified according to miRNA-24 expression below or above median. [score:5]
Correlation between miRNA-24 expression and TRIB3 mRNA and protein expression. [score:5]
C. Disease free survival in patients stratified according to tertiles miRNA-24 expression below 0.5×10 [−3], above 1.2×10 [−3] or in between. [score:5]
We could confirm that the only so far known TRIB3 specific micro RNA (miRNA-24) was upregulated during hypoxia in breast cancer cells. [score:4]
Therefore, we hypothesized that miRNA-24 could be involved in TRIB3 mRNA translational regulation during hypoxia. [score:4]
First we determined whether hypoxia indeed upregulates miRNA-24 levels in breast cancer cells during hypoxia. [score:4]
Martin et al. suggest that the passenger strand miR-24-2*, which does not bind TRIB3, might be involved in the opposing oncogenic and tumor suppressive roles of miRNA-24 [35]. [score:3]
So far the only experimentally validated miRNA that targets TRIB3 is miRNA-24 (miRWalk [3], [14]). [score:3]
0049439.g004 Figure 4 Expression levels (average +/− SD, n = 4) measured by RT-qPCR of miRNA-24 controlled for RNU6 expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours. [score:3]
miRNA-24 expression was detectable in all 94 available breast tumor samples. [score:3]
B. Overall survival in patients stratified according to miRNA-24 expression below or above median (0.9×10 [−3]). [score:3]
Furthermore, miRNA-24 did not show a relation with DFS or OS when the patient group was split according to expression levels into 2 groups at the median (P = . [score:3]
miRNA-24 expression after hypoxia. [score:3]
D. Overall survival in patients stratified according to tertiles miRNA-24 expression below 0.5×10 [−3], above 1.2×10 [−3] or in between. [score:3]
miRNA-24 expression in breast cancer cells during hypoxia. [score:3]
miRNA-24 expression in breast cancer patients. [score:3]
There was no difference in miRNA-24 expression between these groups (P = . [score:3]
Expression levels (average +/− SD, n = 4) measured by RT-qPCR of miRNA-24 controlled for RNU6 expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours. [score:3]
Hypoxia indeed caused an induction in miRNA-24 expression ranging from 2.4 to 6.5 fold (P = 0.029). [score:3]
However, miRNA-24 levels did not correlate with either mRNA or protein expression of TRIB3 in breast cancer patients. [score:3]
Furthermore, we used a patient cohort to investigate if miRNA-24 could mediate translational inhibition of TRIB3 mRNA, and whether the level of miRNA-24 itself has prognostic value in breast cancer. [score:3]
Breast cancer patient survival based on miRNA-24 expression levels. [score:3]
For this we quantified miRNA-24 expression in MDA-MB-231 breast cancer cells exposed for 24 hours to 0.5%, 0.2%, or 0.1% oxygen. [score:3]
Survival curves were generated using the method of Kaplan and Meier, after patients were categorized by miRNA-24 expression in either two or three equally sized groups, thus either at the p50, or at the p33 and p66. [score:3]
While miRNA-24 has previously been described as a cell type-specific oncogene and tumor suppressor [21], [32], [33], [34] we did not find any prognostic value for miRNA-24. [score:3]
Possibly, the induction of miRNA-24 at 0.1% oxygen precludes TRIB3 mRNA from being translated to TRIB3 protein. [score:3]
Analysis of the 3′UTR of TRIB3 using the prediction algorithm TargetScan revealed miRNA24 as a potential candidate [13], [25]. [score:3]
We found that miRNA-24 is hypoxia regulated in breast cancer cells, which is in line with what has been reported for other cell types [3], [15]. [score:2]
Associations of miRNA-24 expression levels with clinicopathological characteristics. [score:1]
There was no correlation between miRNA-24 levels and mRNA (r [s] = −. [score:1]
However, we did not find a relation between miRNA-24 and TRIB3 protein or mRNA. [score:1]
Next, we assessed whether an inverse correlation exists between miRNA-24 and TRIB3 mRNA or protein levels in breast cancer patients. [score:1]
7, Table 2), indicating that miRNA-24 could not explain the discrepancy in TRIB3 mRNA and protein levels in these patients. [score:1]
Although miRNA-24 was the miRNA with the lowest p-value (<. [score:1]
Thus, miRNA-24 is a potential candidate marker that could explain the opposite association of TRIB3 mRNA and protein with breast cancer prognosis. [score:1]
Thus, TRIB3 specific miRNAs such as miRNA-24 (miRWalk, [3], [14]) might attenuate TRIB3 protein levels even in the presence of high mRNA levels. [score:1]
miRNA-24 expression levels exhibited no association with any clinicopathological characteristic tested besides histological grade (grade I/II vs. [score:1]
The miRNA-24 levels were not log-normally distributed and therefore non-parametric statistical tests were used. [score:1]
[1 to 20 of 39 sentences]
16
[+] score: 93
These miRs were found to act on different levels; miR-214-3p, which is upregulated, directly targets β-catenin [40], miR-24-3p, which is downregulated, targets two different “β-catenin destruction complex” genes, APC and GSK3β (TarBase v7.0) [41]. [score:12]
c-myc was found to be upregulated in naive EV -treated TECs, whereas it was downregulated in TECs stimulated with anti-IL-3R-EVs, antago-miR-24-3p-EVs and pre-miR-214-3p-EVs, which is consistent with what is known on the integrated miR-24-3p and miR-214-3p interaction-network. [score:7]
In order to gain further insight into the mechanisms behind the differences in antago-miR-24-3p-EV and pre-miR-214-3p-EV in vivo effects, miR cargo was analyzed and their fold change is reported in Supplementary Table  3 and 4. Figure  7a, b shows how up -upregulated and downregulated miRs are distributed. [score:7]
Two of these, miR-214-3p, which directly targets β-catenin [40], and miR-24-3p, which targets two members of the “β-catenin interacting complex” (APC and GSK3β) [41] were chosen for the study. [score:6]
As shown in the Venn diagram (Fig. 7c), 4 miRs were downregulated in pre-miR214-3p-EVs, antago-miR-24-3p-EVs and in anti-IL-3R-EVs (Fig.   7c). [score:4]
miR-214-3p (red dot) was found to be significantly upregulated in antago-miR-24-3p EVs (foldchange: 3.80 ± 1.00). [score:4]
c Venn diagram of downregulated miRs, identified in anti-IL-3R-EVs, antago-miR-24-3p EVs and pre-miR-214-3p EVs, are reported. [score:4]
The diagram shows an overlap of common miRs across different EVs d Venn diagram of upregulated miRs identified in anti-IL-3R-EVs, antago-miR-24-3p EVs and pre-miR-214-3p EVs. [score:4]
In particular, pathways correlating with downregulated miRs shared by anti-IL-3R-EVs, pre-miR-214-3p-EVs and antago-miR-24-3p-EVs, or by anti-IL-3R-EVs and pre-miR-214-3p-EVs, or anti-IL-3R-EVs and antago-miR-24-3p-EVs were analyzed. [score:4]
miR-24-3p (red dot) was found to be downregulated (fold change: -2.17 ± 0.08). [score:4]
As shown in Fig.   5b, anti-IL-3R-EVs, antago-miR-24-3p- and pre-miR-214-3p-EVs failed to induce c-myc expression, unlike EVs. [score:3]
Moreover, a further and deeper comparison among pre-miR-214-3p-EV, antago-miR-24-3p-EV and anti-IL-3R-EV miR content led us to hypothesize that their overlapping anti-angiogenic effects might also depend on the combined action of a pattern of shared miRs (miR-222-3p, miR-16-5p, miR-484 for all EV samples; miR-19b-3p miR-17-5p, miR-196b-5p, miR-365b-5p for pre-miR-214-3p-EVs and anti-IL-3R-EVs; miR-106a-5p, miR-197-3p, miR-193b-3p for antago-miR-24-3p-EVs and anti-IL-3R-EVs) which may be involved in the regulation of a network of genes related to cancer development/progression. [score:3]
e, f Cell extracts from antago-miR-24-3p TECs (e) and from TECs, treated as above (f), were analyzed for pβ-catenin and β-catenin content, normalized to β-actin (n = 4) (* p < 0.05, for pβ-catenin and ** p < 0.01, for β-catenin, none vs antago-miR-24-3p in e, unpaired t-test, and ** p < 0.01, none and EVs vs anti-IL-3R-EVs and antago-miR-24-3p-EVs in f, one-way ANOVA) Fig. 5miR-24-3p and miR-214-3p integrated interaction-networks merge in c-myc a Network analysis between miR-24-3p/miR-214-3p and mRNA targets. [score:3]
The expression of miR-24-3p and miR-214-3p in EVs and anti-IL-3R-EVs was validated by real-time PCR (Fig.   3c). [score:3]
Antago-miR-24-3p depletion was confirmed by rt-PCR in cells and EVs (Supplementary Fig.   1c, d). [score:1]
TECs were transfected with antago-miR-24-3p and EVs (antago-miR-24-3p-EVs) were recovered. [score:1]
As shown in Fig.   6a, b, both pre-miR-214-3p-EVs and antago-miR-24-3p-EVs strongly reduced TEC-derived vessels in vivo. [score:1]
As shown in Fig.   4c, d, increased APC and GSK3β content was detected in both transfected cells and in antago-miR-24-3p-EV -treated TECs. [score:1]
Data are reported in the histogram as number ± SD of vessels per sample (*** p < 0.001, none and EVs vs others experimental conditions; ** p < 0.01, anti-IL-3R-EVs vs pre-miR-214-3p-EVs and pre-miR-214-3p-EVs vs antago-miR-24-3p-EVs + pre-miR-214-3p-EVs, one-way ANOVA) (20× magnification). [score:1]
Finally, our results suggest that miR-24-3p may be involved in the reverse epigenetic silencing of miR-214-3p, which moves to EVs from cells. [score:1]
The integrated miR-24-3p and miR-214-3p interaction-network identified c-myc as one of their downstream nodes (Fig.   5a). [score:1]
It was then decided to analyze the expression of phosphorylated and unphosphorylated β-catenin in total cell lysates in TECs treated with EVs and anti-IL-3R-EVs in order to investigate the possibility that miR-24-3p and miR-214-3p, carried by anti-IL-3R-EVs, may interfere with the β-catenin signaling pathway. [score:1]
Moreover, it is demonstrated that the effects of anti-IL-3R-EVs may be recapitulated by transfecting cells with antago-miR-24-3p-EVs or using EVs that are depleted of miR-24-3p to stimulate TECs. [score:1]
g Cytoplasmic extracts from untreated or treated TECs, as indicated, were immunoprecipitated with anti-β-TrCP antibody, subjected to SDS–PAGE and immunoblotted with anti-β-catenin and anti-β-TrCP antibodies (*** p < 0.001, none and EVs vs anti-IL-3R-EVs, one-way ANOVA) APC and GSK3β, known miR-24-3p targets, were evaluated to gain further insight into the anti-IL-3R-EV mechanism of action. [score:1]
Moreover, we found that miR-16-5p, commonly shared by pre-miR-214-3p-EVs, antago-miR-24-3p-EVs, and in anti-IL-3R-EVs significantly correlated with 4 out of the 5 pathways identified by DIANA miR path software. [score:1]
c, d Cytoplasmic extracts from TECs depleted of miR-24-3p (antago-miR-24-3p) (c) and from TECs treated with antago-miR-24-3p-EVs (d) were analyzed by Western blot for APC and GSK3β content (** p < 0.01, none vs antago-miR-24-3p in (c), unpaired t-test, and ** p < 0.01, EVs vs anti-IL-3R-EVs and antago-miR-24-3p-EVs in d, one-way ANOVA). [score:1]
Scale bars indicate 50 μm Fig. 7miR distribution in antago-miR-24-3p-EVs and pre-miR-214-3p-EVs. [score:1]
In order to collect EVs, depleted of miR-24-3p or enriched in miR-214-3p, loss-of-function and gain-of-function experiments were performed in TECs, as previously described [22, 64]. [score:1]
RNA, from cells and EVs, was then retro-transcribed using TaqMan microRNA RT kits, specific for miR-214-3p and miR-24-3p, and subjected to quantitative real-time PCR (qRT–PCR) [64]. [score:1]
b TECs treated as indicated were lysed and analyzed for c-myc content, normalized to β-actin content (n = 5) (** p < 0.01, none and EVs vs anti-IL-3R-EVs, antago-miR-24-3p-EVs and pre-miR-214-3p-EVs, one-way ANOVA) Functional studies were performed in vivo to confirm the above data. [score:1]
Although we cannot exclude the possibility that EV inducing effects may depend largely on the combination of all the miRs taken together, a comparison of the miR carried by antago-miR-24-3p-EVs, pre-miR-214-3p-EVs, anti-IL-3R-EVs and their functional activity would appear to point to the crucial role played by selective enrichment pathways. [score:1]
miR-24-3p (red dot) was found to be almost unmodulated in pre-miR-214-3p-EVs (foldchange: 0.26 ± 0.14). [score:1]
Of note, miR-16-5p, commonly shared by pre-miR-214-3p-EVs, antago-miR-24-3p-EVs, and anti-IL-3R-EVs significantly correlated with 4 of the above pathways. [score:1]
However, it was found that, unlike antago-miR-24-3p-EVs, pre-miR-214-3p-EVs were less effective in reducing vessel growth than anti-IL-3R-EVs, while the combo treatment completely recapitulated the anti-IL-3R-EV anti-angiogenic effect. [score:1]
Such significant correlation was also found for miR-17-5p (in pre-miR-214-3p-EVs) and miR-193b-3p (in antago-miR-24-3p-EVs). [score:1]
miR-214-3p and miR-24-3p are both involved in anti-IL-3R-EV-antiagiogenic effects. [score:1]
It is worth noting that antago-miR-24-3p-EVs were found to be enriched in miR-214-3p (Fig.   7a), while no changes in miR-24-3p content were detected in pre-miR-214-3p-EVs (Fig.   7b). [score:1]
As a matter of fact, antago-miR-24-3p-EVs, which were enriched in miR-214-3p, were also much more effective in their anti-angiogenic action than pre-miR-214-3p-EVs. [score:1]
DIANA miR path software was therefore interrogated to identify the most relevant pathways which, along with Wnt-β-catenin, may contribute to the overlapping of the anti-angiogenic effects detected in antago-miR-24-3p-, pre-miR214-3p-, and anti-IL-3R-EV -treated animals (Fig.   6b). [score:1]
[1 to 20 of 39 sentences]
17
[+] score: 90
Firstly, miR-24, −30b or −142-3p downregulate expression of multiple FcRs that plays important role in antigen uptake and presentation (Naqvi A. R, In press) 21. [score:6]
Overexpression of miR-24, miR-30b, and miR-142-3p suppress type I cytokines by DCs. [score:5]
In our previous study we observed reduced expression of both mannose receptor and scavenger receptors (MSR1 and MARCO) in miR-24, −30b or −142-3p overexpressing DC and MΦ 20. [score:5]
Enforced expression of miR-24, miR-30b, and miR-142-3p in untreated MΦ significantly induced (~1.5–2 fold) CD86 expression (Fig. 5a,b). [score:5]
Marked induction (~2–4.5 fold) in PD-L1 expression was observed in miR-24, miR-30b, and miR-142-3p overexpressing cells compared to control mimic (Fig. 5a). [score:4]
We have recently shown that down-regulation of miR-24, -30b and -142-3p during MΦ and DC differentiation is necessary for acquisition of the functional phenotype 19. [score:4]
Flow cytometric analysis showed antigen processing was reduced to approximately 22%, 38% and 40% in DC overexpressing miR-24, miR-30b and miR-142-3p, respectively (Fig. 1g–j). [score:3]
Time kinetics of antigen uptake and processing in miR-24, miR-30b, and miR-142-3p overexpressing APCs. [score:3]
miR-24, miR-30b, and miR-142-3p induce PD-L1 expression in APCs. [score:3]
Impaired T-cell proliferation by MΦ and DC overexpressing miR-24, miR-30b and miR-142-3p. [score:3]
We examined the time kinetics of these pathways by analyzing cells at three different time points: 1.5, 6 and 18 h. In MΦ, antigen uptake as well as antigen processing was markedly inhibited by miR-24, −30b and −142-3p across the time points examined (Fig. 2a). [score:3]
As miRNA-target interaction is sequence specific, we examined the sequence conservation of miR-24, −30b and −142-3p in human and mice analogs. [score:3]
MΦ and DCs overexpressing miR-24, miR-30b, and miR-142-3p are defective in antigen processing. [score:3]
MiR-24, miR-30b, and miR-142-3p mimics or inhibitors were purchased from Qiagen (Gaithersburg, MD, USA). [score:3]
Time kinetics of antigen uptake and processing in MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p. [score:3]
In this study we demonstrate an inhibitory effect of miR-24, miR-30b, and miR-142-3p on the uptake as well as processing of Ova by APCs. [score:3]
PD-L1 surface expression is induced in miR-24, miR-30b, and miR-142-3p transfected MΦ and DC. [score:3]
Taken together, these results show that Th1 activation -associated cytokine profiles are suppressed in DC transfected with miR-24, miR-30b, and miR-142-3p. [score:3]
MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p exhibit impaired antigen processing. [score:3]
Our results show that CD4+ T-cells co-cultured with APCs overexpressing miR-24, −30b or −142-3p mimics are less efficient in secreting IFN-γ and TNF-α cytokines in the presence of Ova as well as reduced IFN-γ levels in assays performed with Th1 inducing antigen derived from CMV. [score:2]
MΦ transfected with miR-24, miR-30b and miR-142-3p mimics show reduced green signal compared to control mimics (Fig. 1a) suggesting impaired antigen processing upon enforced expression of the miRNA mimics. [score:2]
Overall, our results highlight novel mechanistic insights through which miR-24, miR-30b and miR-142-3p can regulate activation of adaptive immune responses guided by APCs. [score:2]
These results lend support to our hypothesis that in myeloid inflammatory cells, miR-24, −30b and −142-3p predominantly regulate critical components of cytoskeleton dynamics leading to altered cell morphology resulting in significant impairment of their capacity to efficiently process and present antigen to T-cells. [score:2]
In MΦ, overexpression of miR-24, −30b or −142-3p reduced CD4+ T-cell proliferation by ~56%, 46%, 44%, respectively, compared to control mimic (Fig. 3c). [score:2]
Compared to control mimic, no significant differences were noted in the presence of miR-24, miR-30b or miR-142-3p inhibitor (Fig. 1e). [score:2]
On the other hand, DCs transfected with miR-24, −30b or −142-3p showed ~38%, 45% and 48% reduction in T-cell proliferation (Fig. 3c). [score:1]
