![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-let-7g |
|||||
Accession | MI0000433 (change log) | ||||
Symbol | HGNC:MIRLET7G | ||||
Description | Homo sapiens let-7g stem-loop | ||||
Gene family | MIPF0000002; let-7 | ||||
Literature search |
![]()
1077 open access papers mention hsa-let-7g | ||||
Stem-loop |
a u a ugagg -a a a 5' ggc gagguagu guuuguacaguu gucu ug uacc c ||| |||||||| |||||||||||| |||| || |||| 3' ccg uuccguca cggacaugucaa uaga ac augg c a - c ----- gg - c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
let-7g-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-let-7g-5p |
|
Accession | MIMAT0000414 |
Previous IDs | hsa-let-7g |
Sequence |
5 - ugagguaguaguuuguacaguu - 26 |
Deep sequencing | 50508337 reads, 159 experiments |
Evidence | experimental; cloned [2-3], Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-let-7g-3p |
|
Accession | MIMAT0004584 |
Previous IDs | hsa-let-7g* |
Sequence |
62 - cuguacaggccacugccuugc - 82 |
Deep sequencing | 1795 reads, 125 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|
4 |