sort by

28 publications mentioning cel-mir-1

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 26
Other miRNAs from this paper: cel-let-7, cel-mir-35, cel-mir-52, cel-mir-58a, dme-mir-1, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, dme-bantam, mmu-let-7d, dme-let-7, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-1a-2, cel-lsy-6, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-1b, cel-mir-58b, mmu-let-7j, mmu-let-7k, cel-mir-58c
Translational activity was monitored through measurement of RL activity in the presence of miR-35 2′- O-Me inhibitor or a non-cognate miR-1 2′- O-Me inhibitor. [score:5]
RL-6×-miR-35-p(A) [0] reporter translation was specifically de-repressed when the extract was treated with a miR-35 2′- O-Me inhibitor, but not when supplemented with a non-cognate miR-1 control (Figure 5B). [score:5]
In untreated or mock -depleted extracts, a 2- to 4-fold increase in RL light counts was observed when a miR-35 2′- O-Me inhibitor was added prior to RL-6×-miR-35-pA [86] reporter translation, in comparison with a non-cognate miR-1 2′- O-Me control (Figure 4A, left panel). [score:5]
Translation counts were monitored over time in the presence of miR-35 or miR-1 2′- O-Me inhibitors. [score:5]
In a mock -depleted extract, as in an untreated extract, the reporter was significantly de-repressed when treated with miR-35 2′- O-Me inhibitor, but not when treated with a non-cognate miR-1 inhibitor (Figure 5C). [score:5]
S10 Worm lysate was pre-cleared with 25 μl of T1 streptavidin beads (Invitrogen) and non-specific 2′- O-Me oligonucleotides (miR-1, 10 pmol) for 1 h at 4°C with rotation. [score:1]
[1 to 20 of 6 sentences]
2
[+] score: 23
Mir-1 is known to have high expression levels in mammalian heart and muscle cells while mir-124 contributes to the cells of the nervous system [24]. [score:3]
Second, we have cloned the 1000 bp 5' flanking region of mir-1 and used it to construct an expression plasmid with green fluorescent protein as the reporter (data not shown). [score:3]
In both cases, we chose mir-1-1 as the representative of mir-1 -family and mir-124a-1 for the representative of mir-124 -family for human and mouse. [score:1]
Figure 4The frequency diagrams of the motif GANNNNGA occurrences in sequences 1000 bp upstream of mir-1 (panel a) and mir-124 (panel b) family members in C. elegans, C. briggsae, human and mouse. [score:1]
The multiple sequence alignment of the mir-1 family upstream sequences of C. elegans, C. briggsae, human and mouse. [score:1]
The abundance and conservation of this motif in the upstream of two old and important miRNAs, mir-1 and mir-124 suggest a connection to miRNAs with global specialized function. [score:1]
We draw the frequency diagrams of the motif GANNNNGA in the 1000 bp upstream sequences of mir-1 and mir-124 orthologs in these four species (Figure 4), and made the global alignments of mir-1 and mir-124 upstream sequences (Additional files 1 and 2). [score:1]
We found these motifs also from the mir-1 and mir-124 1000 bp upstream sequences in C. elegans and C. briggsae, thus strengthening the connection of these miRNAs with a muscle specific function in these two worms. [score:1]
In addition, this motif was observed to be most abundant in the upstream sequences of two important miRNAs, mir-1 and mir-124. [score:1]
Consistent with this result, the transfection of mir-1 duplexes to HeLa cells produced a heart and skeletal muscle profile. [score:1]
When comparing these results, we found that the motif GANNNNGA is especially abundant in the 1000 bp upstream sequences of miRNAs mir-1, mir-124 and mir-228 in both worms. [score:1]
In summary, the mir-1-1 1000 bp upstream sequences of human and mouse contain nearly as many occurrences of the motif GANNNNGA (21 and 20) as the corresponding sequences of mir-1 of C. elegans and C. briggsae (23 and 26). [score:1]
