![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-12131 |
|||||
Accession | MI0039733 (change log) | ||||
Description | Homo sapiens miR-12131 stem-loop | ||||
Stem-loop |
---uccc u -u u
5' ugcccuuuauuugggaguacaccucuccaaaua acagu aac g
||||||||||||||||||||||||||||||||| ||||| |||
3' acgggaaauaaacccucauguggagagguuuau uguca uug a
cucccau u uu u
|
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-12131 |
|
Accession | MIMAT0049025 |
Sequence |
65 - uuuggagagguguacuccca - 84 |
Deep sequencing | 7 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:28471449
"Loss of miR-514a-3p regulation of PEG3 activates the NF-kappa B pathway in human testicular germ cell tumors"
Cell Death Dis. 8:e2759(2017).
|