We therefore examined the impact of miR-24, miR-30b and miR-142-3p on antigen processing by MΦ and DC. [score:1]
Day 7 cultured BMDCs were transfected with murine analogs of miR-24, −30b, −142-3p or control mimic. [score:1]
Overall, these results clearly show miR-24, −30b, and −142-3p mediated impairment of antigen uptake and processing in APCs. [score:1]
We first tested whether murine analogs of miR-24, −30b and −142-3p can impact antigen processing. [score:1]
How to cite this article: Naqvi, A. R. et al. miR-24, miR-30b and miR-142-3p interfere with antigen processing and presentation by primary macrophages and dendritic cells. [score:1]
miR-24, miR-30b, and miR-142-3p impair Ova specific T-cell proliferation. [score:1]
Time kinetics of Ova uptake and processing reveals a similar impact of miR-24, −30b, and −142-3p on antigen uptake and processing by MΦ and DC at the early time points of 1.5 and 6 hr. [score:1]
Impaired T-cell activation and proliferation by miR-24, miR-30b, and miR-142-3p transfected APCs. [score:1]
We next examined the impact of PD-L1 blocking on T cell proliferation by miR-24, miR-30b, and miR-142-3p. [score:1]
[1 to 20 of 35 sentences]
18
[+] score: 88
Returning to the environmental component of this study, it was noted that while miR-24 expression is downregulated by LPS—an observation that is consistent with the downregulation of many other anti-inflammatory molecules by this stimulus—it was not observed when the CSE -modified version was used. [score:9]
In our own study of three miRNAs (miR-24, miR-30b, and miR-142-3p) whose expression were downregulated during MΦ differentiation and in response to LPS, and whose inhibitory potential are comparable, we have not observed synergy in their action (14). [score:8]
While the effect of miR-142-3p appears to be mediated, at least in part, through its direct targeting of PKCα, neither miR-24 nor miR-30b directly targets PKCα. [score:7]
This study not only supports a role for miR-24 in regulating the transition between M1 and M2 states, but also differential miR-24 expression as a route through which environmental changes are translated into changes in MΦ function. [score:6]
We have previously reported that enforced expression of miR-24, miR-30b, or miR-142-3p in activated MΦs inhibits their production of(p40) (11, 13). [score:5]
While our findings revealed the inhibitory capacity of miR-24/30b/142-3p mimics on MΦ cytokine production, the use of corresponding miRNA inhibitors did not reveal any enhancement of cytokine production. [score:5]
While our own studies indicate p110δ as being the mediator of miR-24 -mediated M1/M2 regulation, Banerjee et al. identified C/EBP-δ as the target of let-7c. [score:4]
This attenuation is associated with reduced production of,, andp40, which suggests that our own findings of miR-24/30b/142-3p mediated suppression of these cytokines may be relevant to IRI (11, 13), and by extension, the hemorrhagic and septic shock that causes IRI. [score:3]
For example, miR-24 inhibited LPS -induced either completely, partially, or not at all, depending on the particular set of cytokines used for M1-induction. [score:3]
For example, we have extensively characterized the inhibitory effects of miR-24, miR-30b, and miR-142-3p expression on myeloid inflammatory cell viz. [score:3]
Enforced expression of miR-24 in MΦs reduced the observed enhancement of pro-inflammatory cytokine production in M1 MΦs. [score:3]
We postulate that the maintenance of miR-24 expression with CSE -modified LPS likely contributes to its reduced inflammatory potential. [score:3]
These modifications in M1/M2 polarization and plasticity were not complete, which is to say that not all M1/M2 -associated changes were affected by the enforced expression of miR-24. [score:3]
At the same time, enforced expression of miR-24 enhanced the ability of to generate M2 MΦs. [score:3]
In a finding similar to our own description of miR-24, the authors also found that enforced expression of let-7c diminished the M1 phenotype while promoting M2 polarization. [score:3]
These findings are similar in effect to our own in vitro work on miR-24, which used as the stimulus for alternative activation, and also demonstrated an M2 bias when its expression was enforced (13). [score:3]
Our own investigations into miRNA -mediated regulation of APC functionality have focused on the enforced expression of miR-24/30b/142-3p in human monocyte-derived APC (MΦ/DC)—T cell co-cultures (63). [score:2]
Our previous studies had focused on the role played by miR-24 in MΦ activation and had revealed it to be a negative regulator of TLR -mediated pro-inflammatory cytokine production (11, 13). [score:2]
We have studied the capacity of miR-24 to regulate MΦ plasticity in the context of the interaction between the host (MΦ), pathogen (bacteria), and environment (cigarette smoke) (12). [score:2]
This convergence/divergence is mirrored by our studies on miR-24, miR-30b and miR-142-3p mediated cytokine regulation. [score:2]
This is also an area where convergent miRNA regulation appears to exist, as these same studies identified a very similar phenotype for miR-24 and miR-30b to that of miR-142-3p. [score:2]
We have previously described miR-24, miR-30b, and miR-142-3p -mediated regulation of MΦ phagocytosis (13, 71). [score:2]
Our studies have revealed a similar, but less pronounced, impact on these same functions for miR-24/30b/142-3p. [score:1]
Let-7c and miR-24 favors M2 phenotype while miR-155 and miR-223 can repolarize M2 MΦ toward M1 phenotype. [score:1]
Taken together, our studies on miR-24, miR-30b, and miR-142-3p may provide a route toward novel therapies aimed at treating chronic inflammatory disorders. [score:1]
Furthermore, an additional component of the attenuated IRI in these miR-155 KO mice was a reduction in Th17 differentiation and IL-17 production—another property we have described for miR-24/30b/142-3p (63). [score:1]
Human and murine miR-24 and miR-142-3p possess 100% sequence homology, while miR-30b differs in 2 of its nucleotides. [score:1]
[1 to 20 of 27 sentences]
19
[+] score: 87
Another observation shows that in a single subtype of human Treg cells, different microRNAs can target the 3′-UTR of the same gene (FoxP3 is targeted by miR-24, −31, −210 and −335, CTLA-4 is targeted by miR-9 and −155, and GARP is targeted by miR-24 and −335). [score:9]
The GARP 3′-UTR is directly targeted by miR-24 and −335Analysis of reporter luciferase activity in HEK293 T cells co -transfected with the GARP 3′-UTR, wild-type or miRNA site- deleted, and either miR-24 (Figure  4C) or miR-335 (Figure  4D), showed a direct and specific targeting of the GARP 3′-UTR by these miRNAs, leading to reduced luciferase expression. [score:9]
of miR-24 and −335 in Treg cells significantly reduces GARP expressionEfficient ex vivo transduction of Treg cells using lenti-miR-24 and lenti-miR-335 (Figure  5) showed that miR-24 and −335 expression significantly reduced GARP expression levels by 3.21- and 1.96-fold, respectively (Figure  6C). [score:7]
Analysis of reporter luciferase activity in HEK293 T cells co -transfected with the GARP 3′-UTR, wild-type or miRNA site- deleted, and either miR-24 (Figure  4C) or miR-335 (Figure  4D), showed a direct and specific targeting of the GARP 3′-UTR by these miRNAs, leading to reduced luciferase expression. [score:6]
MiR-24 (C) and miR-335 (D) specifically targets GARP 3′UTR and negatively regulate luciferase reporter expression. [score:6]
Our experiments show that miR-24 and −335 specifically bind to the GARP 3′-UTR and directly regulate GARP expression in primary human CD8 [+] natural Treg cells. [score:5]
Efficient ex vivo transduction of Treg cells using lenti-miR-24 and lenti-miR-335 (Figure  5) showed that miR-24 and −335 expression significantly reduced GARP expression levels by 3.21- and 1.96-fold, respectively (Figure  6C). [score:5]
We found that the 3′-UTR of FOXP3 contained miRNA target sites for miR-24, −31, −210 and −335, which were all underexpressed in CD8 [+]CD25 [+] natural Treg cells compared with CD8 [+]CD25- T cells. [score:4]
Importantly, we have previously shown that miR-24, miR-210 and miR-31 [68, 69] negatively regulate the expression of FOXP3 in human T cells. [score:4]
The GARP 3′-UTR is directly targeted by miR-24 and −335. [score:4]
Lentiviral transduction of miR-24 and −335 in Treg cells significantly reduces GARP expression. [score:3]
QuikChange site-directed mutagenesis were performed using the following primers (5′ to 3′): FOXP3 (miR-335 site deleted 3′UTR): GCCCCCCAGTGGGTGTCCCGTGCAG (forward) CTGCACGGGACACCCACTGGGGGGC (reverse) CTLA-4 (miR-9 site deleted 3′UTR): GGGAATGGCACAGCAGGAAAAGGG (forward) CCCTGCCTTTTCCTGCTGTGCCATTCCC (reverse) CTLA-4 (miR-155 site deleted 3′UTR), GGGATTAATATGGGGATGCTGATGTGGGTCAAGG (forward) CCTTGACCCACATCAGCATCCCCATATTAATCCC (reverse)GARP 3′UTR 2070-bp encompassing the miR-24 and −335 potential target sites were cloned downstream the Firefly luciferase gene (AsiSI/Xho1 sites) in the pEZX-MT01 plasmid (Labomics, Nivelles, Belgium) and designed as pEZX-MT01 3′-UTR WT. [score:3]
Figure 3 Differential expression of miR-24, −335, −155, −31, −210, −449, −509, −214, −205 and −9 between CD8 [+] CD25 [+] nTregs and CD8 [+] CD25 [−] T cells. [score:3]
QuikChange site-directed mutagenesis were performed using the following primers (5′ to 3′): FOXP3 (miR-335 site deleted 3′UTR): GCCCCCCAGTGGGTGTCCCGTGCAG (forward) CTGCACGGGACACCCACTGGGGGGC (reverse) CTLA-4 (miR-9 site deleted 3′UTR): GGGAATGGCACAGCAGGAAAAGGG (forward) CCCTGCCTTTTCCTGCTGTGCCATTCCC (reverse) CTLA-4 (miR-155 site deleted 3′UTR), GGGATTAATATGGGGATGCTGATGTGGGTCAAGG (forward) CCTTGACCCACATCAGCATCCCCATATTAATCCC (reverse) GARP 3′UTR 2070-bp encompassing the miR-24 and −335 potential target sites were cloned downstream the Firefly luciferase gene (AsiSI/Xho1 sites) in the pEZX-MT01 plasmid (Labomics, Nivelles, Belgium) and designed as pEZX-MT01 3′-UTR WT. [score:3]
Figure 5 Differential expression of miR-24, −335, −155 and −9 in CD8 [+] CD25 [+] natural Treg cells after transduction by lenti-miR-24, −335, −155 and −9. [score:3]
Similarly, we found miR-24 and miR-335 target sites in the GARP 3′-UTR. [score:3]
Relative miR-24 and GARP expression in CD8 [+]CD25 [+] Treg cells transduced by lenti-miR-24 compared with CD8 [+]CD25 [+] Treg cells transduced by lenti-miR-Ctrl, as determined by relative qRT-PCR. [score:2]
MiR-9, miR-24, miR-155 and miR-335 detection by TaqManTaqMan miRNA assays (Applied Biosystems) used the stem loop method [64, 65] to detect the expression level of mature miR-9, miR-24 miR-155 and miR-335. [score:2]
TaqMan miRNA assays (Applied Biosystems) used the stem loop method [64, 65] to detect the expression level of mature miR-9, miR-24 miR-155 and miR-335. [score:2]
PCR primers used for amplification of the FOXP3 and CTLA-4 3′-UTR were as follows (5′ to 3′): FOXP3 primers: GCGCCTCGAGTCACCTGTGTATCTCACGCATA (forward) GCGCGAATTCGAGCTCGGCTGCAGTTTATT (reverse) CTLA-4 primers: GCGCCTCGAGAGGAGCTCAGGACACTAATA (forward) GCGCGAATTCAATTGGGCCCATCGAACT (reverse) QuikChange site-directed mutagenesis (deletion) of miR-9, miR-24, miR-155 and miR-335 target sites in psiCHECK 3′-UTR WT was performed according to manufacturer's protocols (Stratagene, La Jolla, CA) and designated as psiCHECK-UTR del. [score:1]
PCR primers used for amplification of the FOXP3 and CTLA-4 3′-UTR were as follows (5′ to 3′): FOXP3 primers: GCGCCTCGAGTCACCTGTGTATCTCACGCATA (forward) GCGCGAATTCGAGCTCGGCTGCAGTTTATT (reverse) CTLA-4 primers: GCGCCTCGAGAGGAGCTCAGGACACTAATA (forward) GCGCGAATTCAATTGGGCCCATCGAACT (reverse) QuikChange site-directed mutagenesis (deletion) of miR-9, miR-24, miR-155 and miR-335 target sites in psiCHECK 3′-UTR WT was performed according to manufacturer's protocols (Stratagene, La Jolla, CA) and designated as psiCHECK-UTR del. [score:1]
Reporter plasmids (psiCHECK, psiCHECK 3′-UTR WT, psiCHECK 3′-UTR deleted, pEZX-MT01, pEZX-MT01 3′-UTR GARP WT, pEZX-MT01 GARP 3′-UTR deleted) (100 ng) were co -transfected in HEK293T and HeLa cells along with miR-9, miR-24, miR-155, and miR-335 -mimic/miR -negative control -mimic at a final concentration of 10 μM (mirVana miRNA mimic, Life Technologies, Gent, Belgium) and control firefly plasmid pGL3-CMV for the psiCHECK vectors only (100 ng) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's gui delines. [score:1]
MiR-9, miR-24, miR-155 and miR-335 detection by TaqMan Real-time PCR. [score:1]
[1 to 20 of 23 sentences]
20
[+] score: 79
The aims of the present study were to: 1) perform a systematic investigation of the expression of ten candidate miRNAs (miR-22, miR-24, miR-31, miR-106a, miR-125b, miR-137, miR-205, miR-214, miR-221, miR-410) in human HF samples; 2) correlate these data with corresponding HF mRNA expression levels; and 3) test the identified target genes for enrichment in pathways and protein networks in order to delineate regulatory interactions in the human HF. [score:6]
In the miRWalk2.0 [12] and TargetScan7.0 [13] analyses, 40%, 62%, and 42% respectively of the identified target genes for miR-24, miR-31 and miR-106a were not predicted by either tool. [score:5]
Expression in the human HF was confirmed for seven of the ten candidate miRNAs, and numerous target genes for miR-24, miR-31, and miR-106a were identified. [score:5]
Furthermore, significant correlations with miR-24 expression were observed for six collagen genes. [score:3]
Intriguingly, ten of the identified target genes were shared between miR-31, miR-24, and miR-106a, suggesting that they may be critical points in the signalling cascades that control HF biology. [score:3]
The present study also detected an enrichment of miR-24 target genes in the hormone signalling cascades ‘Gonadotropin Releasing Hormone (GnRH) Receptor Pathway’, and ‘Androgen Signalling’. [score:3]
Fig. 1Overview of all target genes with a significant correlation to miR-24, miR-31, and miR-106a. [score:3]
MiR-31, miR-24 (i. e., miR-24-3p, miR-24-2-5p), and miR-106a shared the following ten target genes: FZD7, JUN, MEIS2, TAX1BP3, RBM17, SFRP1, TP63, SMARCA4, COL17A1, and ZCCHC11. [score:3]
MiR-24 and miR-106a shared a total of 21 target genes. [score:3]
Significant correlation between miRNA and mRNA expression was observed for miR-24, miR-31, miR-106a, and miR-221. [score:3]
No overlap was found for miR-221 and the three remaining miRNAs In the investigation of a potential enrichment of miRNA target genes in biological pathways, IPA revealed the strongest enrichment of the respective target genes in ‘Hepatic Fibrosis/Hepatic Stellate Cell Activation’ (miR-24), and ‘JAK/STAT Signalling’ (miR-31 and miR-106a). [score:3]
Previous functional studies have demonstrated hair coat thinning and abnormal HF morphogenesis in mice that overexpress miR-24 in basal keratinocytes. [score:3]
The present pathway analysis also revealed an enrichment of miR-24 target genes in ‘Integrin Signalling’. [score:3]
The strongest mean log [2] expression (log [2]_value) was found for miR-205 (log [2]_value = 3.73 ± 0.01), and miR-24 (log [2]_value = 3.69 ± 0.03). [score:3]
In the PANTHER analysis, ‘Integrin Signalling’ was the top pathway for the target genes of miR-24, miR-31 and miR-106a. [score:3]
For miR-24 (i. e., miR-24-3p, miR-24-2-5p), correlation analysis revealed a total of 106 unique target genes. [score:3]
Prediction of significantly correlated target genes of miR-24, miR-31, miR-106a, and miR-221. [score:3]
For miR-24, miR-31, and miR-106a several target genes and pathways of interest were identified (Table  1). [score:3]
The highest number of target genes was identified for miR-24. [score:3]
PPIs of significantly correlated target genes a miR-24; b miR-106a; and c miR-31. [score:3]
Significantly correlated target genes of miR-24, miR-31, miR-106a, and miR-221. [score:3]
The same ten target genes were shared between miR-31 and miR-24. [score:3]
Taken together, these data suggest that miR-24 is an important regulator of hair morphogenesis and maintenance, which achieves its effect via the control of integrin and collagen signalling. [score:2]
These results suggest that integrin signalling is an essential pathway for keratinocyte differentiation in the human HF, and that this is controlled by miR-24. [score:1]
Ten genes (FZD7, JUN, MEIS2, TAX1BP3, RBM17, SFRP1, TP63, ZCCHC11, COL17A1, SMARCA4) were significantly correlated with miR-24, miR-31, and miR-106a (Fig.   1, Additional file 1: Table S1). [score:1]
For miR-24 (i. e., miR-24-3p, miR-24-2-5p), a significant correlation was found with 106 genes: n = 74, negatively correlated (neg. [score:1]
Previous research has identified miR-24 as an anti-proliferative miRNA, which promotes keratinocyte differentiation via the modulation of actin filaments [15], and plays a role in hair morphogenesis [6]. [score:1]
[1 to 20 of 27 sentences]
21
[+] score: 70
Recent miRNA studies on human leukemia cell lines, namely K562 cells, differentiated to megakaryocytes or erythrocytes and HL60 cells differentiated to macrophages or monocytes provided compelling evidence for an up-regulation of miR-24 that leads to a down-regulation of its target H2AX, consequently suppressing efficient DNA repair (Lal et al., 2009). [score:11]
To confirm that miR-24 can effectively target and suppress H2AX formation, we additionally overexpressed miR-24 in the human T-cell line Jurkat E6.1 and monitored the consecutive down-regulation of H2AX. [score:10]