We also found the frequency distribution of the motif in the upstream sequences from human and mouse orthologs of mir-1 and mir-124 to approximately follow its corresponding distributions in the two worms, thus confirming the conserved nature of the motif. [score:1]
Click here for file The multiple sequence alignment of the mir-1 family upstream sequences of C. elegans, C. briggsae, human and mouse. [score:1]
To determine whether the motif GANNNGA is conserved in the upstream sequences of mir-1, mir-124 and mir-228 orthologs in other species, we located all its occurrences from 1000 bp upstream sequences of all miRNAs that, according to miRBase [17], belong to mir-1 or mir-124 family in human and mouse genomes. [score:1]
The 1000 bp upstream sequences of human and mouse miRNAs that belong to mir-1 and mir-124 families were downloaded from UCSC Genome Browser [40], and the multiple sequence alignments for the mir-1 and mir-124 families upstream sequences were made with ClustalW [37]. [score:1]
Prior to and independent from the current study, there has been keen interest in mir-1 and mir-124, two miRNAs with the most abundant GANNNNGA motifs. [score:1]
This motif was also found to be especially abundant in the upstream sequences of two old and biologically important miRNAs, mir-1 and mir-124, thus suggesting a connection between the number of motif instances in the upstream sequence close to a miRNA start site and a globally conserved function of the miRNA. [score:1]
Both human and mouse, have three miRNAs belonging to the mir-1 -family: mir-1-1, mir-1-2 and mir-206. [score:1]
[1 to 20 of 19 sentences]
3
[+] score: 19
Other miRNAs from this paper: cel-mir-39
In contrast, an acute bout of exercise seems to be followed by a transient upregulation of at least miR-1 and -133a in skeletal muscle, which may result in a transient decrease of protein synthesis (28). [score:4]
The muscle and/or heart-specific miR-1, -133, -206, -208b, and -499 seem to be involved during skeletal and/or cardiac muscle development, which both are of particular importance for the improvements of V̇ o [2max] during exercise training programs (11, 13, 35). [score:2]
In contrast, a significant portion of the genes (about 15–20%) are modulated by either miR-1 or -206, thereby giving an additional, indirect evidence for the relevance of our findings. [score:2]
Similarly, in mo dels of physiological cardiac hypertrophy, miR-1 and -133 were decreased (10). [score:1]
Chen JF Man del EM Thomson JM Wu Q Callis TE Hammond SM Conlon FL Wang DZ The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
The increase of miR-1, -133a, and -206 was highly correlated among themselves (R values between 0.85–0.90; P ≤ 0.001), whereas no significant correlation was found in relation to or between the other miRs (R values between −0.17 and 0.49; P > 0.05). [score:1]
For miR-1, -133a, and -206, moderate to strong correlations to V̇ o [2max] and running speed at individual anaerobic lactate threshold (V [IAS]) were found (Table 3, and Fig. 2). [score:1]
miR-1 showed a moderate, negative correlation with fractional shortening, whereas miR-133a was positively related to the thickness of intraventricular septum. [score:1]
Immediately after the marathon, a significant increase of miR-1, -133a, -206, -208b, and -499 was observed (Fig. 1, A–E). [score:1]
The potential suitability of selective miRs such as miR-1, -133a, and -206 as novel biomarkers of aerobic exercise capacity is suggested by their high correlation to standard performance parameters. [score:1]
The consisting correlations of miR-1, -133a, and -206 to aerobic capacity raise the question about an epigenetic effect on the well-known variability of exercise performance after training interventions, resulting from complex gene-environment interactions. [score:1]
