Stem-loop sequence hsa-let-7e

Accession

MI0000066 (change log)

Previous IDs

hsa-let-7eL

Symbol

HGNC:MIRLET7E

Description

Homo sapiens let-7e stem-loop

Gene family

MIPF0000002; let-7

Literature search

1095 open access papers mention hsa-let-7e
(5997 sentences)

Stem-loop

     c   cu   g                u  ----gga  a 
5' cc ggg  gag uaggagguuguauagu ga       gg c
   || |||  ||| |||||||||||||||| ||       ||  
3' gg ccc  uuc auccuccggcauauca cu       cc a
     a   cu   g                -  agaggaa  c 

Deep sequencing

25331368 reads, 5.09e+04 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr19: 51692786-51692864 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000465190 ; SIGLEC20P-001; intron 6

  ENST00000595243 ; SIGLEC20P-001; intron 6

Clustered miRNAs

< 10kb from hsa-let-7e

• hsa-mir-99b: chr19: 51692612-51692681 [+]
• hsa-let-7e: chr19: 51692786-51692864 [+]
• hsa-mir-125a: chr19: 51693254-51693339 [+]

Database links

• EntrezGene:MIRLET7E
• HGNC:MIRLET7E
• RNAcentral:URS000075DE48_9606
• Rfam:let-7
• miRBase Tracker:MI0000066

Mature sequence hsa-let-7e-5p

• Accession: MIMAT0000066
• Previous IDs: hsa-let-7e
• Sequence: 8 - ugagguaggagguuguauaguu - 29
• Deep sequencing: 25324137 reads, 159 experiments
• Evidence: experimental; cloned [1-4], Northern [1], Illumina [5]
• Database links:
  • RNAcentral:URS000000B1C9_9606
• Predicted targets:
  • TargetMiner:hsa-let-7e-5p
  • TargetScanVert:hsa-let-7e-5p
  • miRDB:hsa-let-7e-5p
  • microrna.org:hsa-let-7e-5p

Mature sequence hsa-let-7e-3p

• Accession: MIMAT0004485
• Previous IDs: hsa-let-7e*
• Sequence: 53 - cuauacggccuccuagcuuucc - 74
• Deep sequencing: 7171 reads, 150 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS0000409B45_9606
• Predicted targets:
  • TargetMiner:hsa-let-7e-3p
  • TargetScanVert:hsa-let-7e-3p
  • miRDB:hsa-let-7e-3p
  • microrna.org:hsa-let-7e-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).