As for technical reasons neither overexpression nor knockdown of miRNAs is possible in resting CD8 [+]CD28 [+] and CD8 [+]CD28 [−] T cells, we overexpressed miR-24 in the human leukemic T-cell lymphoblast line Jurkat E6.1. [score:6]
To confirm H2AX as a cellular target of miR-24, we overexpressed miR-24 in the lymphoblast T-cell line Jurkat E6.1. [score:5]
We noted decreased expression of the histone H2A family member X (H2AX), a validated target of miR-24 (Lal et al., 2009; Srivastava et al., 2011), in CD8 [+]CD28 [−] T cells. [score:5]
To be able to study whether changes in miR-24 and H2AX expression were accompanied by alterations of DDR signaling events in CD8 [+]CD28 [−] T cells, DNA damage was induced in isolated CD8 [+] T-cell subsets by etoposide, a classic chemotherapeutic agent that targets topoisomerase II. [score:5]
Forty-eight-hour post-transfection miR-24 levels were strongly up-regulated (Fig. 2). [score:4]
We were particularly interested in the regulation of miR-24, as it targets the H2AX, an important mediator of DSB repair (Lal et al., 2009; Srivastava et al., 2011). [score:4]
To provide definite evidence that there is a connection between miR-24 and the reduction of DDR signaling in CD8 [+]CD28 [−] T cells, the overexpression or the knockdown of miR-24 in resting CD8 [+] T cells would be necessary. [score:4]
Fig. 2(A) miR-24 overexpression in the human leukemic T-cell lymphoblast line Jurkat E6.1. [score:3]
The bar graph shows the relative miR-24 expression normalized to GAPDH; mean fold-ratios ± SEM; n = 5; ** P ≤ 0.01; CD8 [+]CD28 [−] versus CD8 [+]CD28 [+]. [score:3]
The bar graph shows the relative miR-24 regulation normalized to GAPDH 48-h post-transfection; mean log [2]-ratios ± SEM; n = 4; *** P ≤ 0.001; miR-24 Mimic versus controls. [score:2]
750 ng (3 μL of 20 μ m stock) miR-24 miScript miRNA mimic (Qiagen, Hilden, Germany) was diluted in 100 μL medium without serum or antibiotics before adding 4 μL Attractene transfection reagent (Qiagen). [score:1]
Total RNA was extracted from untreated and etoposide -treated CD8 [+]CD28 [+] and CD8 [+]CD28 [−] T cells/Jurkat cells and cDNA was synthesized by applying the miRCURY LNA Universal real-time (RT) system (Exiqon) for evaluation of miR-24 expression. [score:1]
Transfection of Jurkat E6.1 cells with miR-24. [score:1]
Cells were either left untreated (Control) or transfected with empty (Mock), nonsense miRNA (Scrambled), or miR-24 Mimic-filled transfection complexes. [score:1]
We therefore validated our array data on miR-24 by quantitative RT–PCR (Fig. 1B). [score:1]
Data represent fluorescence in individual lanes as percentages of total fluorescence in the whole blot; means ± SEM; n = 4; * P ≤ 0.05; miR-24 Mimic versus controls. [score:1]
Nevertheless, it is an intriguing hypothesis that increased miR-24 levels resulting in decreased H2AX in CD8 [+]CD28 [−] T cells lead to an impairment in the spreading of DNA repair foci along the chromatin (Fig. 4C). [score:1]
The possibility that an attenuated DDR is independent of miR-24 can therefore not be excluded. [score:1]
[1 to 20 of 20 sentences]
22
[+] score: 70
Concomitant inhibition of let-7f and miR-24 resulted in a significant (P<0.05) increase in Luc expression relative to cells transfected with let-7f or miR-24 inhibitor alone (Fig. 3f), suggesting that let-7f also acts cooperatively to regulate gene expression. [score:10]
To determine whether RSV G protein affected expression of the validated miRNAs (Fig. 1), A549 cells were infected (m. o. i. of 1) with recombinant RSV (6340WT) or with a recombinant RSV mutant virus lacking the G gene (RSVΔG), and expression of let-7f, miR-337, miR-520a, miR-26b and miR-24 was determined at 24 h p. i. Both 6340WT and RSVΔG replicated to similar levels over the short period of infection; however, in the absence of the G protein gene (RSVΔG), expression of let-7f was significantly (P<0.001) lower, whilst levels of miR-337 and miR-24 were significantly (P<0.05) upregulated (Table 1 and Fig. 2a). [score:10]
These results indicated that RSV G protein expression was associated with let-7f induction but repressed miR-24 and miR-337 expression. [score:5]
As miRNAs function as a molecular rheostat to fine-tune gene expression and may act cooperatively with other miRNAs (Asirvatham et al., 2009), we investigated whether combined miRNA inhibition of let-7f and miR-24 further increased Luc expression. [score:5]
Luc–3′UTRs of putative let-7f targets were co -transfected into A549 cells with pSEAP2-Control (transfection control) and inhibitors or mimics for let-7f and/or miR-24. [score:5]
A549 cells were transfected with DYRK2-pMLC plasmid and let-7f /miR-24 inhibitor/mimic alone or with DYRK2-pMLC plasmid and equimolar concentrations of let-7f+miR-24 inhibitor/mimic together with pSEAP2-Control plasmid as a transfection control. [score:5]
A549 cells were infected or mock infected with RSV 6340WT virus at an m. o. i. of 1 for 24 h. The data represent the mean qPCR fold change± sem of let-7f (let-7f), miR-337-3p (miR-337), miR-520a-5p (miR-520a), miR-24, miR-26b, miR-198 and miR-595 from three independent experiments relative to mock-infected cells, with values >1.0 considered to be upregulation and values below 1.0 considered to be downregulation. [score:5]
Accordingly, cells were transfected with DYRK2-pMLC plasmid and either transfected with let-7f or miR-24 inhibitor alone or co -transfected with DYRK2-pMLC plasmid and equimolar amounts of let-7f and miR-24 inhibitors or mimics. [score:5]
let-7f and miR-24 did not show any significant homology in the seed site with any region in the RSV genome in both sense and anti-sense orientations, ruling out a direct inhibition of virus replication by these miRNAs. [score:4]
Commercial let-7f and miR-24 inhibitor and mimics used in this study consistently prevented or increased the incorporation of the miRNA guide strand into the RNA -induced silencing complex (RISC) complex via proprietary design (Fig. 3c) (Vermeulen et al., 2007). [score:3]
The data from Fig. 5 clearly showed that inhibition of let-7 and/or miR-24 affected virus replication significantly. [score:3]
A549 cells were mock transfected or transfected in two independent experiments with inhibitors of let-7f and miR-24 separately and together (let-7f+miR-24), followed by infection with rgRSV at an m. o. i. of 0.5. [score:3]
Both let-7f and miR-24 were predicted to regulate the DYRK2 gene (Fig. 3d). [score:2]
In this mo del, microarray data validated by quantitative real-time PCR (qPCR) showed that a different set of miRNAs (let-7f, miR-337, miR-520a, miR-24, miR-26b, miR-198 and miR-595) was deregulated following RSV infection. [score:2]
The miRNAs miR-24, miR-26b, miR-29a, miR-320a and miR-520a-5p (miR-520a) were also induced ≥1.5-fold, whilst miR-198, miR-224 and miR-595 were repressed by at least 1.5-fold (Table S1). [score:1]
qPCR performed using miRNA-specific oligonucleotides validated approximate inductions of twofold for miRNAs let-7f and miR-337, 1.7-fold for miR-520a and miR-24 (Fig. 1) and fourfold for miR-26b (Fig. 1). [score:1]
RSV replication is modulated by let-7f and miR-24. [score:1]
[1 to 20 of 17 sentences]
23
[+] score: 69
These were miR-146a-5p, miR-146b-5p, miR-24-3p, miR-425-3p and miR-3074-5p that were all downregulated after treatment, and their individual expressions were strongly correlated (Fig. 1d,e and Supplementary Table 4) suggesting a shared mechanism of action. [score:6]
In line with our findings in the DRCT, we again found a significant downregulation in the expression of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p in the blood of depressed patients after treatment. [score:6]
To explore the relationship between the downregulated miRNAs and predicted signalling pathways, we cross-referenced the expression of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p with the genes identified through our computational analysis. [score:6]
Following chronic duloxetine treatment for 2 weeks, we found a significant downregulation of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p (Fig. 5a), with no differences in the expression of the endogenous control RNU6B after treatment or changes in these miRNAs after 2 weeks in untreated cells. [score:6]
Gene targets of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p were identified using seven miRNA target prediction databases. [score:5]
Here, we showed that miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p regulate the expression of >30 genes involved in MAPK and Wnt signalling. [score:4]
MicroRNA dysregulation of MAPK/Wnt signalling in vitroTo confirm that antidepressants have an effect on the expression of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p, we treated human neural progenitor cells (NPCs) with duloxetine, the same antidepressant that was used in the DRTC, as well as a no-drug control. [score:4]
We found a significant downregulation of miR-146b-5p, miR-24-3p and miR-425. [score:4]
There was a downregulation of miR-146a-5p, miR-146b-5p and miR-24-3p after antidepressant treatment. [score:4]
Expression of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p in an animal mo del of MDD and post-mortem human brain samples. [score:3]
We measured the expression of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p before and after 8 weeks of AD treatment in a second independent sample composed of 316 additional blood samples from 158 patients treated with the antidepressant escitalopram (selective serotonin reuptake inhibitor) for 8 weeks. [score:3]
To confirm that antidepressants have an effect on the expression of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p, we treated human neural progenitor cells (NPCs) with duloxetine, the same antidepressant that was used in the DRTC, as well as a no-drug control. [score:3]
To explore the relationship between the peripheral changes of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p, and their expression in the brain, we used quantitative real-time PCR to assess the levels of these miRNAs in the ventrolateral prefrontal cortex (vPFC) of depressed humans who died by suicide (n=32) and psychiatrically healthy controls (n=20). [score:3]
Our findings indicate that miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p are consistent blood markers of antidepressant response and regulators of psychiatrically relevant signalling pathways. [score:2]
We measured the expression of miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p in peripheral blood samples of mice before and after treatment with imipramine or saline control, using a NanoString, a probe -based miRNA expression assay. [score:2]
To verify that the correlation between these miRNAs and the MAPK/Wnt genes identified through our in silico analysis was not a random finding, we performed a permutation analysis to test correlations between miR-146a-5p, miR-146b-5p, miR-24-3p, miR-425-3p and 50 random genes. [score:2]
These findings support a relationship between treatment response and miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p. [score:1]
These miRNAs are transcribed from different genomic loci: chr5 (miR-146a-5p), chr10 (miR-146b-5p), chr9/chr19 (miR-24-3p) and chr3 (miR-425-3p). [score:1]
Finally, to experimentally confirm the interaction between miR-146a-5p, miR-146b-5p, miR-24-3p, miR-425-3p and genes of the MAPK/Wnt signalling pathways, we performed functional experiments using miRNA mimics on human embryonic kidney cells (HEK293). [score:1]
These results confirm an interaction between miR-146a-5p, miR-146b-5p, miR-24-3p, miR-425-3p and the MAPK/Wnt signalling pathways. [score:1]
To validate our, we performed a second, independent, in silico analysis for miR-146a-5p, miR-146b-5p, miR-24-3p and miR-425-3p using DIANA: miRPath. [score:1]
For miRNA mimic treatments, cells were grown in the continuous presence of 5 nM miRNA Mimic (miR-146a-5p, miR-146b-5p, miR-24-3p or miR-425-3p), 5 nM miR-Mimic scramble control (AllStars Negative Control siRNA, Qiagen) or mock vehicle (HiPerFect Transfection Reagent, Qiagen) for 24 h after which cell pellets were collected and both mRNA and miRNA were extracted as previously explained. [score:1]
[1 to 20 of 22 sentences]
24
[+] score: 58
These and our findings may indicate a relevant role of miR-21, miR-24 and miR-27a in the malignant behavior of cervical cancer and HCC cell lines; for this reason we monitored their expression levels in human HCC tissues and their PT counterparts and then matched the miR expression levels with clinical patient features. [score:5]
We also found that miR-24 and miR-27a were downregulated in HCC cancer developed in cirrhotic liver. [score:4]
In this context, considering the subclass of HCC tumors developed in cirrhotic liver, miR-24 and miR-27a were downregulated in HCC in respect to PT tissues. [score:4]
In particular, the R value in the cirrhosis subgroup was 0.535±0.0947 (p<0.0001), suggesting that miR-24 was downregulated in HCC with respect to cirrhotic PT tissue. [score:4]
miR-24 was described as an anti-oncomiR by regulating c-myc and E2F2 in the HCC-derived cell line HepG2 and causing inhibition of cell proliferation (35). [score:4]
This suggests that downregulation of miR-24 and miR-27a influences the hepatocyte transformation of cirrhotic tissues. [score:4]
For miR-24 in cirrhotic HCCs, the data obtained indicate a linear correlation between mean overall survival and miR-24 expression. [score:3]
We analyzed the expression profile of the miRs most frequently cloned (miR-24, miR-27a and miR-21) in the tumor and peritumoral tissues from biopsy specimens of patients presenting with HCC. [score:3]
miR-24, miR-27a and miR-21 differential expression in HCC tissues from human biopsy specimens. [score:3]
For miR-24, a significant decrease in expression was observed in the HCV and HBV/HCV subclasses (R=0.523, p=0.0184; R=0.462, p=0.0311 respectively). [score:3]
miR-24 and miR-27a displayed the same expression trend in 66.7% of the cases examined; this may have occurred due to the fact that they are clustered in 1 transcript on chromosome 19. [score:3]
The observation that miR-24 expression is correlated with OS of cirrhotic HCC patients will be further validated in a larger group of patients. [score:3]
Similar to miR-24, miR-27a (Figs. 3 and 5) did not show dysregulation among the 41 cases, as the average R value was 0.915±0.204. [score:2]
Our data revealed miR-24 and miR-27a dysregulation in HCC in respect to their corresponding PT tissues and distinguished a profile in cirrhotic but not in non-cirrhotic tissues. [score:2]
miR-24 (Fig. 2) was not dysregulated, based on the average R value for the 41 examined cases (Fig. 5, R=0.77±0.109). [score:2]
In another study miR-24 acted as an oncomiR negatively regulating p16 in cervical carcinoma cells and the pro-apoptotic FAF1 protein in prostate, gastric and HeLa cancer cells (36, 37). [score:2]
The expression levels of the most frequently cloned miRNAs, miR-24, miR-27a and miR-21, were evaluated using real-time PCR in the tumor and corresponding PT tissues from the biopsy specimens of 41 HCC patients. [score:1]
Among the most abundant, miR-24 was noted. [score:1]
The most frequently isolated miRNAs were miR-24, miR-27a and miR-21 (Table III). [score:1]
Among the 200 bacterial clones sequenced, 118 clones corresponded to 31 known miRs cloned with different frequencies and the miR-24, miR-27a, miR-21 were cloned with the highest frequency. [score:1]
More studies are necessary to better explore the biological role of miR-24 and miR-27a in HCC and in other cancers. [score:1]
Real-time quantification of mature miR-24, miR-27a and miR-21 by stem-loop RT-PCR. [score:1]
In particular, the miRs cloned with the highest frequency were miR-21, miR-27a and miR-24 as noted in our study. [score:1]
[1 to 20 of 23 sentences]
25
[+] score: 46
Furthermore, downregulated expression of miR-24 was validated in human ovarian cancer in the present study. [score:6]
Our result implies that lowering the expression level of CDK4 and p-MDM2 may partly explain for the remarkable pro-apoptotic role of miR-24 and the miR-24-increased p53 expression in the ovarian cancer cells observed here. [score:5]
Obvious downregulation of miR-24 in cancerous ovarian tissues was observed, implying pathological implication in ovarian cancer (S4 Fig). [score:4]
It was also found that overexpression of miR-24 remarkably led to cell apoptosis of the p53 wild-type ovarian cancer cells (Fig 6A and 6B; S2B Fig). [score:3]
Consistent with the previous study [33], this finding suggests that miR-24 may play important role as a tumor suppressor in the ovarian cancer cells. [score:3]
Detection of miR-24 expression in human cancerous (n = 12) and normal (n = 10) ovarian tissues. [score:3]
It was further validated that reduced CDK4 and p-MDM2 protein level and increased p53 expression in a dose -dependent manner might be involved in the mechanism by which miR-24 promoted cell apoptosis of the ovarian cancer cells (Fig 6C). [score:3]
Furthermore, the miR-24 inhibitor (anti-miRNA oligonucleotide of miR-24, AMO-24) was used to be co -transfected with miR-24 to validate the specificity of action of the latter. [score:3]
The HMDD-unrecorded MDA miR-24:ovarian cancer was in vitro validated that overexpression of miR-24 shown remarkable pro-apoptotic effect in the human ovarian cancer cells. [score:3]
The concentration of 50 or 100 nM was applied for miR-24 transfection in the A2780 cells. [score:1]
Cotransfection with AMO-24 was found to obviously reverse the pro-apoptotic role of miR-24 (S3 Fig). [score:1]