Specifically, our data suggest that the skeletal muscle-related miR-1, -133, and -206 seem to be more relevant for adaptation of aerobic capacity than the heart-related miR-208b and -499. [score:1]
Fig. 1. Effects of a marathon run on various circulatory microRNAs (miRs): miR-1 (A), miR-133a (B), miR-206 (C), miR-499 (D), miR-208b (E), miR-21 (F), and miR-155 (G). [score:1]
First, whereas miR-1, -133a, and -206 consistently correlate with V̇ o [2max], only miR-133a moderately correlated with serum CK levels, an indicator for skeletal muscle cell damage. [score:1]
[1 to 20 of 14 sentences]
4
[+] score: 16
Indeed, decreased mRNA levels (in human HeLa cells) were observed for dozens of genes upon transfection of two distinct miRNAs, miR-1 and miR-124; it was also shown that the 3′ untranslated regions (UTRs) of these down-regulated mRNAs have significant complementarity to the 5′ extremity of the transfected miRNAs. [score:6]
In fact, most of the mRNAs encoding cytosolic sector subunits (A, B, D, E, F, and H) of a C. elegans vacuolar H [+]-ATPase contain a conserved target site for miR-1, suggesting a miRNA -mediated regulation of this proton-pumping complex. [score:4]
For example, we found that the predicted target set of C. elegans miR-1 (197 genes having a conserved ACAUUCC or CAUUCCA in their 3′UTRs) contains many genes involved in proton transport (p < 10 [−10]) and ATPase activity (p < 10 [−9]). [score:3]
Similarly, the target sites for miR-2/43 and miR-1 are coconserved in 12 genes (p < 10 [−6]). [score:3]
[1 to 20 of 4 sentences]
5
[+] score: 13
Mutants of miR-1-3p are resistant to levamisole -induced paralysis mediated by the increased expression of its targets unc-29 and unc-63, coding for a non-alpha and an alpha subunit of the nicotinic acetylcholine receptor, respectively. [score:5]
By far, the most highly-expressed miRNAs were miR-58-3p and miR-1-3p, accounting for 50.1% and 19.8%, respectively, of the reads that mapped to miRNAs in well-fed larvae and 48.5% and 18.2%, under starvation (Fig 5). [score:3]
The second most abundant miRNA, miR-1-3p, functions at neuromuscular junctions and is one of the most ancient animal miRNAs, with conserved expression during musculature differentiation in bilaterians [62, 63]. [score:3]
In Drosophila, the homologue of miR-1-3p is required for proper growth of larval muscle [64]. [score:1]
In particular, the expression of miR-58-3p was found to be in the range of 44–54% and that of miR-1-3p was between 22%-32%, when measured in embryo, L1, L2, L3, L4 and adult worms [57]. [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 12
Consistent with the observation that alg-1(ma192) mutations broadly affect miRNA expression, the abundance of all miRNAs tested (lin-4, miR-48, miR-241, miR-84, let-7, miR-1, miR-46, miR-58 and miR-79) was decreased in alg-1(ma192) mutants (Figure 2B). [score:4]
1004486.g004 Figure 4(A) Transcriptional reporters for lin-4, let-7 and miR-1 drive GFP-pest expression in an oscillatory manner during C. elegans post-embryonic development. [score:4]
Collectively, these results suggest that the expression patterns of lin-4, let-7 and mir-1 are dynamic throughout development and that the cyclical transcription of these miRNAs is mediated by their cognate promoter sequences. [score:4]
[1 to 20 of 3 sentences]
7
[+] score: 12
One homologous to mir-1, tsp-miR-1, was observed to express in three developmental stages of T. spiralis and may have similar functions. [score:4]
The following forward primers were designed to confirm the sequencing results of miRNAs that showed differential expression patterns: tsp-miR-100 5′-AAC CCG TAG ATC CGA ACT TGT GT-3′; tsp-let-7 5′-TGA GGT AGT AGG TTG TAT AGT T-3′; tsp-miR-228 5′-AAT GGC ACT GGA TGA ATT CAC GG-3′; tsp-miR-1 5′-TGG AAT GTA AAG AAG TAT GTA G-3′; tsp-miR-31 5′-AGG CAA GAT GTT GGC ATA GCT GA-3′; tsp-novel-108 5′-CTT GGC ACT GTA AGA ATT CAC AGA-3′; tsp-novel-83 5′-TTG AGC AAT TTT GAT CGT AGC-3′; tsp-novel-46 5′-TGG ACG GCG AAT TAG TGG AAG-3′; tsp-novel-86 5′-TGA GAT CAC CGT GAA AGC CTT T-3′; tsp-novel-21 5′-TCA CCG GGT AAT AAT TCA CAG C-3′. [score:2]