Transfection of miR-24 was performed by using X-treme GENE (Roche, Swiss), according to the procedure specification. [score:1]
Pro-apoptotic effect of miR-24 in S KOV3 cells. [score:1]
0136285.g006 Fig 6(A) Effect of transfection of 100 nM miR-24 on cell viability of A2780 cells (n = 7). [score:1]
After transfection of 100 nM miR-24 or scramble miRNA, cells were cultured for 48 h. Briefly, cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 sodium citrate buffer after washing 3 times with phosphate buffered saline (PBS). [score:1]
Taken together, our results suggest putative MDA between miR-24 and ovarian cancer. [score:1]
S3 FigNC: negative control cells that were transfected with scramble miRNA; ns: not significant; *** p < 0.001 versus NC; [#] p < 0.05, [###] p < 0.001 versus miR-24, n = 5. (TIF) Click here for additional data file. [score:1]
0136285.g005 Fig 5(A, B and C) Effect of transfection of different concentrations of miR-24 on cell viability of S KOV3 cells (n = 7). [score:1]
Validation of miR-24 transfection in S KOV3 cells (A) and A2780 cells (B). [score:1]
Cotransfection of AMO-24 (50 nM) reversed the pro-apoptotic effect of miR-24 (50 nM) in S KOV3 cells (A) and A2780 cells (B). [score:1]
By applying this approach, miR-24 was identified for the first time to be functionally associated with ovarian cancer. [score:1]
Pro-apoptotic effect of miR-24 in A2780 cells. [score:1]
[1 to 20 of 22 sentences]
26
[+] score: 46
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
Three of the 107 genes are previously identified targets of the downregulated miRNAs, including mmp14, a known target of miR-133 [64], mmp9 (targeted by miR-204 and miR-338) and timp2 (targeted by miR-24 and miR-204). [score:12]
Conversely, miR-204 was downregulated in zebrafish and bichir, miR-133a was downregulated in bichir, and miR-2184, miR-338 and miR-24 were downregulated in axolotl. [score:10]
S24 Table Zebrafish Ensembl gene identifiers for 107 genes upregulated in three mo dels with predicted miRNA binding sites for miR-2184, miR-204, miR-338, miR-133a and miR-24 and members of the network of commonly up- and downregulated genes with functional interactions to 11 blastema -associated genes. [score:7]
We performed similar analyses to capture potential target genes for the 5 commonly downregulated miRNAs (miR-2184, miR-204, miR-338, miR-133a and miR-24). [score:6]
S23 Table Zebrafish Ensembl gene identifiers for 205 genes upregulated in three mo dels with predicted miRNA binding sites for miR-2184, miR-204, miR-338, miR-133a and miR-24 in all three mo dels. [score:4]
Within this subset of differentially regulated zebrafish miRNAs, we identified 10 miRNAs: miR-21, miR-181c, miR-181b, miR-31, miR-7b, miR-2184, miR-24, miR-133a, miR-338 and miR-204, that showed conserved expression changes with both bichir and axolotl regenerating samples (Table 1). [score:4]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
Although zebrafish miRNAs have been examined in numerous studies [25, 27, 41– 43], our analysis revealed novel paralogs of 18 miRNAs that do not currently have zebrafish records in miRBase (version 21), including miR-181a, miR-20a, miR-23b, miR-24, miR-29a, miR-103, miR-128, miR-148, miR-181b, miR-199, miR-204, miR-212, miR-221, miR-338, miR-724, miR-2184, let-7b and let-7e. [score:1]
[1 to 20 of 9 sentences]
27
[+] score: 45
AE1 interacts with another mir-24 target tumor suppressor p16 and sequesters p16 in the cytoplasm, thereby leading to loss of control of cell-cycle regulation and induction of gastric carcinogenesis. [score:6]
Click here for file Predicted targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24 by TargetScan. [score:5]
This file contains the list of targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24 as predicted by the TargetScan. [score:5]
Overview of the bioinformatics analysis of the TargetScan predicted targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24. [score:5]
Predicted targets of hsa-miR-23a, hsa-miR-27a and hsa-miR-24 by TargetScan. [score:5]
-2 is unique among miRNAs of this cluster since can originate from two different genomic loci one localized on chromosome 19p13 encoding miR-23b, -27b, and -24-1, and the other localized on chromosome 9q22 encoding, -27a, and -24-2. Since, mir-24-1 and-2 have the same mature sequence but different primary transcripts, it means that they have similar biological functions but both of them are differentially expressed and regulated. [score:4]
-2 is unique among miRNAs of this cluster since can originate from two different genomic loci one localized on chromosome 19p13 encoding miR-23b, -27b, and -24-1, and the other localized on chromosome 9q22 encoding, -27a, and -24-2. Since, mir-24-1 and-2 have the same mature sequence but different primary transcripts, it means that they have similar biological functions but both of them are differentially expressed and regulated. [score:4]
Figure 4 Involvement of hsa-miR-24 in biological processes and the diseased states. [score:3]
The different biological processes and the diseased states where the role of hsa-miR-24 has been established are shown. [score:3]
miR-24 in tumorigenesis. [score:1]
miR-24 in haematopoetic differentiation. [score:1]
miR-24 in phenotypic plasticity. [score:1]
mir-24 emerged as a biomarker specific for Kaposi Sarcoma (KS) in a study done by O'Hara et al in 2009 to identify specific miRNAs that serve as biomarkers for tumor progression [88]. [score:1]
miR-24. [score:1]
[1 to 20 of 14 sentences]
28
[+] score: 40
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
There were eight microRNAs (bta-miR-27b, bta-miR-191, bta-miR-30d, bta-miR-451, bta-miR-25, bta-miR-140, bta-miR-24-3p, and bta-miR-122), that were upregulated in older animals in the present study, and upregulated in fetal muscle tissue of the study. [score:7]
It has been proposed that upregulation of bta-miR-24-3p inhibits the transcription of HO-1, therefore, hampering the cell’s ability to defends itself against pathogens [23]. [score:6]
It can be postulated that bta-miR-24-3p is over-expressed when exposed to a pathogen; however, further studies are needed to establish if HO-1 is the target of bta-miR-24-3p in M. bovis exposure in cattle. [score:5]
Bta-miR-24-3p upregulation has been reported in challenge studies. [score:4]
In the present study, an upregulation of bta-miR-24-3p was detected after animals became -positive. [score:4]
It has also been observed that bta-miR-24-3p was over-expressed in serum samples from patients with hepatocellular carcinoma [13]. [score:3]
In bovine mammary epithelial cells challenged with E. coli, an over -expression of bta-miR-24-3p was identified [22]. [score:3]
Bta-miR-24-3p regulate the production of HO-1 at the post-transcriptional level [21]. [score:2]
Fig 1 shows the interaction (P = 0.0268) of status (positive and negative groups) and season for bta-miR-24-3p. [score:1]
Bta-miR-22-3p and bta-miR-24-3p had the fewest number of copies in summer, 2013, an intermediate number of sequences in fall, 2013, and the greatest number in spring, 2014 (P< 0.0001). [score:1]
Serum antibody to M. bovis microRNA Negative Positive SE P-value bta-let-7b 11,691 15,421 1,200 0.0336 bta-miR-24-3p 15,908 24,390 1,495 0.0002 bta-miR-92a 83,405 64,330 4,156 0.0023 bta-miR-423-5p 124,920 101,818 6,315 0.0133 A total of 21 microRNAs were associated with season (Table 3). [score:1]
0161651.g001 Fig 1Interaction of season and antibody response to M. bovis for bta-miR-24-3p (P = 0.0268). [score:1]
Interaction of season and antibody response to M. bovis for bta-miR-24-3p (P = 0.0268). [score:1]
In this study, bta-miR-24-3p abundance increased in the seropositive group. [score:1]
[1 to 20 of 14 sentences]
29
[+] score: 39
Upon NaButyrate induction, two of the most upregulated miRNAs common to both cell lines were miR-24 and miR-10a, whose target genes have been shown to inhibit endodermal differentiation. [score:8]
Two of the most upregulated miRNAs common to both of our cell lines were miR-24 and miR-10a, whose target genes have been shown to inhibit endodermal differentiation. [score:8]
These miRNAs were differentially-expressed upon NaB -induced differentiation and represent ES miRNAs (hsa-miR-302a*, hsa-miR-302d, hsa-miR-517b), endodermal miRNAs (hsa-miR-122, hsa-miR-375) and miRNAs that were upregulated in both lines (hsa-miR-10a, hsa-miR-24). [score:6]
According to the data of Laurent et al., miR-122, miR-10a and miR-24 were upregulated in hESC differentiated towards extraembryonic endoderm, while miR-375's expression was unchanged [20]. [score:6]
miR-24 was predominantly upregulated in both lines (Table 3). [score:4]
Notch-signaling was shown to inhibit endoderm formation in zebrafish [39], and hence, it is intriguing to consider miR-24 involvement in repression of Notch signaling as a component in promoting endodermal differentiation. [score:3]
A miR-24 validated target is Notch1 [38]. [score:3]
Thus, induction of miR-10a and miR-24 in response to NaB may contribute to endodermal differentiation via HOXA1 and Notch repression. [score:1]
[1 to 20 of 8 sentences]
30
[+] score: 37
To examine if expression of other target genes may be altered in older participants, we focused on previously reported targets for miR-24 and miR-221, two age -associated miRNAs we identified in this study. [score:7]
Based on our miRNome data, we further verified the expression of miR-24 and miR-155 and showed that these miRNAs are downregulated with age in our larger cohort (Fig. 3). [score:6]
The TaqMan® microRNA assay (Applied Biosystems) was used to quantitate miR-24 and miR-221 expression in young and old participants and normalized to miR-147 expression. [score:4]
These subsets of miRNAs and others appear to target different senescence -associated genes, including several that encode cell cycle proteins (the miR-106b group), MKK4 (miR-15b, miR-24, miR-25, miR-141), p16 [INK4a] (miR-24), and IL-6/IL-8 (miR-146a/b) [16], [17], [18], [19]. [score:3]
miR-24 has been reported to modulate the expression of histone H2AX [29], which is a key component in the repair of DNA double-strand breaks. [score:3]
Intriguingly, it has been shown that miR-24 can target E2F2, p16 [INK4a], MKK4 and H2AX [17], [19], [29], [32]. [score:3]
In our studies, we found that several miRNAs have similar expression patterns in both senescent cells and in aging PBMCs, including miR-17, miR-24, miR-93, miR-141, miR-146, miR-155 and miR-106a. [score:3]
It is interesting to propose that with increasing age miR-24 coordinately modulates H2AX expression, in part to help to overcome the additional oxidative stress and DNA damage that occurs with age. [score:3]
Furthermore, downregulation of miR-24 and miR-221 (two miRNAs we examine further below) was also observed when we measured their expression using a TaqMan microRNA assay (Fig. 3B). [score:3]
For duplicate wells, a total of 100 ng of RNA was used for miR-24 and miR-147 and 200 ng of RNA for miR-221. [score:1]
These include miR-106b, miR-93, miR-25 and miR-15b, miR-24, miR-25, and miR-141 [16], [17]. [score:1]
[1 to 20 of 11 sentences]
31
[+] score: 37
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-24-2, hsa-mir-106a, hsa-mir-34a, hsa-mir-449a
Increased miR-24 expression in senescent HDFs may inhibit cell proliferation by suppressing cell cycle regulatory genes including E2F2 [32], which then prevent miR-20a promoter activation resulting in decreased miR-20a expression [35]. [score:10]
Our data on SA-miRNAs expression showed upregulation of miR-24 and miR-34a and downregulation of miR-20a and miR-449a in senescent cells. [score:9]
Deep sequencing analysis [17] and loss-of-function analysis [32] supported the upregulation of miR-24 in senescent cells observed in this study despite the contradictory findings that were reported earlier [33, 34]. [score:4]
The expression of miR-20a and miR-449a was decreased while the expression of miR-24 and miR-34a was increased significantly in senescent HDFs as compared to young HDFs (P < 0.05) (Figure 2). [score:4]
However, TRF treatment did not have any modulatory effect on miR-24 expression in senescent HDFs and also young HDFs. [score:3]
No significant effect was observed on the expression of miR-24 with TRF treatment. [score:3]
Several miRNAs (including miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) that funnel proliferating cells to senescence regulate cellular senescence via either or both p53/p21 and p16/pRb pathways [14]. [score:2]
PCR reactions were then performed according to manufacturer's instructions to quantitate the expression levels of miRNAs (miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) using Taqman Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems, USA), and Taqman microRNA assay (Applied Biosystems, USA) for the miRNAs of interest. [score:2]
[1 to 20 of 8 sentences]
32
[+] score: 36
Overexpression of miR-126 or inhibition of miR-24 antagonizes FFAs -induced lipid accumulation in AML12 hepatocytes. [score:5]
To determine whether the disordered miR-126 or miR-24 levels induced by free fat acid (FFA) affect cellular triglyceride (TG) accumulation, we examined the TG levels in AML-12 cells transfected with mimic (Negative control) NC, miR-126 mimic or inhibitor NC, miR-24 inhibitor using Nile red staining. [score:5]
Whether up-regulation of reduced hepatic miR-126 using miR-126 mimic (or down-regulation of elevated hepatic miR-24 using antagomiR-24) approaches would alleviate liver steatosis in high fat diet-fed mice is currently under investigation in our laboratory. [score:5]
More important, overexpression of miR-126 or inhibition of miR-24 markedly improved fat accumulation in AML-12 cells expose to FFA (Figure 5). [score:5]
0080774.g005 Figure 5 AML12 cells were transfected with either miR-126 mimic, miR-24 inhibitor or their corresponding negative controls. [score:3]
To test the biological roles of miR-126 and miR-24, miR-126 mimic, miR-24 inhibitor or their corresponding negative controls were transfected into AML12 cells using lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocol. [score:3]
AML12 cells were transfected with either miR-126 mimic, miR-24 inhibitor or their corresponding negative controls. [score:3]
In conclusion, the present study demonstrated that various miRNAs were differentially expressed in ob/ob mouse liver (especially for miR-126 and miR-24), suggesting that they were tightly linked to obesity and other metabolic disorders. [score:3]
miR-126 or miR-24 Regulates Lipid Accumulation in AML12 Hepatocytes Exposed to FFAs. [score:2]
The functional analysis in AML-12 liver cells showed that dysregulation of miR-126 and miR-24 is correlated with fat accumulation (Figure 5). [score:2]
[1 to 20 of 10 sentences]
33
[+] score: 36
Significant differences between the GCK-MODY, type 1 diabetes and control groups were less numerous, with miR-24 showing higher expression in controls than in patients with type 1 diabetes (adjusted p = 0.0060); miR-24, along with miR-23a, miR-145 and miR-99b, also showed significantly lower expression levels in GCK-MODY than in controls (p = 0.0011, p = 0.0103, p = 0.0042 and p = 0.0236, respectively). [score:5]
The most striking differences were found between the HNF1B-MODY and HNF1A-MODY groups, evidenced by lower expression levels of miR-223, miR-24, miR-27b and miR-199a in the former. [score:3]
Among the 11 differentially expressed miRNAs (significant in ANOVA), eight differed significantly between HNF1B-MODY and at least one of the other groups (miR-32, miR-223, miR-23a, miR-199a, miR-27b, miR-24, miR-145 and miR-423; ESM Table 3). [score:3]
In conclusion, we have shown that expression of the circulating miRNAs miR-24, miR-223, miR-27b and miR-199a depends on HNF1β function, making them potentially applicable in the diagnosis of HNF1B-MODY. [score:3]
Expression levels of: (c) miR-24 ΔC [t]; (d) miR-223 ΔC [t]; (e) miR-27b ΔC [t]; (f) miR-199a ΔC [t]; (g) miR-32 ΔC [t]; (h) miR-23a ΔC [t]; (i) miR-423 ΔC [t]; (j) miR-145 ΔC [t]. [score:3]
The miRNAs with the most significant differences in expression levels mirrored those observed in the primary group: miR-24, miR-223, miR-27b and miR-199a (Fig.   2). [score:3]
Five of them differed between HNF1A-MODY and HNF1B-MODY, and, amongst those, four (miR-24, miR-27b, miR-223 and miR-199a) showed HNF1B-MODY-specific expression levels in the replication group. [score:3]
Significant differences in covariate-adjusted expression levels were noted for miR-24 (p = 0.0072), miR-223 (p = 0.0184), miR-27b (p = 0.0107) and miR-199a (p = 0.0435; ESM Fig.   1). [score:3]
Brackets are used to connect the groups with significant (p < 0.05) pairwise differences; [†] p = 0.07; exact p values are shown in ESM Table  4 Afterwards, we measured the impact of siRNA -induced knockdowns of HNF1α and HNF1β on the expression levels of miR-24, miR-223, miR-27b and miR-199a in human hepatocytes (HepG2). [score:2]
The silencing of HNF1A significantly decreased levels of miR-24, miR-27b and miR-199a, and had no effect on the miR-223 content in HepG2 cells (Fig.   3d). [score:1]
Fig. 2Comparisons of serum miRNA levels in the UK group: (a) miR-24; (b) miR-223; (c) miR-27b; (d) miR-199a. [score:1]
miR-24, miR-223, miR-23 and miR-199a show 100% conservation of seed region sequences between humans and mice [23]. [score:1]
Significance criterion was met by 11 distinct miRNAs: miR-223, miR-24, miR-99b, miR-423, miR-92a, miR-27b, miR-23a, miR-199a, miR-101, miR-145 and miR-32; these are presented on a hierarchical cluster heatmap in Fig.   1b. [score:1]
Silencing of HNF1B in human hepatocytes significantly decreased intracellular levels of miR-24, miR-27b, miR-199a and miR-223. [score:1]
AU, arbitrary units These data suggest that serum levels of miR-24, miR-223, miR-27b and miR-199a associated with HNF1B dysfunction might reflect changes in intracellular miRNA profile in the liver. [score:1]
miR-27b and miR-24 are clustered together. [score:1]
For miR-27b and miR-24, a ChIP signal peak was also located upstream of the miRNA cluster. [score:1]
[1 to 20 of 17 sentences]
34
[+] score: 36
For the four miRNAs (miR-26a, miR-24, miR-26b, and miR-142-3p) chosen from the class of up-regulation in adults, their expression patterns were also confirmed by showing up-regulation (P < 0.0001) in the adults as compared to the preterm infants and the children, with three of them (miR-26a, miR-26b, and miR-24) being down-regulated from infancy to childhood. [score:11]
For the four miRNAs (miR-26a, miR-24, miR-26b, and miR-142-3p) chosen from the class of up-regulation in adults, their expression patterns were also confirmed by showing up-regulation (P < 0.0001) in the adults as compared to the preterm infants and the children, with three of them (miR-26a, miR-26b, and miR-24) being down-regulated from infancy to childhood (Fig. 3B). [score:11]
Fourth, miR-26a, miR-24, miR-26b, miR-410, and miR-107 were down-regulated from infancy to children, up-regulated in young adulthood, and then showed expression diminishing with aging (Fig. 4D). [score:9]
Six (miR-1, miR-486, miR-26a, miR-24, miR-26b, and miR-142-3p) of seven top 5% differentially expressed miRNAs in the classes with age-limited or age-related expression were confirmed in a validation set using qPCR. [score:5]
[1 to 20 of 4 sentences]
35
[+] score: 35
miR-24 functions as tumor suppressor and radiosensitizer in NPC cells and xenografts by inhibiting Jab1 translation through targeting both the 3′ untranslated region (3′UTR) and 5′UTR of Jab1, leading to tumor growth inhibition, and sensitizes NPC tumors to radiation in vivo (Wang S. et al., 2016). [score:13]
Although miRNAs always target the 3′UTR of the target gene (Lal et al., 2009), miR-24 could target both the 3′UTR and 5′UTR of Jab1 (Wang S. et al., 2016). [score:7]
miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to “seedless” 3'UTR microRNA recognition elements. [score:5]
Our group recently, discovered that miR-24 interacted with both the 3′UTR and 5′UTR of Jab1, resulting in Jab1 mRNA degradation and translational suppression. [score:5]
Hsa-miR-24-3p increases nasopharyngeal carcinoma radiosensitivity by targeting both the 3′ UTR and 5′ UTR of Jab1/CSN5. [score:3]
miR-24-Jab1/COPS5 axis represents a novel biomarker for NPC. [score:1]
Furthermore, miR-24 levels inversely associated with Jab1 mRNA and protein levels in both NPC cells and patients (Wang S. et al., 2016). [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 31
However, while enforced expression of miR-124 significantly decreased IQGAP1 expression at both mRNA and protein levels (Figure 4C and 4D), no such inhibitory effect was induced by miR-24 overexpression (Figure IIIC in the online-only Data Supplement), indicating that IQGAP1 is negatively regulated by miR-124 but not by miR-24. [score:10]
Data from our miRNA reporter assays showed that the activity of luciferase from construct harboring the wild-type IQGAP1 3′-UTR was significantly repressed by miR-124 overexpression (Figure 4E) but not by miR-24 overexpression (Figure IIID in the online-only Data Supplement), providing evidence that IQGAP1 is the target gene of miR-124. [score:6]
qRT-PCR data (Figure 4B; Figure IIIB in the online-only Data Supplement) revealed that overexpression of hnRNPA1 significantly increased both miR-24 and miR-124 expression levels in VSMCs. [score:5]
In this aspect, data from our recent predesigned/customized miR PCR array showed that miR-24 and miR-124 were 2 of the top upregulated miRs during VSMC differentiation into contractile phenotype in response to transforming growth factor-β treatment (Data not shown). [score:4]
Accordingly, we speculated that hnRNPA1 inhibits IQGAP1 through activation of either miR-24 or miR-124 or both. [score:3]
Talasila A Yu H Ackers-Johnson M Bot M van Berkel T Bennett MR Bot I Sinha S Myocardin regulates vascular response to injury through miR-24/-29a and platelet-derived growth factor receptor-β. [score:2]
Moreover, by closely scrutinizing the 3′-UTR sequence of IQGAP1, we have identified a conserved binding site for both miR-24 and miR-124 within the 3′-UTR of IQGAP1 (Figure IIIA in the online-only Data Supplement). [score:1]
[1 to 20 of 7 sentences]
37
[+] score: 27
Targets of miR-24. [score:3]
Involvement of miR-24 in cardiovascular diseases. [score:3]
Mir-24 regulates junctophilin-2 expression in cardiomyocytes. [score:3]
miR-24 functions as an oncogenic or tumor suppressor miRNA in a cancer (sub)type- or cell line -dependent manner (Figure 3A). [score:3]
Local inhibition of microRNA-24 improves reparative angiogenesis and left ventricle remo deling and function in mice with myocardial infarction. [score:3]
Circulating miR-24, miR-125b, miR-195, and miR-214. [score:1]
Involvement of miR-24 in cancers. [score:1]
Human chromosomal loci of genes is derived from the miR-23b/miR-27b/miR24-1 locus at human chromosome 9q22.32 and the miR-23a/miR-27a/miR-24-2 locus at human chromosome 19p13.13 (Figure 2). [score:1]
MiR-24 regulates the proliferation and invasion of glioma by ST7L via β-catenin/Tcf-4 signaling. [score:1]
MicroRNA-24 regulates XIAP to reduce the apoptosis threshold in cancer cells. [score:1]
Human chromosomal loci of miR-24 genes. [score:1]
miR-24. [score:1]
is derived from the miR-23b/miR-27b/miR24-1 locus at human chromosome 9q22.32 and the miR-23a/miR-27a/miR-24-2 locus at human chromosome 19p13.13 (Figure 2). [score:1]
Repression of choroidal neovascularization through actin cytoskeleton pathways by microRNA-24. [score:1]
The negative feedback-loop between the oncomir Mir-24-1 and menin modulates the Men1 tumorigenesis by mimicking the “Knudson's second hit. [score:1]
MicroRNA-24 regulates vascularity after myocardial infarction. [score:1]
MicroRNA-24 regulates cardiac fibrosis after myocardial infarction. [score:1]
[1 to 20 of 17 sentences]
38
[+] score: 27
On the other hand, a dozen miRNAs including miR-27a and miR-24 have been shown to be up-regulated in skin cells upon ultraviolet irradiation [25], and miR-24 overexpression can induce enhanced autophagy in smooth muscle cells [34]. [score:6]
As previously discussed, miR-23a, miR-24, and miR-27a are in the same gene cluster, but up-regulation of miR-27a and miR-24 does not produce the same effects as miR-23a. [score:4]
Surprisingly, down-regulated miR-23a, but not miR-27a or miR-24, is necessary for reducing the SA-β-gal percentage and increasing EdU -positive cell percentage, which is the hallmark of PUVA-SIPS and UVB-SIPS fibroblasts. [score:4]
a., b., c. The expression levels of miR-23a, miR-27a and miR-24 were detected via qRT-PCR in the UVB- and PUVA-SIPS fibroblasts as well as the sham-irradiated cells groups. [score:3]
To detect the effects of endogenous miRNA inhibition on SIPS, we transfected PUVA- and UVB-SIPS cells with miR-23a-specific antagomirs (Ant-23a), miR-24-specific antagomirs (Ant-24), miR-27a-specific antagomirs (Ant-27a), and Ant-CNT (Ant-CNT), and then analyzed the percentage of SA-Δ-gal -positive and EdU -positive cells. [score:3]
Figure 2 a., b., c. The expression levels of miR-23a, miR-27a and miR-24 were detected via qRT-PCR in the UVB- and PUVA-SIPS fibroblasts as well as the sham-irradiated cells groups. [score:3]
However, the same effect was not found in the miR-27a and miR-24 intervention groups (Figure 2d-2f). [score:1]
Thus, it is apparent that miR-23a initiates senescence following ultraviolet irradiation, whereas miR-27a and miR-24 do not exert a synergistic effect. [score:1]
d. Prior to ultraviolet irradiation, cultured fibroblasts were transfected with miR-23a antagomirs (Ant-23a) or miR-24 antagomirs (Ant-24) in addition to either miR-27a antagomirs (Ant-27a) or control antagomirs (Ant-CNT). [score:1]
Therefore, further studies are required to specifically elucidate the role of miR-27a and miR-24 in photoaging. [score:1]
[1 to 20 of 10 sentences]
39
[+] score: 25
Prominent regulatory role of miR-24 on the methylated P16-INK4A gene in the non-aggressive breast cancer subtype P16-INK4A acts as an inhibitor of CDK4 kinase and in cooperation with TP53 has a regulatory role for cell cycle G1 control. [score:5]
e) Pathway analysis predicts the role of has-miR-24 (MIRN24) as a down-regulator of the P16-INK4A. [score:4]
f) Expression profile of has-miR-24 in the non-aggressive breast cancerous cell line (SKBR3) versus control breast cell line (HB2). [score:3]
The expression of miR-24 showed significant inverse correlation to P16-INK4A which might provide an explanation for P16-INK4A shut down in the non-aggressive cell line. [score:3]
MiR-24 has intriguing complementarities to 3′-UTRs and controlling region (CR) of the P16-INK4A and can suppress the gene (Fig. 7e) [67]. [score:2]
Prominent regulatory role of miR-24 on the methylated P16-INK4A gene in the non-aggressive breast cancer subtype. [score:2]
g) Comparison of miR-24 recognition site with the location of found mutations in the mature P16-INK4A mRNA. [score:2]
Further investigation demonstrated steady up-regulation of miR-24 in SKBR3 after treatment and at all follow-up passages (Fig. 7f). [score:2]
Two found mutations/polymorphisms are not located in the complementary site of the miR-24, and therefore they cannot be responsible for the change of the binding affinity of the miR-24 to the gene (Fig. 7g). [score:2]
[1 to 20 of 9 sentences]
40
[+] score: 24
For example, Xie et al. [16] showed that miR-24 over -expression can overcome apoptosis-resistance in cancer cells via downregulation of XIAP expression. [score:8]
Overexpression of miR-23a enhanced autophagyTo explore the role of miRNAs in autophagy, we performed qRT-PCR analysis for the expression levels of miR-24, miR-7, miR-513a-5p and miR-23a in MCF-7 and T47D cells treated with EBSS. [score:5]
To determine whether miRNAs potentially participated in regulating autophagy, we identified several miRNAs potentially targeting XIAP by bioinformatic analysis, including miR-24, miR-7, miR-23a and miR-513a-5p. [score:4]
Figure 2Forced expression of miR-23a induces autophagic activity(A) MCF-7 and T47D cells were transfected with miR-24 mimics, miR-7 mimics, miR-23a mimics and miR-513a-5p mimics. [score:3]
To explore the role of miRNAs in autophagy, we performed qRT-PCR analysis for the expression levels of miR-24, miR-7, miR-513a-5p and miR-23a in MCF-7 and T47D cells treated with EBSS. [score:3]
Shown is the qRT-PCR analysis for miR-24, miR-7, miR-513a-5p and miR-23a. [score:1]
[1 to 20 of 6 sentences]
41
[+] score: 22
For example, miR-24, which we found up-regulated early during the differentiation process and subsequently expressed in both astrocytes and neurons, is known to target dihydrofolate reductase (DHFR) [59], a gene critical for DNA synthesis and replication; suggesting that miR-24 may play a role in cellular differentiation via targeting of DHFR to inhibit DNA replication. [score:12]
NT2-N. Four miRNAs (miR-27a, miR-27b, miR-24, and miR-29a), although classified astrocytic in primary cells, passed the ratio threshold, but failed either the expression level or SAM-FDR threshold criteria in NT2-A vs. [score:3]
NT2-N. The astrocytic expression of miR-24 and miR-27a, however, was confirmed by qPCR (Table S1). [score:3]
Notably, of the 5 known miRNAs, miR-92a and miR-24 are both members of described genomic miRNA clusters. [score:1]
Similarly, paralogs of miR-24 occur in the miR-23a and miR-23b genomic clusters that were detected in NT-A and primary human astrocytes (microarrays and/or qPCR; Fig. 7A, B & Table S1). [score:1]
miR-24 and miR-27a are members of a genomic cluster on chromosome 19 with the astrocytic miRNA miR-23a (Fig. 7A). [score:1]
A paralogous miR-24 gene is found on chromosome 9 with miR-27b and the astrocytic miRNA miR-23b (Fig. 7B). [score:1]
[1 to 20 of 7 sentences]
42
[+] score: 21
More importantly, the miRNAs analyzed in this study not only included the miRNAs like Let-7a, miR-15b, miR24, miR-100 and miR-125 which may suppress the expression of cyclins A and B, and miRNAs such as Let-7a, miR24 and miR-125 which may regulate activity of CDK1, but also miRNAs such as miR-181a, miR-221 and miR-222 which can target CDK inhibitors [30– 32]. [score:10]
To investigate whether miRNAs have a role in the cell cycle regulation of splenocytes following aniline exposure, the expression of miRNAs, including Let-7a, miR-15b, miR24, miR-100, miR-125, miR-181a, miR-221 and miR-222 which are known to mainly control G2/M phase regulators [30– 32], was analyzed by using real-time PCR and the results are presented in Fig 7. Aniline exposure led to significantly decreased expression of Let-7a (decreased 82%), miR-15b (decreased 62%), miR24 (decreased 78%), miR-100 (decreased 63%), miR-125 (decreased 86%), whereas miR-181a, miR-221 and miR-222 increased by 155%, 78% and 56%, respectively, in comparison to controls (Fig 7). [score:5]
Therefore, greater decreases in Let-7a, miR-15b, miR24, miR-100 and miR-125 expression and significant increases in miR-181a, miR-221 and miR-222 levels in the spleens following aniline treatment may be mechanistically important in generalizing that aniline exposure leads to increased cyclin A, cyclin B, CDK1, and decreased p21, p27, thus triggering the splenocytes to go through G2/M transition. [score:3]
Real-time PCR analysis of miRNAs Let-7a, miR-15b, miR24, miR-100 and miR-125 (A), and miRNAs miR-181a, miR-221 and miR-222 (B) expression in rat spleens following aniline exposure. [score:3]
[1 to 20 of 4 sentences]
43
[+] score: 21
In 2009, Lal and colleagues showed that inhibition of H2AX expression and DNA repair in terminally differentiated blood cells is mediated by upregulated miR-24 and also that the miR-24 -mediated H2AX suppression rendered hematopoietic cells hypersensitive to DNA-damaging agents [18]. [score:10]
Lal A. Pan Y. Navarro F. Dykxhoorn D. M. Moreau L. Meire E. Bentwich Z. Lieberman J. Chowdhury D. miR-24 -mediated downregulation of H2AX suppresses DNA repair in terminally differentiated blood cells Nat. [score:6]
Lal A. Navarro F. Maher C. A. Maliszewski L. E. Yan N. O’Day E. Chowdhury D. Dykxhoorn D. M. Tsai P. Hofmann O. miR-24 inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to “seedless” 3’UTR microRNA recognition elements Mol. [score:5]
[1 to 20 of 3 sentences]
44
[+] score: 21
We observed a significant reduction of luciferase expression upon miR-24, miR-186, and miR-455 expression (Figure 1A) compared to a scrambled miRNA (SCR) negative control. [score:4]
In conclusion, we identified NCSTN -targeting miRNAs (miR-24, miR-186, and miR-455) that could decrease Aβ secretion. [score:3]
This analysis resulted in a list of 22 miRNAs (Table 1), which we narrowed down to six (i. e., miR-24, miR-186, miR-340, miR-455, miR-656, and miR-1301) based on our previous expression profiling studies in the human cerebral neocortex (45 raw reads cut-off; Hébert et al., 2013). [score:3]
FIGURE 2 miR-24, miR-186, and miR-455 expression results in decreased Aβ secretion. [score:3]
In order to determine the functional consequences of miR-24, miR-186, and miR-455 expression on Aβ production, we performed using HEK293-APPSwe cells. [score:3]
We thus identified miR-24, miR-186, and miR-455 as endogenous regulators of human NCSTN. [score:2]
These screens indicated that the polymorphism C460T, which is located in the 5′ compensatory region of the miRNA binding site, did not significantly affect miR-24 function (Figure 3A). [score:1]
SNPID Position in 3′UTR Polymorphism Predicted microRNA Seed region Number of raw reads Ts10059 18 C/T hsa-miR-31 Y 0 Ts41266889 196 C/T hsa-miR-3153 Y 0 Ts180769907 360 A/T hsa-miR-1226* Y 0 hsa-miR-608 N 0 hsa-miR-92a* N 0 Ts1043230 367 C/A hsa-miR-92a-2* Y 0 hsa-miR-4298 N 0 Ts1043329 460 C/T hsa-miR-24 N 150 Ts141849450 515–516 delCA hsa-miR-455-5p Y 95 Ts34629439 582 delT hsa-miR-1301 N 45 hsa-miR-590-5p N 11 hsa-miR-27b* N 23 hsa-miR-582-5p N 15 hsa-miR-656 N 107 Ts113810300 623 T/G hsa-miR-1252 Y 0 hsa-miR-3125 Y 0 hsa-miR-340 Y 1708 hsa-miR-142-5p Y 20 hsa-miR-186 Y 1209 hsa-miR-3121 N 0 hsa-miR-4311 N 0 Ts71719087 638/639 delAT hsa-miR-3145 Y 0The SNP ID and the nature of the polymorphism are indicated. [score:1]
Both miR-186 and miR-455 decreased (soluble) Aβ40 and Aβ42 levels, while miR-24 had a small, nonetheless significant effect on Aβ42 (Figure 2). [score:1]
[1 to 20 of 9 sentences]
45
[+] score: 21
The expressions of 17 of the dysregulated miRNAs (miR-145*, -145, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -125a-5p, let-7b, miR-24-1*, -1979, and -768-3p) were significantly lower in both colon and rectal cancers compared with normal tissues, but of the remaining 5, miR-133a and miR-140-3p were found significantly downregulated (P<0.05) only in rectal cancers, and miR-27b*, miR-30a, and miR-29b-2* were significantly downregulated only in colon cancers (P<0.05; Figure 1). [score:9]
Altogether, 17 dysregulated miRNAs that have similar expression patterns in both colon and rectal cancer were identified, including miR-145*, -145, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -125a-5p, let-7b, miR-24-1*, -1979, and -768-3p. [score:4]