The mature miRNA of tsp-mir-1 and the complementary miR* are represented in red and blue respectively. [score:1]
For instance, tsp-miR-1-3p was detected at 1,515 TPM (transcripts per million) in the Ad stage, 9,759 in the NBL stage and 3,351 in the ML stage, respectively, whereas its counterpart tsp-miR-1-5p was much less abundant (Fig. 4, Table S5). [score:1]
Sequences and the number of sequencing reads matching the tsp-mir-1 hairpin were listed. [score:1]
Figure 4Sequence and predicted secondary stem-loop structure of tsp-mir-1 identified in T. spiralis. [score:1]
Five conserved miRNAs (tsp-miR-228, tsp-miR-100, tsp-let-7, tsp-miR-1 and tsp-miR-31) and five novel miRNAs (tsp-novel-108, tsp-novel-83, tsp-novel-46, tsp-novel-86 and tsp-novel-21) with relatively higher TPM values identified by sequencing were validated by qRT-PCR and Northern blot. [score:1]
Sequence and predicted secondary stem-loop structure of tsp-mir-1 identified in T. spiralis. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 11
For example, the miRNA miR-1 is expressed in muscles of Drosophila, the zebrafish, and the mouse [11, 56, 98]. [score:3]
Among the microRNAs for which mutations exist for flies and worms, Dmir-1 and C. elegans miR-1 are the most similar in sequence [56]. [score:2]
The muscle-specific Drosophila miRNA miR-1 is required for larval development and cardiac differentiation [56, 57]. [score:2]
For example, the severity of the muscle defect of C. elegans mir-1 mutants might depend on physiological conditions, as is the case for the Dmir-1 mutant phenotypes of Drosophila [56]. [score:1]
Whereas Dmir-1 loss-of-function mutant fly larvae display muscle degeneration and die [56], we found that C. elegans miR-1 loss-of-function mutant animals are fully viable. [score:1]
The first loss-of-function studies of miRNAs in the mouse have been reported demonstrating a role for miR-1 and miR-208 in cardiac growth in response to stress [61, 62] and miR-155/BIC in normal immune function [63, 64]. [score:1]
Despite these differences, the mir-1 miRNA family could have a conserved role in muscle homeostasis and function. [score:1]
[1 to 20 of 7 sentences]
9
[+] score: 10
They found miR-71, miR-1, and miR-60 were abundant in male and female parasites but the relative expression or copy number was higher in males, implying their role in adult maturation and development. [score:4]
There were stage specific miR expression observed in young and adult worm, though the miR-1, miR-77, and miR-44 were abundant in young and adult worm stage suggesting they might be crucial for the survival (Chang et al., 2013). [score:3]
The miR expression profile showed miR-1, let-7, miR72, miR87 and miR-124 were highly abundant in the muscle larvale, suggesting it’s potential role in growth and metabolism. [score:3]
[1 to 20 of 3 sentences]
10
[+] score: 9
Other miRNAs from this paper: cel-mir-58a, cel-mir-243, cel-mir-58b, cel-mir-58c
Although miR-243 is relatively depleted in ALG-1 immunoprecipitates (Figure 3), a mild level of upregulation was also detected in alg-1 mutant worms, while deletion of mir-1, the second miRNA targeting Y47H10A. [score:6]
5 sequence on miRBase revealed the presence of two microRNA binding sites within the 3′ UTR, one for miR-1 and one for miR-243. [score:1]
The alleles used in this study were alg-1(gk214), rde-1(pk3301), rde-1(ne300) rescued with rde-1::HA [16], alg-1::HA(pkIs2250) [17], mir-243(n4759); mir-1(gk276); rrf-1(pk1417); rrf-2(pk2040); rrf-3(pk1426). [score:1]
were readily detected in wild-type animals, and they were still present in alg-1 or mir-1 mutant worms (Figure 4A). [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 9
Other miRNAs from this paper: cel-let-7, cel-lin-4
In C. elegans, miR-1 negatively regulates the expression of two nicotinic acetylcholine receptor (nAChR) subunits, unc-29 and unc-63 [37]. [score:4]
Intriguingly, in mir-1 mutants the expression of both UNC-29 and UNC-63 subunits is increased, and this corresponds with decreased muscle sensitivity to acetylcholine and levamisole (Figure 1(b)). [score:3]
Given the high degree of conservation of some miRNA sequences across species, including the miR-1 sequence, C. elegans presents a suitable mo del system in which to functionally test potential miRNA-3′-UTR interactions, which cannot readily be examined directly in parasitic species. [score:2]
[1 to 20 of 3 sentences]
12
[+] score: 8
Two miRNAs, miR-58 and miR-1, which showed the highest expression in our total libraries, were abundantly expressed in animals of all developmental stages we examined, from embryo to young adult of hermaphrodites, and in young adult males (Figure 2). [score:6]
Similarly, C. elegans miR-1 has a broad and generalized role, as it is involved in the function of neuromuscular junctions [31], and a mir-1 homologue in Drosophila has an important role in muscle development [32]. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 5
Parallel analysis of miR-1 and several additional miRNAs across development shows that effects of loss of henn-1 are specific to its substrates and not due to generalized small RNA dysregulation in the henn-1 mutant (Figure 2B, Figure S5). [score:3]
Levels of miR-1 across development were assayed by Taqman qPCR. [score:1]
Total embryo RNA was probed for miR-1. Variable intensity of 5.8S rRNA bands in embryo indicates unequal loading. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 5
A network buffering function has also been suggested for the regulation of muscle development by miR-1 throughout evolution, regulation of the Wnt pathway by miR-8, and fine-regulation of Pten dosage by a variety of miRNAs [48]– [50]. [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 5
While most of the highly expressed parasite miRNAs are abundant in both the L3 and adult stage, there are a few exceptions, with mir-2b and let-7 being found only in the adult stage of B. pahangi (Figure 2A), while H. contortus mir-1 is present only in the L3 stage (Figure 2B). [score:3]
Additionally, function may only become apparent after detailed analysis, as demonstrated for C. elegans mir-1, which regulates synaptic signalling at neuromuscular junctions and influences sensitivity to levamisole [27]. [score:2]
[1 to 20 of 2 sentences]
16
[+] score: 5
Supporting this hypothesis is the genetic analysis of muscle microRNAs miR-1 and miR-133 in zebrafish, which were shown to refine the expression levels of their target transcripts in muscle [27]. [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 5
Additionally, we report that the mir-51 family interacts with multiple, diverse, miRNA regulated genetic pathways, including pathways regulated by the let-7 and mir-35 family miRNAs, as well as, miR-240/786, and miR-1. We provide evidence that is inconsistent with the mo del that the mir-51 family regulates miRNA biogenesis or miRNA activity. [score:4]
mir-1. Loss of mir-51 family members does not broadly enhance miRNA biogenesis or activity. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 4
All 21U RNA qPCR data from transgenic studies were normalized to miR-1 levels. [score:1]
21UR-synth blot was reprobed for miR-1. Endogenous ♀21UR-2502 is shown as a control. [score:1]
As a result of this normalization, some small RNAs whose levels are not detectable (cycle number >36) appear to be detected due to small variation in detection of miR-1. 21UR-synth is not detectable in non-transgenic animals at any stage at which it was assessed. [score:1]
Northern blot probe sequences used for this study: miR-1 5′ TACATACTTCTTTACATTCCA /3StarFire/ 3′; ♀21UR-2502 5′ CAGCAGTCTACTACAATTTCA /3StarFire/ 3′; 21UR-synth 5′ AGTCTACTACATCGCATATCA /3StarFire/ 3′. [score:1]