Altogether, 23 overlapped miRNAs in the paired t-tests were found, all downregulated, including miR-145*, -145, -101*, -133a, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -29b-2*, -125a-5p, let-7b, miR-24-1*, -27b*, -30a, -1979, -140-3p, and -768-3p. [score:4]
The 22 overlapping miRNAs were miR-145*, -145, -133a, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -29b-2*, -125a-5p, let-7b, miR-24-1*, -27b*, -30a, -1979, -140-3p, and -768-3p, all of which were downregulated. [score:4]
[1 to 20 of 4 sentences]
46
[+] score: 20
MiR-21, miR-24 and let-7f were reported to contribute to MSC differentiation 26, while miR-145 was found previously to inhibit hESC self-renewal, repress the expression of pluripotent genes and induce lineage-restricted differentiation by targeting the pluripotency factors Oct4, Sox2 and Klf4 24. [score:7]
Our results showed that miR-489, miR-370 and miR-433 were highly expressed in spheroid hMSCs, while miR-7, miR-145, let-7f, miR-21 and miR-24 were down-regulated in spheroid hMSCs, compared to hMSCs that had been cultured in monolayer. [score:5]
showed that miR-489, miR-370 and miR-433 were highly expressed in spheroid hMSCs compared to monolayer hMSCs, especially miR-370 with a fivefold increase, while let-7f, miR-7, miR-145, miR-21 and miR-24 were down-regulated in spheroid hMSCs (Fig. 5A). [score:5]
To understand whether miRNAs were involved with the phenotypical changes of hMSCs in spheroids, real-time PCR analysis was performed to examine the expression of miR-489, miR-370, miR-433, let-7f, miR-7, miR-145, miR-21 and miR-24. [score:3]
[1 to 20 of 4 sentences]
47
[+] score: 20
In particular, the following target proteins, involved in cell proliferation, were downregulated: DHFR targeted by miR24 [33], Cyclin D1 targeted by miR223 [34], and E2F-2 targeted by miR31 [35]. [score:12]
Moreover, the use of miRNA inhibitors against miR451, miR223, miR24, miR125b, and miR31 on HepG2 reduced the proapoptotic activity induced by MV-HLSC. [score:3]
Among miRNAs present in MV-HLSC, we detected several miRNAs with potential antitumor activity including miR451, miR223, miR24, miR125b miR31, and miR122 (Fig. 3A). [score:1]
Silencing Dicer in HLSC resulted in the modulation of different miRNAs, with a significant reduction of the antitumor miR223, miR24, miR31, and miR122 [55] in MVs. [score:1]
MVs released from DCR-Kd HLSC (MV DCR−), but not from CTR-A HLSC (MV CTR-A), showed a significant reduction of miR223, miR24, miR31, miR122, and miR214 as detected by qRT-PCR (Fig. 4B). [score:1]
Among miRNAs present in MV-HLSC [10], several ones were associated with potential antitumor activity, such as miR451, miR223, miR24, miR125b, miR31, miR214, and miR122. [score:1]
To evaluate whether single miRNAs with antitumor activity (miR451, miR223, miR24, miR125b, and miR31) were relevant for the proapoptotic effect of MV-HLSC, we transfected HepG2 with selected miRNA inhibitors (Fig. 5A). [score:1]
[1 to 20 of 7 sentences]
48
[+] score: 20
miRNA-31 downregulation conferred resistance to radiotherapy and chemotherapy in several types of cancers [37], [38], and downregulation of miRNA-30a [39], miRNA-203 [40], miRNA-183 [41], miRNA-130a [42], miRNA-24 [43] and miRNA-23a [43], and upregulation of miRNA-193b [44] increased tumor cells resistant to chemotherapy. [score:10]
Our results showed that miRNA-23a, miRNA-203, miRNA-31, miRNA-30a, miRNA-183, miRNA-130a, and miRNA-24 were downregulated, and miRNA-193b upregulated in the radioresistant NPC cells, suggesting that deregulation of these miRNAs might be involved in the NPC radioresistance. [score:8]
In this network, ten genes (SOCS6, SMAD2, CDKN2B, PPARGC1A, FOS, FOSL2, IL8, IRS2, JAK1, WDR32) were coregulated by six miRNAs (miRNA-23a, miRNA-24, miRNA-30a, miRNA-545, miRNA-203, miRNA-660) (Figure 2, Table 4). [score:2]
[1 to 20 of 3 sentences]
49
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
Among the miRNAs examined, 79 miRNAs (24%) responded to the hyperandrogenic condition and interestingly, 80% of which were upregulated compared to the control group supporting the notion that hyperandrogenic condition down-regulates androgen receptors in the granulosa cells [35] which could be mediated by these upregulated miRNAs (rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p). [score:9]
A list of differentially expressed miRNAs (Fold change ≥ 2 and their corresponding P value) is presented in Figure  4. Beside this group, miRNAs which were also highly abundant in DHT -treated ovaries are rno-miR-221, rno-miR-222, rno-miR-25, rno-miR-26b, rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p. [score:3]
Among the fourteen miRNAs mapped to the ingenuity databases, twelve (rno-let-7d, rno-miR-132, rno-miR-182, rno-miR-183, rno-miR-184, rno-miR-21, rno-miR-221, rno-miR-24, rno-miR-25, rno-miR-26b, rno-miR-31 and rno-miR-96) had 171 experimentally validated targets. [score:3]
Whereas rno-miR-24 and rno-miR-183 were highly expressed in the theca and, to a lesser extent, in the granulosa cells of the cystic follicles (Figure  5), Rno-miR-31 and rno-miR-96 were present in the cumulus granulosa cells. [score:3]
These included rno-miR-24, rno-miR-31, rno-miR-96, rno-miR-183, rno-miR-222, rno-miR-489, U6 snRNA (positive control) and scrambled miRNA (negative control). [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 19
Other miRNAs from this paper: hsa-mir-22, hsa-mir-24-2, hsa-mir-221, hsa-mir-222
In a recent study, the miR-24 family was reported to be upregulated in differentiated hematopoietic cells and T cells, and was shown to directly downregulate H2AX expression, thereby inhibiting DSB repair and enhancing chemosensitivity [5]. [score:12]
However, H2AX expression and its function are intact in terminally differentiated astrocytes [4], and we did not observe any significant changes in endogenous H2AX expression levels in terminally differentiated MCF-7 cells, indicating that miR-24 affects H2AX expression depending on the cellular context. [score:7]
[1 to 20 of 2 sentences]
51
[+] score: 19
In vitro, miRNA-24 inhibition enhanced human ECs survival, proliferation and networking in capillary-like tubes in association with increased eNOS (a direct target of miRNA-24) [94]. [score:6]
These studies indicate that miRNAs, miRNA-208, miRNA-23a, miRNA-24, miRNA-125, miRNA-21, miRNA-129, miRNA-195, miRNA-199, and miRNA-212 are frequently increased in response to cardiac hypertrophy, whereas, miRNA-29, miRNA-1, miRNA-30, miRNA-133, and miRNA-150 expression are often found to be decreased. [score:3]
Meloni M. Marchetti M. Garner K. Littlejohns B. Sala-Newby G. Xenophontos N. Floris I. Suleiman M. S. Madeddu P. Caporali A. Local inhibition of microRNA-24 improves reparative angiogenesis and left ventricle remo deling and function in mice with myocardial infarction Mol. [score:3]
Meloni et al. (2013) [94] have shown that myocardial infarction induction in mice decreased miRNA-24 expression in the peri-infarct tissue and its resident cardiomyocytes and fibroblasts; while it is increased in endothelial cells (ECs). [score:3]
Recent analysis identified miRNAs expressed in undifferentiated mouse embryonic stem cells and differentiating cardiomyocytes and found increased level of miRNA-1, miRNA-18, miRNA-20, miRNA-23b, miRNA-24, miRNA-26a, miRNA-30c, miRNA-133, miRNA-143, miRNA-182, miRNA-183, miRNA-200a/b, miRNA-292-3p, miRNA-293, miRNA-295 and miRNA-335 in mice [14, 45]. [score:3]
Local delivery of adenovirus -mediated miRNA-24 decoy in the ischemic area of myocardium increased angiogenesis and blood perfusion [94]. [score:1]
[1 to 20 of 6 sentences]
52
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
Clusters mir-16-1-mir-15a, let-7f-let-7a-1, mir-181a-1-mir-181b-1, let-7j-let-7k, mir-23b-mir-27b-mir-24, and mir-16-2-mir-15b were down-regulated in lungs and mir-181a-1-mir-181b-1 was also down-regulated in tracheae with AIV infection. [score:7]
Based on other immune related miRNA studies in mammals [11, 66], differentially expressed miRNAs of their mammalian homologs and their targets are presented in Table 9. MiR-15a, miR-21 and miR-181a have important functions in lymphocytes development and modulations while miR-122 and miR-24 are related to virus infection and miR-146a, induced by macrophages, can activate Toll like receptor (TLR) and expose antigens to interleukin-1 beta. [score:6]
The miRNAs from five of these clusters (mir-16-1-mir-15a, mir-16-2-mir-15b, let-7f-let-7a-1, let-7j-let-7k and mir-23b-mir-27b-mir-24) identified in both lungs and tracheae were significantly down-regulated in infected lungs compared to non-infected lungs and also had higher expression levels in non-infected lungs than non-infected tracheae. [score:5]
[1 to 20 of 3 sentences]
53
[+] score: 18
As shown in Figure 9C, there was excellent concordance in the data from the miRNA profiling and qPCR, the expression of miR-21, miR-26a, miR-24, miR-30b and miR-29a was down-regulated by EF24 treatment both in vitro and in vivo, while the expression of miR-345, miR-409, miR-10a and miR-206 was upregulated by EF24 treatment. [score:11]
In contrast, only 5 miRNAs (miR-21, miR-26a, miR-24, miR-30b and miR-29a) were found to be downregulated both in vitro and in vivo by EF24 treatment. [score:4]
miR-24 is a putative oncomir and is overexpressed in breast and cervical carcinoma [35]. [score:3]
[1 to 20 of 3 sentences]
54
[+] score: 17
miR-24 was also found to regulate translation of the cyclin -dependent kinase inhibitor p16, thereby allowing increased p16 expression in senescent cells [17]. [score:8]
Recently, four microRNAs (miR-15b, miR-24, miR-25, and miR-141) that jointly lower expression of the kinase MKK4 were found to decline during replicative senescence and to contribute to the senescence process [16]. [score:3]
Reduced expression of miR-103, miR-107, miR-128, miR-130a, miR-155, miR-24, miR-221, miR-496, and miR-1538 in older individuals was also recently reported [19]. [score:3]
Other microRNAs were expressed at lower levels in senescent cells [e. g., miR-24, miR-141, and miR-10a (Figure 3, Supplementary Table 1)]. [score:3]
[1 to 20 of 4 sentences]
55
[+] score: 17
For instance, PRRSV downregulates the expression of miR-125b post-infected MARC-145 cells and activates NF-κB to facilitate its own multiplication [30]; while the downregulation of miR-24 in PRRSV-infected PAMs (Primary alveolar macrophages) increased the expression of IRG6 and the subsequent induction of the antiviral response [27]. [score:11]
In recent years, increasing numbers of studies have reported the impact of viral infections on the cellular miRNAome; for example, the expression levels of 108 human miRNAs were shown to change more than 2.0-fold in hepatitis C virus (HCV)-infected human hepatoma cells, and the differentially-expressed miRNAs, including miR-24, miR-149*, miR-638 and miR-1181, were shown to be involved in virus entry, replication and propagation [14]. [score:5]
Ranking JEV-Infected Group JEV-Uninfected Group miRNA Reads miRNA Reads 1 ssc-miR-21 17,39,040 ssc-miR-21 877,629 2 ssc-let-7f 309,868 ssc-let-7f 151,697 3 ssc-miR-30a-5p 69,597 ssc-miR-19b 33,441 4 ssc-miR-100 60,186 ssc-miR-24-3p 23,501 5 ssc-miR-29a 53,334 ssc-miR-152 22,650 6 ssc-miR-152 49,317 ssc-miR-18a 21,872 7 ssc-miR-10a-5p 39,632 ssc-let-7a 20,908 8 ssc-miR-19b 37,389 ssc-miR-100 16,274 9 ssc-miR-26a 35,650 ssc-miR-19a 14,533 10 ssc-miR-182 29,255 ssc-miR-30a-5p 14,489 When a host is infected with a viral pathogen, it produces a strong antiviral response to protect itself. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 17
These include miR-210, which is also commonly identified as “hypoxia miR” is expressed in the heart and it increases under hypoxic conditions, including in cardiac myocytes[18– 21] and miR-24, which is upregulated in the myocardium and its endothelial cells, but downregulated in cardiac myocytes following the experimental induction of an ischemic event in mice[22, 23]. [score:9]
Cardiac-expressed (miR-1, miR-24, miR-133a/b, miR-208a/b, miR-210), non-cardiovascular (miR-122) and quality control miRs were measured in whole plasma and in plasma exosomes. [score:1]
The concentration of total exosomes was positively correlated with the concentration of exosomal miR-1, miR-133a, miR-24, miR-210 and miR-133b (Fig 7). [score:1]
In ARCADIA, a selection of the aforementioned miRs (miR-1, miR-24, miR-133a, miR-133b, miR-210) together with the negative control (for cardiac expression) liver-specific-miR-122 were measured both in whole plasma and its exosomal fraction. [score:1]
We have found that after surgery, miR-24 and miR-210 were substantially enriched in the total pool of plasma exosomes. [score:1]
In detail, concentrations of exosomal miR-1, miR-24, miR-133a and miR-133b all increased at both 24h and 48h post-surgery, while some of these changes were not detected in the whole plasma (see above). [score:1]
By contrast, the concentration of miR-24 did not. [score:1]
This suggests the possibility that after CABG miR-24 and miR-210 are predominantly released via exosomes, while miR-1 and miR-133 are released via exosomes and exosome-independent mechanisms in similar proportions. [score:1]
Finally, the exosomal concentrations of miR-1, miR-133a, miR-24, miR-210 and miR-133b were strongly positively correlated with cTn-I (Fig 8). [score:1]
[1 to 20 of 9 sentences]
57
[+] score: 17
On the other hand, microRNAs might function as oncogenes by suppressing apoptosis, i. e. miR-24, which inhibits apoptosis and represses Bim in mouse cardiomyocytes [52]; miR-886-5p, which inhibits apoptosis by down -regulating Bax expression in human cervical carcinoma cells [53], and miR-183, which inhibits TGF-β1 -induced apoptosis by downregulation of PDCD4 expression in human hepatocellular carcinoma cells [54]. [score:17]
[1 to 20 of 1 sentences]
58
[+] score: 16
The relative expression levels of 62 miRNA (out of 366 human miRNAs tested) expressed substantially in these cells are shown in Figure 6. The most abundant miRNAs expressed in ARPE-19 cells were let-7b, let-7a, miR-125b, miR-24, miR-320, miR-23b, let-7e, and let-7d. [score:7]
Microarray hybridization analysis identified let-7b, let-7a, miR-125b, miR-24, miR-320, miR-23b, let-7e, and let-7d as the most abundant miRNAs normally expressed in ARPE-19 cells. [score:3]
showed that a large number of miRNAs are normally expressed in ARPE-19 cells, the most abundant ones being let-7b, let-7a, miR-125b, miR-24, miR-23b, let-7e, and let-7d. [score:3]
The most abundant miRNAs that were detected in ARPE-19 cells were let-7b, let-7a, miR-125b, miR-24, miR-320, miR-23b, let-7e, and let-7d. [score:1]
Let-7b, miR-125b, miR-24, miR-23b, and let-7e represented the most abundant ones, while miR-210, miR-193b and miR-423 represented the less abundant ones. [score:1]
MiR-24 has been shown to regulate several cell cycle genes, the activin type 1 receptor ALK4 and dihydrofolate reductase [49- 51]. [score:1]
[1 to 20 of 6 sentences]
59
[+] score: 16
Let-7f, -7i, miR-24, -31 and -221 have been shown to be upregulated in infected epithelial cells or nasal mucosa of infected infants 70– 72. miR-221 and Let-7f have been recently shown to modulate RSV replication in epithelial cells 70, 71, while miR-24 expression facilitate porcine reproductive and respiratory syndrome virus (PRRSV) infection [73]. [score:6]
Similarly, miR-182-5p target include Flotillin 1 (FLOT-1) which is a component of exosomes, miR-24-3p may target apoptosis facilitator BCL2-like11, and interferon gamma (IFNG) genes. [score:5]
Xiao S MicroRNA miR-24-3p promotes porcine reproductive and respiratory syndrome virus replication through suppression of heme oxygenase-1 expressionJ. [score:5]
[1 to 20 of 3 sentences]
60
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Two of the six miRNAs showed a trend for a stronger upregulation during white adipocyte differentiation - miR-24-1* and miR-23b. [score:4]
The six miRNAs tending to demonstrate a stronger upregulation during the white adipocyte differentiation included miR-24-1* and miR-23b, members of a recently identified miR-23b cluster. [score:4]
Nevertheless, the miRNAs mir-34c, mir-143, mir-24, mir-720 and mir-21 showed robust expression in the adipocyte cultures, and these 5 miRNAs were thus profiled in subcutaneous adipose tissue from healthy humans with different BMIs to examine their regulation in adipose tissue expansion. [score:4]
Five miRNAs (mir-21, mir-143, mir-34c, mir-24 and mir-720) were profiled in subcutaneous adipose tissue from healthy humans with varying degrees of obesity. [score:1]
Of the 10 miRNAs that showed expression in the adipocyte cultures, we chose a subset of 5 miRNAs (mir-34c, mir-143, mir-24, mir-720 and mir-21) to measure in human adipose tissue RNA samples from obese persons (BMI >30, n = 10) and non-obese persons (BMI <30, n = 10). [score:1]
Our results, in combination with these previous observations, suggest that this mechanism might therefore involve miR-24-1 and miR-23b. [score:1]
Figure 4 Expression levels of mir-21, mir-24, mir-34c, mir-143 and mir-720 were measured in subcutaneous adipose tissue of obese (BMI >30, n = 10) and non-obese (BMI <30, n = 10) healthy persons. [score:1]
[1 to 20 of 7 sentences]
61
[+] score: 16
These studies included differential miRNA expression in central epithelium of transparent and cataractous lenses [22] with overexpression of let-7b in lenses with greater opacity [23]; downregulation of miR-29b increasing fibrosis risk in Tenon’s fibroblasts after glaucoma filtering surgery [24]; miR-24 blocking p53 tumor surveillance contributing to retinoblastoma [25]; and downregulation of miR-146a [26] and miR-200b [27] in retinal endothelial cells in diabetics. [score:11]
Regulation of p14ARF expression by miR-24: a potential mechanism compromising the p53 response during retinoblastoma development. [score:5]
[1 to 20 of 2 sentences]
62
[+] score: 16
Generally, these modified isomiRs had lower percentage of total expression from a given miRNA locus, although other isomiRs from the same locus were highly expressed (for example hsa-miR-24, Figure 2 and Figure 5). [score:5]
We only found one common isomiR among normal and diseased samples (hsa-miR-24–65-A, “65” indicated the end site on hsa-mir-24-1). [score:3]
For example, modified isomiRs of hsa-miR-24 showed various length distributions, and additional nucleotide could be added 3′ end of canonical miRNA sequence, shorter or longer isomiRs (Figure 2). [score:1]
Sequence in pink box is canonical hsa-miR-24 sequence in the miRBase database. [score:1]
These isomiRs are showed according to start and end sites on hsa-mir-24-1 sequence. [score:1]
0021072.g002 Figure 2 Hsa-miR-24 is the most abundant miRNA in the three samples. [score:1]
Hsa-miR-24 is the most abundant miRNA in the three samples. [score:1]
Hsa-miR-24 was the most abundant miRNA, while only 3 miRNAs were shared by the three samples (Table 1 and Figure 3A). [score:1]
For example, hsa-miR-24 had several modified isomiRs, but adenosines and uridines were dominant additional nucleotides (Figure 2A). [score:1]
For example, several of them were modified isomiRs of hsa-miR-24 (Table 2 and Figure 2A). [score:1]
[1 to 20 of 10 sentences]
63
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
The effect of masculinization treatment with either a synthetic androgen (17-α-methyl testosterone) or an inhibitor of cytochrome P450 aromatase (Fadrozole) on miRNA expression has been studied in Atlantic halibut; masculinization treatment resulted in differential expression of let-7a, miR-19b, miR-24, and miR-202-3p in gonads (Bizuayehu et al. 2012b). [score:7]
In Sertoli cell-specific Dicer conditional knockout mouse mo del, miR-125a-3p, miR-872, and miR-24 have role in translational control during spermatogenesis (Papaioannou et al. 2011). [score:4]
A rainbow trout spleen cell line, RTS34, was used in target validation of a miRNA in Atlantic halibut, which confirmed the binding of miR-24 to the 3′-UTR of kiss peptin 1 receptor-2 (Bizuayehu et al. 2013). [score:3]
The roles of other maternally stocked miRNAs, such as miR-24, miR-30, miR-126, miR-146, and miR-221 (Ma et al. 2012; Juanchich et al. 2013) remain to be uncovered. [score:1]
Juanchich et al. (2013) let-7, miR-10, miR-21, miR-24, miR-25, miR-30, miR-143, miR-146, miR-148, and miR-202 Rainbow trout NGS ? [score:1]
[1 to 20 of 5 sentences]
64
[+] score: 16
Other miRNAs from this paper: hsa-let-7e, hsa-mir-17, hsa-mir-24-2, hsa-mir-106a, hsa-mir-484
Similarly, miR-24 also tended to be downregulated in Intercept platelets by nearly two fold (albeit not reaching statistical significance), as we reported previously [11]. [score:4]
Moreover, the two miRNAs (miR-484 and miR-24) were found to be strongly correlated with each other (Fig 6C), suggesting that they depart from the Intercept -treated platelets along with their predicted target mRNAs. [score:3]
Ensembl gene ID Gene symbol microRNA Correlation ENSG00000204427 ABHD16A hsa-miR-24 1.0 ENSG00000204427 ABHD16A hsa-miR-484 1.0 ENSG00000047644 WWC3 hsa-miR-484 1.0 ENSG00000130052 STARD8 hsa-miR-484 0.9 ENSG00000168488 ATXN2L hsa-miR-484 0.7 ENSG00000128578 FAM40B hsa-let-7e 0.7 ENSG00000100030 MAPK1 hsa-miR-106a 0.7 ENSG00000100030 MAPK1 hsa-miR-17 0.7 ENSG00000100030 MAPK1 hsa-miR-24 0.7 ENSG00000100030 MAPK1 hsa-miR-484 0.7 ENSG00000149480 MTA2 hsa-miR-484 0.7 ENSG00000163590 PPM1L hsa-miR-24 0.7 ENSG00000163590 PPM1L hsa-miR-484 0.7 ENSG00000158352 SHROOM4 hsa-miR-24 0.7 ENSG00000158352 SHROOM4 hsa-miR-484 0.7 ENSG00000134668 SPOCD1 hsa-miR-24 0.7 ENSG00000134668 SPOCD1 hsa-miR-484 0.7 ENSG00000182253 SYNM hsa-miR-484 0.7 ENSG00000139722 VPS37B hsa-miR-24 0.7 ENSG00000139722 VPS37B hsa-miR-484 0.7To infer the most pronounced miRNA-mRNA relationships in Intercept platelets, we increased the stringency of the analysis and considered only those mRNAs that were differentially expressed below the p-value threshold of 0.001. [score:2]
Ensembl gene ID Gene symbol microRNA Correlation ENSG00000204427 ABHD16A hsa-miR-24 1.0 ENSG00000204427 ABHD16A hsa-miR-484 1.0 ENSG00000047644 WWC3 hsa-miR-484 1.0 ENSG00000130052 STARD8 hsa-miR-484 0.9 ENSG00000168488 ATXN2L hsa-miR-484 0.7 ENSG00000128578 FAM40B hsa-let-7e 0.7 ENSG00000100030 MAPK1 hsa-miR-106a 0.7 ENSG00000100030 MAPK1 hsa-miR-17 0.7 ENSG00000100030 MAPK1 hsa-miR-24 0.7 ENSG00000100030 MAPK1 hsa-miR-484 0.7 ENSG00000149480 MTA2 hsa-miR-484 0.7 ENSG00000163590 PPM1L hsa-miR-24 0.7 ENSG00000163590 PPM1L hsa-miR-484 0.7 ENSG00000158352 SHROOM4 hsa-miR-24 0.7 ENSG00000158352 SHROOM4 hsa-miR-484 0.7 ENSG00000134668 SPOCD1 hsa-miR-24 0.7 ENSG00000134668 SPOCD1 hsa-miR-484 0.7 ENSG00000182253 SYNM hsa-miR-484 0.7 ENSG00000139722 VPS37B hsa-miR-24 0.7 ENSG00000139722 VPS37B hsa-miR-484 0.7 To infer the most pronounced miRNA-mRNA relationships in Intercept platelets, we increased the stringency of the analysis and considered only those mRNAs that were differentially expressed below the p-value threshold of 0.001. [score:2]
Correlations are shown between miR-484 and ABHD16A (a), miR-24 and ABHD16A (b) and between miR-24 and miR-484 (c). [score:1]
Ensembl gene ID Symbol miRNA Correlation ENSG00000185262 FAM100B hsa-miR-484 -1.0 ENSG00000100325 ASCC2 hsa-miR-484 -0.9 ENSG00000182087 C19orf6 hsa-miR-24 -0.9 ENSG00000182087 C19orf6 hsa-miR-484 -0.9 ENSG00000137343 ATAT1 hsa-miR-484 -0.9 ENSG00000119004 CYP20A1 hsa-miR-17 -0.9 ENSG00000119004 CYP20A1 hsa-miR-484 -0.9 ENSG00000158161 EYA3 hsa-miR-24 -0.9 ENSG00000186642 PDE2A hsa-miR-24 -0.9 ENSG00000122741 DCAF10 hsa-miR-484 -0.9 ENSG00000180353 HCLS1 hsa-miR-484 -0.7 ENSG00000143851 PTPN7 hsa-miR-24 -0.7 ENSG00000143851 PTPN7 hsa-miR-484 -0.7 ENSG00000136868 SLC31A1 hsa-miR-17 -0.7 ENSG00000136868 SLC31A1 hsa-miR-24 -0.7 ENSG00000136868 SLC31A1 hsa-miR-484 -0.7 ENSG00000161888 SPC24 hsa-miR-484 -0.7 ENSG00000166548 TK2 hsa-miR-24 -0.7 ENSG00000166548 TK2 hsa-miR-484 -0.7 ENSG00000185651 UBE2L3 hsa-miR-484 -0.7 10.1371/journal. [score:1]
From this analysis, 2 different miRNA-mRNA pairs, both involving ABHD16A (miR-484• ABHD16A and miR-24• ABHD16A) were positively correlated that were found to be statistically significant (p<0.05) after performing regression analysis (Fig 6A–6B). [score:1]
0133070.g006 Fig 6Correlations are shown between miR-484 and ABHD16A (a), miR-24 and ABHD16A (b) and between miR-24 and miR-484 (c). [score:1]
Ensembl gene ID Symbol miRNA Correlation ENSG00000185262 FAM100B hsa-miR-484 -1.0 ENSG00000100325 ASCC2 hsa-miR-484 -0.9 ENSG00000182087 C19orf6 hsa-miR-24 -0.9 ENSG00000182087 C19orf6 hsa-miR-484 -0.9 ENSG00000137343 ATAT1 hsa-miR-484 -0.9 ENSG00000119004 CYP20A1 hsa-miR-17 -0.9 ENSG00000119004 CYP20A1 hsa-miR-484 -0.9 ENSG00000158161 EYA3 hsa-miR-24 -0.9 ENSG00000186642 PDE2A hsa-miR-24 -0.9 ENSG00000122741 DCAF10 hsa-miR-484 -0.9 ENSG00000180353 HCLS1 hsa-miR-484 -0.7 ENSG00000143851 PTPN7 hsa-miR-24 -0.7 ENSG00000143851 PTPN7 hsa-miR-484 -0.7 ENSG00000136868 SLC31A1 hsa-miR-17 -0.7 ENSG00000136868 SLC31A1 hsa-miR-24 -0.7 ENSG00000136868 SLC31A1 hsa-miR-484 -0.7 ENSG00000161888 SPC24 hsa-miR-484 -0.7 ENSG00000166548 TK2 hsa-miR-24 -0.7 ENSG00000166548 TK2 hsa-miR-484 -0.7 ENSG00000185651 UBE2L3 hsa-miR-484 -0.7 10.1371/journal. [score:1]
[1 to 20 of 9 sentences]
65
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
As previously described for many clustered miRNAs (Lagos-Quintana et al., 2003; Lim et al., 2003), Mir24.1 had an expression pattern similar to that observed for Mir23b, including expression in the nasal epithelium (Supplemental Figures 3A– C), tongue (Supplemental Figures 3E,F,H,I) and maxillary process epithelium (Supplemental Figure 3D), though expression in the palatal shelf mesenchyme and overlying epithelium (Supplemental Figures 3D,F,H,I) and trigeminal ganglia (Supplemental Figure 3G) was weak. [score:7]
Further, like the comparison between MiR23b and MiR24.1, expression of MiR206 was much weaker than the expression observed for MiR133b. [score:4]
We initially examined miRNA expression in E12.5 mouse embryo using whole mount ISH and LNA probes against Mir23b, Mir24.1, and Mir666 (Supplemental Figure 1). [score:3]
In mouse, Mir23b is part of a miRNA cluster that includes Mir23b, Mir27b, Mir3074.1, and Mir24.1. [score:1]
In zebrafish, this corresponds to mir23b, mir27d, and mir24.1. [score:1]
[1 to 20 of 5 sentences]
66
[+] score: 16
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
Of the down-regulated miRNAs a number have been reported to be down-regulated in prostate cancer relative to benign prostate tissues, i. e. miR-16 [23]– [25], miR-24 [26]– [28], miR-29a [26], miR-145 [23], [24], [27], [29], [30], and miR-205 [24], [31], [32]. [score:7]
[1 to 20 of 2 sentences]
67
[+] score: 15
One functional network connected up-regulation of the differentiation inhibitor ID2 mRNA to down-regulation of the hematopoiesis- or cell cycle regulating miR-125b-5p, miR-181a-5p, miR-196a-5p, miR-24-3p and miR-320d in adult PreBII large cells. [score:10]
0070721.g007 Figure 7 Note connection of miR-125b-5p to ID2 and involvement of the hematopoiesis related miR-181a-5p and miR-196a-5p, and the cell cycle regulating miR-24-3p. [score:2]
Note connection of miR-125b-5p to ID2 and involvement of the hematopoiesis related miR-181a-5p and miR-196a-5p, and the cell cycle regulating miR-24-3p. [score:2]
Notably, the network also included the hematopoiesis associated miR-181a-5p [17] and miR-196a-5p [33], and the cell cycle associated miR-24-3p [34] and finally miR-320d. [score:1]
[1 to 20 of 4 sentences]
68
[+] score: 15
The mitogen-activated protein kinase (MAPK) signaling pathway was associated with the smallest P-value (1.8×10 [−11]) among the pathways targeted by the five miRNAs over-expressed in NPC exosomes, which included hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908. [score:5]
For example, miR-20a-5p, miR-24-3p, and miR-106a-5p converge on MAPK1 and miR-20-5p and miR-106a-50 converge on TAOK3, demonstrating a combinatorial effect of miRNAs on the same target. [score:3]
E. The identification of five over-expressed miRNAs in P-serum-EXOs/N-serum-EXOs, TW03 (EBV [+])-EXOs/NP69-EXOs, and TW03 (EBV [−])-EXOs/NP69-EXOs: hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908. [score:3]
Five miRNAs, including hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908, were commonly over-expressed in the exosomes from P-serum and TW03 (EBV [+]) or TW03 (EBV [−]) cells (Fig. 5E). [score:3]
Our results showed that five exosomal miRNA clusters, including hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908, were abundant in NPC tumor-derived exosomes from patient sera or TW03 cell lines versus the exosomes from healthy donor sera or NP69 cells. [score:1]
[1 to 20 of 5 sentences]
69
[+] score: 15
The virus -induced decrease of miR-24 benefits the expression of furin, the target of miR-24, and promotes the furin -mediated proteolytic activation of HA precursor [66]. [score:5]
Human miR-24, as the representative of this type, is robustly downregulated by the highly pathogenic avian-origin H5N1 strain in A549 cells. [score:4]
Mice with lower Dicer activity are more susceptible to vesicular stomatitis virus (VSV) due to impairment of miR24 and miR93 expression [46]. [score:3]
Loveday E. K. Diederich S. Pasick J. Jean F. Human microRNA-24 modulates highly pathogenic avian-origin H5N1 influenza A virus infection in A549 cells by targeting secretory pathway furin J. Gen. [score:3]
[1 to 20 of 4 sentences]
70
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
Lal A. Pan Y. Navarro F. Dykxhoorn D. M. Moreau L. Meire E. Bentwich Z. Lieberman J. Chowdhury D. miR-24 -mediated downregulation of H2AX suppresses DNA repair in terminally differentiated blood cells Nat. [score:6]
Firstly, the DNA damage transducer genes, ATM is itself targeted by miR-421 in Hela cells [23], whilst H2AX is regulated by miR-24 in terminally differentiated human blood cells [24]. [score:4]
Ectopic expression of miR-421 causes a phenotype resembling that seen in ATM patients characterized by cellular checkpoint changes and radiosensitivity [23], whereas miR-24 mediated suppression of H2AX causes sensitivity to gamma-radiation and genotoxic drugs [24]. [score:3]
These closely overlap with those that regulate DNA damage checkpoints, including miR-34a, miR-24 and members of the miR-106b cluster [83]. [score:2]
[1 to 20 of 4 sentences]
71
[+] score: 15
We have previously shown that L11 associates with miR-24, but not other Myc -targeting miRNAs including let-7b and miR-34c, to repress c-Myc expression in response to ribosomal stress [22]. [score:5]
Finally, c-myc mRNA stability and/or translation are negatively regulated by several microRNAs (miRNAs), such as Let-7 [19], miR-145 [20], miR-34c [21], miR-24 [22, 23], and miR-185 [24]. [score:4]
Interestingly, although L11 recruits miR-24 to the c-myc 3′-UTR in response to ribosomal stress (22), the binding of L11 and Ago2 to miR-24 following UV treatment was much less robust compared to that of miR-130a (Figs. 6E and 6F), suggesting that miR-130a plays a prevalent role over miR-24 in c-Myc down-regulation in response to UV irradiation. [score:3]
We previously found that ribosomal protein L11 (L11 thereafter) regulates c-Myc levels via miR-24 -mediated c-myc mRNA decay in response to ribosomal stress [22]. [score:2]
U2OS cells treated with or without UV were subjected to RNA-IP using control IgG or anti-Ago2 (E) or anti-L11 (F) antibodies, followed by RT-qPCR detection of miR-130a, miR-24 and the control U6 RNA. [score:1]
[1 to 20 of 5 sentences]
72
[+] score: 14
We noted that miRNAs (miR-328-5p, miRNA-26a, hsa-miR-4654, miR-4707-5p, miR-4487, miR-24-3p, miR-6824-5p, miR-4740-5p, miR-8074 and, miR-146a-5p) down-regulated in females with OA have a number of TLR related target genes as per miRNA target prediction software’s (targetscan, miRwalk2.0 and microRNA. [score:10]
The miRNAs (miR-24-3p, miR-26a-5p, miR-200a-3p) down-regulated in female OA samples are known to be elevated with estrogen treatment 51, 52, 55– 57. [score:4]
[1 to 20 of 2 sentences]
73
[+] score: 14
On the contrary, miR-24-1, a member of the miR23b cluster [16] that interferes with Transforming Growth Factor β (TGFβ) expression, was also up-regulated approximately 3-fold (p = 0.0048, unadjusted). [score:6]
Interestingly, miR-24-1 levels were increased following irradiation and miR-24-1 might influence angiogenesis, invasion and local immune response through down-regulation of TGFβ [16]. [score:4]
The expression levels of a number of microRNAs known to be involved in the regulation of cellular processes like apoptosis, proliferation, invasion, local immune response and radioresistance (e. g. miR-1285, miR-24-1, miR-151-5p, let-7i) displayed 2 - 3-fold changes after irradiation. [score:4]
[1 to 20 of 3 sentences]
74
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Within 6 hrs of the presence of E. coli, the expression of 6 miRNAs in MAC-T cells was significantly altered (P < 0.05), three were down regulated (bta-miR-193a-3p, miR-30c and miR-30b-5p) while three were up-regulated (bta-miR-365-3p, miR-184 and miR-24-3p) (Table  3). [score:7]
Five differentially expressed miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
Furthermore, the differential expression pattern of five miRNAs (bta-miR184, miR-24-3p, miR-148, miR-486 and bta-let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
Interestingly, our study shows that a different set of five miRNAs (miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli bacteria while another set of four (miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus bacteria. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 13
Interestingly, miR-222, miR-21 and miR-24 were up-regulated after differentiation while 2 h stimulation of monocytes with viable Salmonella did not affect their expression (Figure 6). [score:6]
Besides well-known protagonists such as miR-146 or miR-155, we identified the up-regulation of miR-21, miR-222, miR-23b, miR-24, miR-27a as well as miR-29 upon monocyte differentiation or infection, respectively. [score:4]
The design of the miR-Q approach allows simultaneous quantification of a canonical miRNA as well as its isomiRs as exemplified by miR-24 (Figure 5C). [score:1]
We performed comparative and paralleled spike-in experiments using synthetic canonical miR-24 as well as the A or U isomiRs, respectively. [score:1]
The columns in Figure 5C show triplicate determination of the linear range using synthetic miR-24 as well as synthetic isomiRs. [score:1]
[1 to 20 of 5 sentences]
76
[+] score: 13
Other miRNAs from this paper: hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-26a-2
The relative locations of RNA editing sites, miRNA target sites, as well as the predicted RNA secondary structures are illustrated in Fig.   7b, c. Both genes were confirmed as miRNA target genes (miR-24 targeting GOLGA3 and miR-26 targeting GINS1) (Supplementary Fig.   11,). [score:9]