[1 to 20 of 4 sentences]
19
[+] score: 3
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-48, cel-mir-84, cel-mir-241, cel-lsy-6
For miR-1 Northern, the dashed line indicates that unrelated lanes have been removed between samples. [score:1]
Representative of RNA samples from synchronized populations at mid-L3 (for lin-4 and miR-1) and at mid-L4 (for let-7) of wild type N2 (WT), vps-52(ok853), alg-1(0) and ain-1(ku322) animals. [score:1]
C) Abundance of let-7, miR-1 and lin-4 miRNAs. [score:1]
[1 to 20 of 3 sentences]
20
[+] score: 3
Other miRNAs from this paper: cel-mir-71, cel-mir-72, cel-mir-74, cel-mir-228, cel-mir-248, cel-mir-255
EMBO J 80 Ikeda S He A Kong SW Lu J Bejar R 2009 MicroRNA-1 negatively regulates expression of the hypertrophy -associated calmodulin and Mef2a genes. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
1003592.g004 Figure 4 A. Bar graph representing the relative abundance of miRNAs enriched in the asynchronous neuronal miRISC IP, with a p<0.01 determined by a student's t-test (* except miR-1 and lsy-6). [score:1]
A. Bar graph representing the relative abundance of miRNAs enriched in the asynchronous neuronal miRISC IP, with a p<0.01 determined by a student's t-test (* except miR-1 and lsy-6). [score:1]
First, we noticed a moderate depletion of miR-1, a muscle-specific miRNA, from neuronal miRISCs (p<0.06) [4], [29]. [score:1]
[1 to 20 of 3 sentences]
22
[+] score: 3
Finally, in order to test whether neuronal activity regulates SKN-1 in the nervous system, we examined mutants with increased synaptic activity (dgk-1/diacylglycerol kinase or goa-1/Gαo) and mutants with decreased activity (unc-2/VGCC or unc-18/nSec1), as well as mutants lacking mef-2/MEF and mir-1/microRNA, which are involved in a retrograde synaptic signaling pathways that is dependent on nlg-1 [35]. [score:2]
The following strains were provided by the Caenorhabditis Genetics Center, which is funded by the NIH National Center for Research Resources (NCRR): sek-1(km4), pmk-1(km25), sgk-1(ok538), skn-1(zu67), nlg-1(ok259), clk-1(e2519), mef-2(gv1), mir-1(gk276), isp-1(gm150), and pink-1(ok3538). [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 2
In Addgene Inc Cambridge: USA 48 Simon DJ Madison JM Conery AL Thompson-Peer KL Soskis M 2008 The microRNA miR-1 regulates a MEF-2 -dependent retrograde signal at neuromuscular junctions. [score:2]
[1 to 20 of 1 sentences]
24
[+] score: 1
LIN-28 also did not interact with pre-lin-4, pre-miR-237 (a lin-4 relative), pre-miR-1 (an unrelated microRNA), or a control RNA, the Iron Response Element (IRE). [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
Other miRNAs from this paper: cel-mir-35, cel-mir-58a, cel-mir-243, cel-mir-58b, cel-mir-58c
In henn-1 mutant L4 larvae, which are enriched for ALG-3/4 class 26G siRNAs, the levels of three miRNAs (miR-1, miR-35 and miR-58) and an ALG-3/4 class 26G siRNA (26G siR-S5) derived from ssp-16 were each indistinguishable from wild type (Figure 6D and 6E). [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Other miRNAs from this paper: cel-mir-71, dme-mir-1, cel-mir-228, dme-mir-210
For example, Nrf2 abrogates mir-1 and miR-206 and affects lung carcinoma metabolism by reprogramming glucose metabolism toward the pentose phosphate pathway (PPP) and the tricarboxylic acid (TCA) cycle [215]. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
For instance, microRNA miR-1 microinjection induced a heritable murine hypertrophic cardiomyopathy. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Worth noting is that cel-miR-1/256/796, cel-miR-48/84/795 and cel-miR-81/82 have high homology to hsa-miR-1, hsa-let-7 and hsa-miR-143, which have been demonstrated to function in apoptosis in response to IR or microgravity [63– 68]. [score:1]
[1 to 20 of 1 sentences]