To make miRNA sponge vectors, three copies of miR-24 and miR-26 target sequences were inserted into the 3′ UTR of a GFP reporter via EcoRI and BamH I cloning sites (Supplementary Table  2). [score:3]
A total of 2.5 μg miR-24 or miR-26 sponge vector were transfected into HEK293 cells. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 13
The loss of miR-24 targeting DHFR transcript due to a T-allele 14 nt downstream of the predicted target site was demonstrated to reduce the half life of the transcript [18]. [score:5]
A C-to-T polymorphism 14 nt downstream of the miR-24 target site on DHFR gene resulted in degradation of the target transcript [19]. [score:5]
c: The validated binding site for hsa-miR-24 in the 3' UTR of DHFR gene with 'U' allele 14 bp downstream is structured and hence, inaccessible for miRNA binding while the 'C' allele makes the target site totally unstructured thereby allowing miRNA binding. [score:3]
[1 to 20 of 3 sentences]
78
[+] score: 13
miR-24 expression is regulated by TGF-β, a potent positive and negative regulator of hematopoiesis [47], [48]. [score:5]
miR-222 targets p27Kip1 [55] while miR-24 suppresses p16 (INK4a) [56]. [score:5]
Both miR-24 and miR-16 regulate red cell production [49], [50], while miR-16 also modulates lymphoid development [51]. [score:3]
[1 to 20 of 3 sentences]
79
[+] score: 13
miR-24 is enriched in cardiac endothelial cells and upregulated after cardiac ischemia, and acts as a critical regulator of endothelial cell apoptosis and angiogenesis [36]. [score:5]
Furthermore, it has been reported that miR-24 suppression prevents the transition from compensated hypertrophy to decompensated hypertrophy by stabilizing junctophilin-2 expression and protecting the ultrastructure of T-tubule-sarcoplasmic reticulum junctions [37]. [score:5]
Li R. C. Tao J. Guo Y. B. Wu H. D. Liu R. F. Bai Y. Lv Z. Z. Luo G. Z. Li L. L. Wang M. In vivo suppression of microRNA-24 prevents the transition toward decompensated hypertrophy in aortic-constricted mice Circ. [score:3]
[1 to 20 of 3 sentences]
80
[+] score: 13
Among the interesting features of the ten genes is that five (ALDH1A1, CDH11, CH13L1, FGF2, and IGFBP5) were predicted by TargetScanHuman to be targeted by microRNA-23a and −23b cluster microRNAs (mir-23ab, mir-24, mir-27ab) and mir-204/211 (Table 7). [score:5]
Mir-24 and mir-204/211 are microRNAs experimentally confirmed to be expressed in the TM and to affect expression of some glaucoma-relevant genes [25, 26]. [score:5]
It would be of interest to determine if mir-24 and mir-204/211, predicted to target IGFBP-5 mRNA, may selectively affect specific isoforms. [score:3]
[1 to 20 of 3 sentences]
81
[+] score: 12
The expression levels of miR-17-5p, miR-593, miR-23a-5p, miR-586, miR-1180, miR-508-5p, miR-511, miR-646, miR-634, miR-149-5p, miR-24-3p, miR-1267, miR-504 and miR-1270 were upregulated. [score:6]
The expression levels of miR-17-5p, miR-593, miR-23a-5p, miR-586, miR-1180, miR-508-5p, miR-511, miR-646, miR-634, miR-149-5p, miR-24-3p, miR-1267, miR-504 and miR-1270 were upregulated (Fig. 2A) (P<0.05). [score:6]
[1 to 20 of 2 sentences]
82
[+] score: 12
This suggests that a virus-specific downregulation of furin-directed miRNAs such as miR-24 may represent a viral regulatory mechanism to govern the production of infectious virions. [score:6]
When an inhibitor of miR-664 is used, such as miR664i, molecules LIF and NEK7 are expressed normally, which counteracts the replication of influenza A. In studies examining the furin -dependent proteolytic activation of highly pathogenic influenza H5 and H7 viruses, the miR-24 response was shown to strongly decrease both furin messenger RNA (mRNA) levels and intracellular furin activity in A549 cells [43]. [score:5]
Cells transfected with miR-24 mimics showed a decrease of H5N1 infectious virions and a complete block of H5N1 virus spread that was not observed in cells infected with H1N1 virus. [score:1]
[1 to 20 of 3 sentences]
83
[+] score: 12
Mature miRNA expression could be classified into two groups: i) cardia-tissues: miRNAs rarely expressed in other tissues but expressed in gastric cardia, including miR-148a, miR-192, miR-200a and miR-200b; ii) quasi-ubiquitous: miRNAs expressed in many tissues and conditions, including miR-29c, miR-21, miR-24, miR-29b, miR-29a, miR-451, miR-31, miR-145, miR-26a, miR-19b and let-7b. [score:9]
The high expression levels of miRNAs identified by ultra-deep sequencing (in descending order: miR-29c, miR-21, miR-148a, miR-29a, miR-24, miR-29b, miR-192, miR-451, miR-145, miR-31, miR-200a, miR-19b, miR-200b, let-7b and miR-26a) were validated with the TaqMan miRNA assays (Life Technologies). [score:2]
hsa-miR-24 ANKRD52 ; UBN2 ; NFAT5 ; PTPRD ; KIAA2018 ; KIAA0355 ; CNOT6 ; SH3PXD2A ; SLC16A2 ; C11orf41 ; SCML2 ; PIK3R3 ; SP1 ; PLAG1 ; TP53INP1 ; ADAM19 ; PHLPPL; AMMECR1; CALCR; CSNK1G1. [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 12
Other pancreatic β-cell proliferation regulators include miR-24, which is highly expressed in pancreatic β-cells, further upregulated in the islets of genetic fatty db/db mice, and inhibits β-cell proliferation and insulin secretion by binding to two maturity-onset diabetes of the young genes, Hnf1α and Neurod1. [score:9]
Meanwhile, the expression of miR-24 increased from 2.0- to 3.5-fold in 8- and 12-week-old db/db mice, showing an increase with the aging of db/db mice [19]. [score:3]
[1 to 20 of 2 sentences]
85
[+] score: 12
Focusing on the miRNAs able to target different genes at the same time, we evidenced that the genes are targeted by twelve following miRNAs: hsa-miR24-3p, hsa-miR-6778-5p, hsa-miR-6514-3p, hsa-miR-5010-5p, hsa-miR-23a-5p, hsa-miR-25-5p, hsa-miR-6792-5p, hsa-miR-6866-5p, hsa-miR-4728-5p, hsa-miR-6825-5p, hsa-miR-6803-3p, hsa-miR-6794-5p (Table 2 and Figure 4). [score:5]
In fact, it is important to underline that hsa-miR-24-3p is up-regulated in gastric cancer and breast cancer and promotes cell growth, apoptosis and invasion mechanisms [101, 102]. [score:4]
Du W. W. Fang L. Li M. Yang X. Liang Y. Peng C. Qian W. O’Malley Y. Q. Askeland R. W. Sugg S. L. MicroRNA miR-24 enhances tumor invasion and metastasis by targeting PTPN9 and PTPRF to promote EGF signalingJ. [score:3]
[1 to 20 of 3 sentences]
86
[+] score: 12
Sang et al. identified microRNAs present in microvesicles and the supernatant of human follicular fluid, and microRNA-24 was found to regulate oestradiol concentrations and progesterone concentrations, which shows that the highly expressed microRNA-24 targets genes associated with reproductive, endocrine, and metabolic processes [31]. [score:6]
The results predicted that microRNA-24, microRNA-106a, microRNA-19b and microRNA-25 may be closely related to apoptosis; n = 3. Table 1 Predicted target genes analysis of microRNAs expressed in huMSC-EXOs. [score:5]
We predicted that microRNA-24, microRNA-106a, microRNA-19b and microRNA-25 may be closely related to apoptosis. [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 12
Neither miR-24 nor miR-31 alone was sufficient to alter development of multipotent MSCs to mature adipocytes, but in the presence of BMP2, miR-24 overexpression accelerated mature adipocyte marker expression, while miR-31 overexpression suppressed the adipogenic markers PPARG, CEBPA and aP2 [64]. [score:10]
Unlike mouse MSCs miR-31 and miR-24 were not reported to be altered during adipogenic differentiation of human multipotent MSCs [75, 76]. [score:1]
Opposing effects of miR-24 and miR-31 have been reported in the C3H10T1/2 multipotent mouse embryonic stem cell line treated with BMP2 to induce adipogenic differentiation [64]. [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 12
Deregulated miRNAs might show abnormal isomiR expression profiles in tumor cells, such as miR-194-5p (upregulated) and miR-24-3p (downregulated) (Figure 2). [score:10]
Some miRNAs, such as miR-24-3p (mir-24-2 gene is located in BX640708), always showed consistent deregulation patterns with their host lncRNAs (Figure 5). [score:2]
[1 to 20 of 2 sentences]
89
[+] score: 12
Other miRNAs from this paper: hsa-mir-24-2, hsa-mir-210, hsa-mir-221, hsa-mir-222
This study has determined that 197 of 217 genes are targeted and downregulated by only four of the miRNAs: miR-24, miR-210, miR-221, and miR-222 in which miR-24 was the most important because numerous target genes, represented in Tables 2 and 3, are controlled and regulated by miR-24. [score:9]
The miR-24 has been reported as most important miRNA and genes such as ACVR2B, GFRA1, and MTHFR are most involved in pancreatic cancer. [score:1]
In addition, miR-24, miR-210, miR-221, and miR-222 are the most important among miRNAs. [score:1]
The important one is miR-24. [score:1]
[1 to 20 of 4 sentences]
90
[+] score: 12
Recently, Xiang et al. compared the expressions of U6, miR-16 and miR-24 in serum following several freeze-thaw cycles, knowing that U6 expression gradually decreased after several cycles of freezing and thawing. [score:4]
Further, a recent study showed that exosomal miR-21 was highly upregulated in the CSF of Japanese Encephalitis Virus (JEV) patients, in which the detected difference was approximately five folds between JEV -positive patients and JEV -negative controls using the RT-PCR method and miR-93, miR-24 and miR-103 as internal controls [58]. [score:4]
In contrast, the expression of miR-16 and miR-24 remained relatively stable. [score:3]
Additionally, in a pancreatic cancer study we discussed above, the combination of miR-16 and miR-24 was even used to diagnose this cancer [47]. [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 11
We found 12 miRNAs (hsa-miR-21, hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i) that were consistently up-regulated in the senescent cells of all donors (Fig. 1A), whereas only three miRNAs of the 17–92 cluster were down-regulated (Fig. 1A). [score:7]
We identified 12 miRNAs to be up-regulated in senescence, comprising hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i. [score:4]
[1 to 20 of 2 sentences]
92
[+] score: 11
The presence of miR-24 highly expressed by both cell types and MVs was confirmed by in situ hybridization that showed the accumulation of miR-24 inside MSCs as a punctuate pattern and in MSC MVs (Figure 4 D and E). [score:3]
was conducted on HLSCs, MSCs and their MVs and performed using a miRCURY LNA detection probe against hsa-miR-24 (Exiqon, Vedbaek, Denmark), showing to be highly expressed by cells and MVs. [score:3]
D. hsa-miR-125b 157.2±44.7 hsa-miR-24 52.5±12.8 hsa-miR-222 120.1±10.7 hsa-miR-222 48.9±18.8 hsa-miR-24 70.9±25.4 hsa-miR-99a 43.3±7.5 hsa-miR-99a 67.9±5.4 hsa-miR-125b 37.8±0.2 hsa-miR-100 62.6±0.0 hsa-miR-100 37.2±0.3 hsa-miR-594 40.3±3.2 hsa-miR-31 30.9±12.3 hsa-miR-31 33.2±8.4 hsa-miR-19b 25.3±4.3 hsa-miR-16 29.4±3.1 hsa-miR-16 21.4±3. [score:1]
D. miRNAs MSCs MSC MVs HLSCs HLSC MVs hsa-miR-125b 296.2±82.55 66.1±57.6 51.3±0.25 20.4±3.15 hsa-miR-222 222.25±19.7 39.1±20.2 68.7±25.5 43.2±4.2 hsa-miR-24 135±46.85 40.75±29.6 72.3±17.4 54.4±18.5 hsa-miR-99a 125.7±9.9 23.7±14.1 59.1±10.2 15.0±1.8 hsa-miR-100 115. [score:1]
Panel D–F: Representative micrographs of in situ hybridization on MSCs (D) and MSC-derived MVs (E and F) using a probe for miR-24 or a scramble-miR probe (miR-Scr) as control. [score:1]
Moreover, miR-24 accumulation on MVs was also detected by immunogold electron-microscopy as shown in figure 4F. [score:1]
The following miRNAs were tested: miR-221 (line1), miR-99a (line 2), miR-222 (line 3), miR-24 (line 4), miR-410 (line 5), miR-21 (line 6), miR-100 (line 7), miR-214 (line 8), miR-31 (line9), miR-223 (line 12), miR-122 (line 13) and miR-451 (line 14). [score:1]
[1 to 20 of 7 sentences]
93
[+] score: 11
Target gene analysis for miR-24-3p and miR-151a-5p. [score:3]
We studied the expression of miR-215-5p in HepG2 cells with and without HBV replication by RT-qPCR after 48 h of doxycycline treatment, and we normalised using miR-24-3p, miR-151a-5p, and miR-425-5p. [score:3]
The best combination of genes was miR-130b-3p and miR-24-3p, lowering the stability value to 0.025 (Table  4). [score:1]
Table 1 Candidate reference genes for microRNA normalisation microRNA Sequence PubMed ID miR-17-5p CAAAGUGCUUACAGUGCAGGUAG 18375788 miR-24-3p UGGCUCAGUUCAGCAGGAACAG 22074795 miR-26b-5p UUCAAGUAAUUCAGGAUAGGU 18718003 miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG2213452918375788 miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA221345292151918418375788 miR-106a-5p AAAAGUGCUUACAGUGCAGGUAG1837578822788411 miR-130b-3p CAGUGCAAUGAUGAAAGGGCAU 20890088 miR-151a-5p UCGAGGAGCUCACAGUCUAGU 22745731 miR-191-5p CAACGGAAUCCCAAAAGCAGCUG221345292151918418375788 miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 21567136 miR-425-5p AAUGACACGAUCACUCCCGUUGA 20429937 miR-940 AAGGCAGGGCCCCCGCUCCCC 24488924 let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 24223986 The selected candidate RGs were analysed by RT-qPCR. [score:1]
Taking the amplification efficiencies into account (Table  3), the best combination to use in the present mo del system is miR-151a-5p, miR-425-5p, and miR-24-3p (Fig.   2). [score:1]
We identified miR-24-3p, miR-151a-5p, and miR-425-5p as the most valid combination of reference genes for microRNA RT-qPCR studies in our hepatitis B virus replicating HepG2 cell mo del. [score:1]
We identified miR-24-3p, miR-151a-5p, and miR-425-5p as the most valid combination of RGs to use for microRNA studies in this HBV-replicating HepG2 cell system and confirmed their validity with miR-215-5p. [score:1]
[1 to 20 of 7 sentences]
94
[+] score: 11
In a microarray study for proteins down regulated by miR-24 expression, it was observed that multiple genes whose expression was reduced do not have predictable target sequences. [score:8]
Using an algorithm that does not require a seed match, it was further confirmed that the miR-24 targeting sequences are indeed within the 3' UTRs of the repressed genes [18]. [score:3]
[1 to 20 of 2 sentences]
95
[+] score: 11
Importantly, several of these miRNAs (miR-24, miR-140, miR-182, miR-183, miR-328) are expressed in fetal or neonatal lung and their relative expression levels are modulated during lung development [26, 27] or in lung cancer [28– 30]. [score:6]
Of these, miR-140, miR-183, and miR-328 suppressed luciferase activity, while miR24 and miR-182 increased luciferase activity (Fig 3F, mouse, and S4A Fig and S4B Fig, human). [score:3]
Mature microRNA mimics for miR-24, miR-140, miR-182, miR-183, and miR-328 were then screened for their ability to regulate luciferase activity of the human or mouse FGF9 3’ UTR. [score:2]
[1 to 20 of 3 sentences]
96
[+] score: 11
While seven of the ten most highly expressed small RNA genes and gene families were highly expressed in all tissues (let7 family, mir-24-3p, mir-378a-3p, mir-21-5p) other highly expressed small RNAs (mir-143-3p, mir-126-3p) were specific to adipose tissue (average q-value of pairwise comparisons <0.1, ). [score:7]
The most highly expressed small RNAs (Figure 2A) have previously been associated with adipose development (mir-143-3p [38], mir-21-5p [12]), angiogenesis (mir-126-3p [39], mir-378a-3p [40]), and erythropoiesis (mir-24-3p [41], mir-451a [42]). [score:4]
[1 to 20 of 2 sentences]
97
[+] score: 11
This targeting mode is similar to miR-185-3p (a potential target sequence in the protein coding region of c-Myc mRNA [24]), while distinct from other c-Myc targeting miRNAs such as miR-145, let-7a, miR-24(target sites in 3’UTR of c-Myc [25– 27]). [score:9]
Several miRNA are known to be regulators of c-Myc in various different cancers including miR-24 in leukemia [26], miR-145 in oral squamous cell carcinoma [25], let-7a in burkitt lymphoma [27], miR-34a in renal cell carcinoma [33] and miR-185-3p in CRC [24]. [score:2]
[1 to 20 of 2 sentences]
98
[+] score: 11
Within the genetic background scanned for miRNA expression on Exiqon arrays, miR-24 and miR-26b were significantly correlated with GH and PRL, with miR-26b being reported to have a potential impact upon expression of the TF Pit-1 in GH3 cells by inhibiting the Pit-1 inhibitor called Lef-1 [59]. [score:9]
We selected the top 9 miRNAs (miR-200a, miR-200b, miR-182, miR-429, miR-183, miR-200c, miR-141, miR-96 and miR-24) showing the highest standard deviations. [score:1]
Of the 9 miRNAs, miR-24 shows the best correlation with GH and PRL (Fig 6C). [score:1]
[1 to 20 of 3 sentences]
99
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
With exception of miR-33a, miR223, miR-9, miR-24, and miR-429, whose expression level was low in activated B cells, such Prdm1 -targeting miRNAs were significantly upregulated by HDI. [score:8]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
[1 to 20 of 2 sentences]
100
[+] score: 11
We evaluated the correlation between miR-23a, miR-24 and miR-27a expression levels and Smad expression. [score:3]
MiR-23a, miR-24 and miR-27a expression in lung cancer cells. [score:3]
The miR-23a, miR-24 and miR-27a expression levels were quantified by quantitative reverse transcription-PCR (qRT-PCR) using TaqMan [®] MicroRNA Assay System (Applied Biosystems, Foster City, CA). [score:2]
In contrast, no correlation was observed between miR-24 or miR-27a and Smad2/3. [score:1]
In contrast, miR-24 and miR-27a belonging to the same cluster were induced in a Smad-independent manner in lung adenocarcinoma cells. [score:1]
We first investigated miR-23a, miR-24 and miR-27a expression levels in NSCLC cell lines, including 6 AC cell lines and 4 SCC cell lines. [score:1]
[1 to 20 of 6 sentences]